Primer group for detecting urinary system infection pathogens and drug-resistant genes and application of primer group

Abstract

The invention discloses a primer group for detecting urinary system infection pathogens and drug-resistant genes and application of the primer group. The primer group comprises primers of which the nucleotide sequences are as shown in SEQ ID NO: 1-208. The primer group can be used for detecting various pathogens at the same time through multiple PCR amplification and pathogen targeted sequencing, drug-resistant genes and drug-resistant gene mutation are efficiently detected, and compared with a traditional detection method, the detection flux, the coverage range and the sensitivity are higher.

Description

Technical Field

[0001] The present application relates to the field of gene detection technology, and in particular to a primer set for detecting pathogens and drug-resistant genes of urinary tract infections and applications thereof. Background Art

[0002] Infectious diseases are common clinical diseases. They are mostly local or systemic inflammation or organ dysfunction caused by pathogens such as bacteria, viruses and fungi and their products. They are very harmful and have a high mortality rate. Urinary tract infection is one of the common clinical infectious diseases. According to statistics, there are 130 to 175 million patients with urinary tract infection worldwide each year. Urinary tract infections include simple urinary tract infections in children and adults (including the elderly), as well as infections caused by kidney disease, urinary stones, etc. On the basis of quickly and accurately identifying the cause of the disease, choosing a reasonable treatment plan can effectively control the occurrence and development of the disease.

[0003] Clinical epidemiological statistics show that common pathogens of urinary tract infection with positive urine culture include Enterobacteriaceae such as Escherichia coli, Pseudomonas aeruginosa, and Klebsiella pneumoniae, as well as Gram-positive cocci such as Enterococcus (Enterococcus faecium, Enterococcus faecalis, etc.) and Staphylococcus (Staphylococcus aureus, Staphylococcus haemolyticus, etc.). However, due to the widespread abuse of antibiotics, the increase in drug-resistant strains and changes in urinary tract flora have led to an increasing number of mixed bacterial infections, fungal infections, and mixed bacterial and fungal infections, which have brought severe challenges to clinical etiological diagnosis and anti-infection treatment. In addition to conventional bacterial and fungal infections, mycoplasmas, chlamydia, and viruses may also cause urinary tract infections, and their diagnosis becomes more complicated because these pathogens are difficult to clinically identify and culture.

[0004] The current conventional detection methods for etiology include morphological detection, culture separation, biochemical detection, immunological detection and nucleic acid detection (PCR, DNA restriction endonuclease analysis, nucleic acid probe method, etc.). Because these detection methods are simple to operate, rapid, and have low technical requirements, and have a certain diagnostic sensitivity and specificity, they are still widely used in clinical practice. However, traditional detection methods have limitations in sensitivity, specificity, timeliness, and information volume, and cannot quickly identify unknown or rare pathogenic microorganisms. At present, for conventional bacterial infections, traditional culture methods have difficulties in distinguishing mixed infections, and cannot detect viral infections such as polyomavirus; traditional molecular biology techniques such as PCR have disadvantages such as low throughput and limited detection of microorganisms; antigen-antibody detection has disadvantages such as low sensitivity and specificity.

[0005] The new generation of high-throughput sequencing technology (NGS sequencing technology) can quickly obtain pathogen and gene sequence information with the advantages of high throughput, large-scale, parallel sequencing and fast speed. These advantages assist and meet the needs of clinical pathogen infection detection. After 2020, the pathogen metagenomic detection technology (mNGS) based on NGS technology has achieved great success. It has been widely used in the etiological diagnosis of critical and severe diseases and difficult infections, especially in lower respiratory tract infections, bloodstream infections, and central nervous system infections. mNGS has become a second-line or even first-line detection technology.

[0006] There are two main methods for identifying microorganisms based on NGS, including metagenomic sequencing (mNGS) and pathogen-targeted sequencing (tNGS). Among them, mNGS sequencing technology is an unbiased sequencing of all nucleic acids in the sample, combined with a professional pathogenic microorganism database, to detect the pathogenic microorganism sequences contained in the sample, showing great advantages in diagnosing complex and severe infections such as blood infections, respiratory infections, bone and joint infections, encephalitis, etc.

[0007] Although mNGS has many advantages in clinical pathogen diagnosis, the technology still faces some challenges, such as the interference of the human cell genome on pathogen targeted gene detection, low detection rate of intracellular bacteria / fungi, low sensitivity of RNA virus detection, and difficulty in detecting drug-resistant genes. These factors will lead to low detection levels of pathogen nucleic acid sequences, false negative results of pathogens, and inability to clearly identify the pathogen species. The high cost of testing will also limit patients' choice of this technology. Summary of the invention

[0008] Based on this, it is necessary to provide a primer set for detecting pathogens and drug-resistant genes of urinary tract infections and its application. Specifically, a primer set for detecting pathogens and drug-resistant genes of urinary tract infections, a kit for detecting pathogens and drug-resistant genes of urinary tract infections, and a method for detecting pathogens and drug-resistant genes of urinary tract infections are provided.

[0009] The first aspect of the present application provides a primer set for detecting pathogens and drug-resistant genes of urinary tract infections, the primer set comprising primers having nucleotide sequences as shown in SEQ ID NOs: 1 to 208.

[0010] In some embodiments, a linker is further connected to each primer sequence in the primer set. Optionally, the nucleotide sequence of the linker is shown in SEQ ID NO: 209 or SEQ ID NO: 210.

[0011] The second aspect of the present application provides a kit for detecting pathogens and drug-resistant genes of urinary tract infections, the kit comprising the primer set described in the first aspect of the present application.

[0012] In some embodiments, the kit further comprises a label primer; the label primer has a barcode for identifying different samples.

[0013] In some embodiments, the kit further comprises a PCR amplification reagent; optionally, the PCR amplification reagent comprises a multiplex PCR amplification reagent; further optionally, the multiplex PCR amplification reagent comprises one or more of a PCR buffer, a multiplex amplification enzyme and dNTPs.

[0014] In some embodiments, the kit further comprises an internal reference primer.

[0015] The third aspect of the present application provides a method for detecting urinary system infection pathogens and drug resistance genes, the method comprising the following steps:

[0016] Using the kit of the second aspect of the present application to perform PCR amplification on the sample DNA to construct a library, thereby obtaining a library;

[0017] The library was sequenced.

[0018] In some embodiments, the method for detecting urinary tract infection pathogens and drug resistance genes satisfies one or more of the following conditions:

[0019] The sequencing is high-throughput sequencing, and optionally, the high-throughput sequencing is pathogen-targeted sequencing; and,

[0020] The PCR amplification is multiplex PCR amplification. Optionally, the multiplex PCR amplification includes a first step amplification and a second step amplification.

[0021] In some embodiments, the first step of amplification satisfies one or more of the following conditions:

[0022] The reaction system for PCR amplification comprises the primer set described in the first aspect of the present application, sample DNA, nuclease-free water, multiplex amplification enzyme, human gene internal reference gene primers and PCR buffer; optionally, the final concentration of the primer set in the reaction system is 0.05 μM to 0.2 μM; the final concentration of the sample DNA is greater than or equal to 0.2 ng / μL; the final concentration of the multiplex amplification enzyme is 0.9 U / μL to 1.1 U / μL; the final concentration of the human gene internal reference gene primer is 0.025 μM to 0.1 μM; and,

[0023] The amplified products were purified using magnetic beads.

[0024] In some embodiments, the second step of amplification satisfies one or more of the following conditions:

[0025] The reaction system of PCR amplification includes the first step amplification product, label primers, nuclease-free water, and PCR premix; optionally, the final concentration of the first step amplification product in the reaction system is 0.01 μM to 0.05 μM; the final concentration of the label primer is 0.5 μM to 2 μM; the PCR premix contains one or more of a hot start enzyme, dNTPs, a reaction buffer, and; and,

[0026] The amplified products were purified using magnetic beads.

[0027] The fourth aspect of the present application provides the use of the primer set for detecting urinary tract infection pathogens and drug-resistant genes described in the first aspect of the present application in the preparation of a product for detecting urinary tract infection.

[0028] The aforementioned primer set combined with multiplex PCR amplification and pathogen targeted sequencing (tNGS) can simultaneously detect multiple pathogens. Compared with traditional detection methods, the detection throughput, coverage, and sensitivity are higher. Compared with pathogenic microorganism metagenomic (mNGS) detection, the detection cost is lower, and the detection sensitivity of drug-resistant genes and drug-resistant gene mutations is higher.

[0029] Furthermore, the detection method provided in one embodiment of the present application has a low data volume requirement for the detection of clinical samples, and the data volume required for a single sample is as low as 0.4M reads. Therefore, the sequencing cost is relatively low, and multiple samples can be detected at the same time, which is more suitable for clinical detection of pathogens and drug sensitivity of urinary tract infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the technical solutions in the implementation methods and examples of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for use in the description of the implementation methods or examples. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0031] Figure 1 The distribution of the number of bacterial positive species detected in one embodiment of the present application;

[0032] Figure 2 The distribution of the number of fungus-positive species detected in one embodiment of the present application. DETAILED DESCRIPTION

[0033] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present application are given in the drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the present application belongs. The terms used herein in the specification of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0035] In this application, "optionally", "optional", and "optional" mean optional or dispensable, that is, any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent.

[0036] In the present application, "preferred", "better", "more preferred" and "suitable" are only used to describe implementation methods or examples with better effects. It should be understood that they do not constitute limitations on the scope of protection of the present application.

[0037] The terms "having", "containing", "including" and "comprising" used in this application are synonymous, which are inclusive or open-ended and do not exclude additional, uncited members or features. Members or features include materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features include actions, conditions for the occurrence of actions, timing, states, etc.

[0038] In this application, the technical features or technical solutions described in an open language include closed technical features or technical solutions composed of the listed contents, and also include open technical features or technical solutions containing the listed contents.

[0039] In this application, if the unit of the data range is followed only by the right endpoint, it means that the units of the left endpoint and the right endpoint are the same. For example, 1-3 μL means that the units of the left endpoint "1" and the right endpoint "3" are both μL, which have the same meaning as 1 μL-3 μL. In addition, similar descriptions involving other parameters also apply to the above understanding.

[0040] In this application, if there are multiple steps involved in the method flow, unless there is a clear different description in this document, there is no strict order restriction for the execution of these steps, and they can be executed in other orders than described. Moreover, any step can include multiple sub-steps or multiple stages, and these sub-steps or stages are not necessarily executed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be executed in turn, alternating or simultaneously with other steps or parts of sub-steps or stages of other steps.

[0041] In the present application, exemplary descriptions such as "in some implementation modes (or examples)" and "in one implementation mode (or example)" may include but are not limited to the following meanings: these solutions may be combined with other solutions in a suitable manner to form new technical solutions.

[0042] In the present application, the terms "first", "second", "third", "fourth", etc. in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc. are used only for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

[0043] In this application, "greater than or equal to", "greater than or equal to" and "≥" have the same meaning and can be used interchangeably; "less than or equal to", "less than or equal to" and "≤" have the same meaning and can be used interchangeably; "greater than" can be equivalently expressed as ">" and "less than" can be equivalently expressed as "<". In this application, unless otherwise specified, "greater than or equal to" and "≥" can be regarded as providing two solutions of "greater than" and "equal to". In this application, unless otherwise specified, "less than or equal to" and "≤" can be regarded as providing two solutions of "less than" and "equal to".

[0044] In the present application, when it comes to a numerical interval (i.e., a numerical range), unless otherwise specified, the distribution of the optional numerical values ​​in the numerical interval is considered to be continuous, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical interval, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to an integer in the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints, which is equivalent to directly listing each integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical range disclosed herein should be understood to include any and all sub-ranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. "Numerical interval" allows broadly including numerical interval types such as percentage intervals, ratio intervals, and ratio intervals.

[0045] Traditional pathogen detection methods have limitations in terms of sensitivity, specificity, timeliness, and information content, and are unable to quickly identify unknown or rare pathogenic microorganisms. Although mNGS has many advantages in clinical pathogen diagnosis, its technology still faces some challenges, such as the interference of human cell genomes in pathogen targeted gene detection, low detection rates of intracellular bacteria / fungi, low sensitivity of RNA virus detection, and difficulty in drug-resistant gene detection. These factors will lead to low levels of pathogen nucleic acid sequence detection, false negative results of pathogens, and the inability to clearly identify pathogen species. The high cost of testing will also limit patients' choice of this technology.

[0046] tNGS technology, which uses super-multiplex PCR to amplify target pathogen nucleic acid sequences and cooperates with NGS sequencing to detect common pathogens, can effectively solve the technical and cost disadvantages of mNGS:

[0047] 1) tNGS is not affected by human genes, bacterial genes, and other background gene fragments, so the data utilization rate is high and the sequencing cost is greatly reduced;

[0048] 2) Designing multiple pairs of amplification primers for pathogens and amplifying targeted species can effectively enrich the abundance of target pathogens in samples, greatly improving the detection sensitivity of pathogens compared to traditional PCR technology;

[0049] 3) It can effectively enrich genes and gene mutations related to bacterial antibiotic resistance, and significantly improve the detection rate of bacterial resistance genes compared with mNGS technology.

[0050] Based on this, the embodiments of the present application at least provide a primer set for detecting pathogens and drug-resistant genes of urinary tract infections and its application. Specifically, a primer set for detecting pathogens and drug-resistant genes of urinary tract infections, a kit for detecting pathogens and drug-resistant genes of urinary tract infections, and a method for detecting pathogens and drug-resistant genes of urinary tract infections are provided.

[0051] In a first aspect of the present application, a primer set for detecting pathogens and drug-resistant genes of urinary tract infections is provided, the primer set comprising primers having nucleotide sequences as shown in SEQ ID NOs: 1 to 208.

[0052] In some embodiments, a linker is connected to each primer in the primer set, and further connected to the 5' end of each primer.

[0053] In the present application, unless otherwise specified, a "linker" is added to the 5' end of a primer and is used for sequencing primer binding and completing sequence determination during the sequencing process.

[0054] In some embodiments, the nucleotide sequence of the linker is shown as SEQ ID NO:209 or SEQ ID NO:210.

[0055] In a second aspect of the present application, a kit for detecting pathogens and drug-resistant genes of urinary tract infections is provided, the kit comprising the primer set of the first aspect of the present application.

[0056] In some embodiments, the kit further comprises a label primer, and the label primer has a barcode for identifying different samples.

[0057] In some embodiments, the nucleotide sequences of the tag primers are shown in SEQ ID NO:211 and SEQ ID NO:212.

[0058] In this application, unless otherwise specified, "tag primer" refers to a molecular tag used to distinguish different samples in high-throughput sequencing, including two upstream and downstream primers.

[0059] In this application, unless otherwise specified, "Barcode" is added to the DNA fragment of each sample as a unique label so that the data of each sample can be distinguished and attributed after the mixed sample is sequenced.

[0060] In some embodiments, the kit further comprises a PCR amplification reagent, and optionally, the PCR amplification reagent comprises a multiplex PCR amplification reagent; further, the multiplex PCR amplification reagent comprises one or more of a PCR buffer, a multiplex amplification enzyme, and dNTPs.

[0061] In this application, unless otherwise specified, "multiplex amplification enzyme" refers to a special DNA polymerase used for multiplex PCR.

[0062] In some embodiments, the kit further comprises an internal reference primer. In a non-limiting manner, the internal reference primer is selected from human gene internal reference gene primers.

[0063] In a third aspect of the present application, a method for detecting urinary system infection pathogens and drug resistance genes is provided, comprising the following steps:

[0064] S100: Using the kit of the second aspect of the present application to perform PCR amplification on the sample DNA to construct a library, thereby obtaining a library.

[0065] S200: Sequence the library.

[0066] In some embodiments, the sample is processed and nucleic acid is extracted before multiplex PCR amplification and library construction of the sample DNA, wherein the sample is mainly urine, including one or more of routine clean midstream urine (morning urine), suprapubic bladder puncture urine, indwelling catheter catheterization and bladder catheterization.

[0067] In some embodiments, nucleic acid extraction can be performed on a sample using conventional extraction methods in the art, such as, but not limited to, one or more of acid extraction, chloroform extraction, or magnetic bead extraction.

[0068] In some embodiments, in step S100, the PCR amplification is multiplex PCR amplification, further comprising a first step amplification and a second step amplification.

[0069] In some embodiments, in the first amplification step, the PCR amplification reaction system includes the primer set of the first aspect of the present application, sample DNA, nuclease-free water, multiplex amplification enzymes, human gene internal reference gene primers and PCR buffer.

[0070] In some embodiments, in the first amplification step, the final concentration of the primer set is 0.05 μM to 0.2 μM. Without limitation, the final concentration of the primer set can be 0.05 μM, 0.1 μM, 0.15 μM, 0.2 μM, 0.05 μM or a value or range between any two of the above values.

[0071] In some embodiments, in the first amplification step, the final concentration of the sample DNA is greater than or equal to 0.2 ng / μL. Non-limitingly, the final concentration of the sample DNA can be, but is not limited to, 0.2 ng / μL, 0.3 ng / μL, 0.4 ng / μL, 0.5 ng / μL, or a value between any two of the above values ​​or above.

[0072] In some embodiments, in the first amplification step, the final concentration of the multiplex amplification enzyme is 0.9-1.1 U / μL. Without limitation, the final concentration of the multiplex amplification enzyme can be 0.9 U / μL, 1.0 U / μL, 1.1 U / μL, or a value or range between any two of the above values.

[0073] In some embodiments, in the first amplification step, the final concentration of the human gene internal reference gene primer is 0.025 μM to 0.1 μM. Without limitation, the final concentration of the human gene internal reference gene primer can be 0.025 μM, 0.05 μM, 0.075 μM, 0.1 μM, or a value or range between any two of the above values.

[0074] In some embodiments, in the first amplification step, the amplified product is purified by magnetic beads.

[0075] In some embodiments, in the second step amplification, the reaction system includes the first step amplification product, label primers, nuclease-free water and PCR premix.

[0076] In some embodiments, the PCR master mix includes one or more of a hot start enzyme, dNTPs, and a reaction buffer.

[0077] In some embodiments, in the second step amplification, the final concentration of the first step amplification product is 0.01 μM to 0.05 μM. Without limitation, the final concentration of the first step amplification product can be 0.01 μM, 0.02 μM, 0.03 μM, 0.04 μM, 0.05 μM, or a value or range between any two of the above values.

[0078] In some embodiments, in the second step amplification, the final concentration of the index primer is 0.5 μM to 2 μM. Without limitation, the final concentration of the index primer can be 0.5 μM, 1 μM, 1.5 μM, 2 μM, or a value or range between any two of the above values.

[0079] In some embodiments, in the second step of amplification, the amplified product is purified by magnetic beads.

[0080] In some embodiments, in step S200, sequencing is high-throughput sequencing, and further is pathogen-targeted sequencing.

[0081] In some embodiments, in step S200, sequencing is performed using MGISEQ or DNBSEQ sequencing platforms.

[0082] In some embodiments, the library is subjected to DNB amplification prior to high-throughput sequencing.

[0083] In this application, unless otherwise specified, "DNB amplification" refers to the use of the rolling circle amplification (RCA) principle to amplify the single-stranded circular DNA library to form DNA nanoballs, which can avoid the occurrence of error accumulation during the amplification process and effectively improve the sequencing accuracy.

[0084] In the fourth aspect of the present application, there is provided use of the primer set of the first aspect of the present application or the kit of the second aspect of the present application in the preparation of a product for detecting urinary tract infection.

[0085] Some examples are provided below.

[0086] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which the conditions are not specified in the following examples are preferably referred to the guidance given in the present application, and can also be based on the experimental manual or normal conditions in the art, or can also be based on the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.

[0087] In the following examples, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operating accuracy are allowed.

[0088] Embodiment 1:

[0089] The specific technical solutions adopted in this application are as follows:

[0090] 1. Primer Design and Synthesis

[0091] This application covers a total of 43 common clinical urinary tract infection-related pathogens and 6 drug resistance genes, including Acinetobacter baumannii, Citrobacter freundii, Citrobacter kremeri, Enterobacter cloacae complex, Escherichia coli, Klebsiella pneumoniae, Morganella morganii, Mycobacterium tuberculosis complex, Proteus mirabilis, Pseudomonas aeruginosa, Pseudomonas putida, Serratia marcescens, Stenotrophomonas maltophilia, Corynebacterium striata, Enterococcus faecalis, Enterococcus faecium, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus hemolyticus, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, The resistant genes (non-mutated) included KPC, NDM, OXA-23, mecA, vanA, and CTX-M. Multiple primers were designed and screened for the above species and the regions where the resistant genes were located (primer sequences are shown in Table 1).

[0092] Primers were synthesized according to the designed primer sequences and mixed into a pool named YK UT panelMix.

[0093] Table 1

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100] The 5' end of the primers must also include an MGI-UDB tag sequence, wherein the primers shown in SEQ ID NOs: 1 to 104 must be added with an F-tag: TCAGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 209); the primers shown in SEQ ID NOs: 105 to 208 must be added with an R-tag: GTCTTCCTAAGACCGCTTGGCCTCCGACTT (SEQ ID NO: 210).

[0101] 2. Sample pretreatment and nucleic acid extraction

[0102] The sample types involved in this application are mainly urine, including routine clean midstream urine (morning urine), suprapubic bladder puncture urine, indwelling catheter catheterization, bladder catheterization, etc. It is recommended to collect 2 to 10 mL of sample. After sample collection, it should be processed within 24 hours and stored at 2℃ to 8℃. For long-term storage, it should be stored at -20℃ or -80℃.

[0103] Optionally, 2 to 10 mL of urine sample is centrifuged before extraction (4000 rpm, 10 min), the supernatant is removed, and 400 μL to 1000 μL of the lower precipitate is taken.

[0104] Urine samples need to be broken before nucleic acid extraction: take out the grinding tube, add 1000uL of lysis solution into the grinding tube, add 400μL to 1000μL of the sample to be tested, preferably 800μL; perform wall breaking for 420s on a wall breaking instrument (power 165W; speed 18M / s).

[0105] Nucleic acid extraction: The nucleic acid was extracted from the above samples using the acid extraction or purification reagent (magnetic bead method) of Guangzhou Daan Gene Co., Ltd.

[0106] 1) Take the supernatant of the sample after cell wall disruption, place it in a 2 mL centrifuge tube, add 30 μL high affinity silica-based magnetic beads and 40 μL proteinase K, and vortex thoroughly to mix;

[0107] 2) Place the centrifuge tube in a constant temperature shaking metal bath, incubate at 70°C for 12 min (speed 1000 rpm), let stand and then centrifuge instantly;

[0108] 3) Place the centrifuge tube on the magnetic rack. After the magnetic beads are completely adsorbed, carefully remove the liquid with a pipette, being careful not to absorb the magnetic beads.

[0109] 4) Add 800 μL of washing solution 1 to the centrifuge tube, vortex mix for 1 min, let stand and then centrifuge instantly;

[0110] 5) Place the centrifuge tube on the magnetic rack. After the magnetic beads are completely adsorbed, carefully remove the liquid with a pipette, being careful not to absorb the magnetic beads.

[0111] 6) Add 800 μL of washing solution 2 to the centrifuge tube, vortex mix for 1 min, let stand and then centrifuge briefly;

[0112] 7) Place the centrifuge tube on the magnetic rack. After the magnetic beads are completely adsorbed, carefully remove the liquid with a pipette, being careful not to absorb the magnetic beads.

[0113] 8) Repeat steps 6) and 7);

[0114] 9) Centrifuge the centrifuge tube for 10 seconds, place the centrifuge tube on the magnetic rack, and after the magnetic beads are completely adsorbed, carefully remove the liquid with a pipette, being careful not to absorb the magnetic beads, and open the lid to dry for 3 to 5 minutes;

[0115] 10) Add 100 μL of elution buffer to the centrifuge tube, vortex to mix, incubate at room temperature for 5 minutes, place on the magnetic rack, and transfer the nucleic acid solution to a new sterile centrifuge tube after the magnetic beads are completely adsorbed.

[0116] DNA was quantified using Qubit4.0 Nucleic Acid Quantifier. If subsequent experiments are not continued immediately after nucleic acid extraction, it can be stored at -20°C (within 1 month).

[0117] 3. Library Construction and Sequencing

[0118] Multiplex PCR library construction was performed using a multiplex library reconstruction kit. The first step amplification primer was YK UT panel mix, which was used to amplify the target sequence of the pathogen of interest. The second step amplification primer was MGI-UDB tag primer (including two upstream and downstream primers), which was used to add sample-specific barcode sequences to the amplified product sequence to identify different samples. MGI-UDB is a universal amplification primer for sample-specific barcode sequences, and the primer sequences are: PCR2-F: CTCTCAGTACGTCAGCAGTTnnnnnnnnnnCAACTCCTTGGCTCACAGAACGACATGGCTACGA (SEQ ID NO: 211); PCR2-R: GCATGGCGACCTTATCAGnnnnnnnnnnTTGTCTTCCTAAGACCGCTTGGCC (SEQ ID NO: 212), where nnnnnnnnnn is a sample-specific tag (barcode) of 10 bases, and n is any base among A / T / G / C; the upstream of PCR2-F primer also needs to be phosphorylated. There are 288 numbered MGI-UDB index primers, and each numbered MGI-UDB index primer has at least one primer barcode sequence (10 bases) difference. The library construction system involved in this application is suitable for MGISEQ or DNBSEQ sequencing platforms manufactured by MGI.

[0119] (1) In the first step of amplification, the amount of amplified DNA template is 0.1ng-500ng, and the reaction system is as shown in Table 2. Among them, in the YK UTpanel Mix primers, the final concentration of the microbial and drug resistance gene primers is 0.05-0.2μM, preferably 0.1μM; the final concentration of the human gene internal reference gene primer is 0.025-0.1μM, preferably 0.05μM. Among them, the human gene internal reference gene primer is the human GAPDH internal reference gene primer, and the sequence is F1: CCAGCAAGAGCACAAGAGGAAGAGA (SEQ ID NO: 213); R1: CCTCTTCAAGGGGTCTACATGGCAA (SEQ ID NO: 214).

[0120] Table 2

[0121]

[0122] The reaction procedure is shown in Table 3 below:

[0123] Table 3

[0124]

[0125] (1) Purification of the first step amplification product: The first step amplification product was adsorbed with MagPure A3 XP 1 beads (1.2×) and washed twice with 80% ethanol. The remaining 80% ethanol in the tube was discarded as much as possible and placed at room temperature until dry. Finally, the magnetic beads were resuspended in 23 μL of nuclease-free water (NFW) and eluted to obtain the purified product, which was placed in a -20°C refrigerator.

[0126] (2) The second step is amplification reaction. The reaction system is shown in Table 4, where MGI-UDB is a universal amplification primer for the sample-specific Barcode sequence:

[0127] Table 4

[0128] Components Volume (μL) NFW 10 2x Hifi Mix 25 MGI-UDB 5 The first purified product 10 Total 50

[0129] The reaction procedure is shown in Table 5 below:

[0130] Table 5

[0131]

[0132]

[0133] (1) Sorting of the second-step amplification product: MagPure A3 XP 1 beads (0.75×) were used to adsorb the non-target fragments in the second-step amplification product to remove them, and then MagPure A3 XP 1 beads (0.9×) were used to adsorb the product purified in the previous step, and washed twice with 80% ethanol. The remaining 80% ethanol in the tube was discarded as much as possible, and the tube was placed at room temperature to dry. Finally, 20 ul of NFW was used to resuspend the magnetic beads to elute the purified product.

[0134] (2) Qubit4.0 was used to measure the library concentration. A concentration of >0.4 ng / μL indicated that the library concentration was qualified. Agilent2100 was then used to detect that the main peak fragments of a normal library were 240 bp and 350 bp, and there was no contamination by adapters or large fragments, indicating that the quality control was qualified. At this point, the eluted product was a library that could be loaded onto the machine and was placed in a -20°C refrigerator for long-term storage.

[0135] (3) Sequencing on a machine: according to the throughput and total library requirements of the sequencer, as well as the concentration of the sample library, all libraries are mixed together, DNB amplified, and then sequenced on the machine. The amount of data on the machine is allocated according to 0.5M reads to 5M reads, preferably 1M reads.

[0136] 4. Data Analysis

[0137] (1) Data quality control filtering

[0138] The original test data was filtered using Fastp software (v0.22.0), and the filtering parameters for analysis were: a). Removal of sequences containing adapters (dimers); b). Removal of sequences with an average base quality control value lower than 15; and removal of sequences with a base number N greater than 5; c). The minimum length of polyG tail trimming was 10 bp, and the length of 3-end polyX trimming was 10 bp. After the above processing, the filtered Clean FASTQ file was obtained.

[0139] (2) Database comparison

[0140] Clean FASTQ sequences were aligned with the target amplified sequences using BWA mem (v0.7.17) to obtain the alignment sam file, and the sam file was statistically analyzed using a statistical script, retaining the results with a similarity of more than 90% with the target amplified sequence, and calculating the total number of each target amplified sequence.

[0141] (3) Analysis of drug resistance mutations

[0142] The sam file obtained in step 2 was subjected to variation analysis using bcftools software, and the results were matched with the known variation site database to obtain the total number of site mutation sequences and mutation frequency.

[0143] (4) Data Statistics

[0144] The database comparison results and mutation analysis results were annotated to the species information using a script to obtain the number of detected sequences for each species, as well as the total number of drug-resistant gene sequences and mutation frequency.

[0145] Embodiment 2:

[0146] Based on the analysis of the detection sensitivity of species within the detection range of this application

[0147] The positive reference tNGS MIXA and the negative reference NC were prepared with cultured bacteria, fungi and viruses, and the concentration was confirmed by digital PCR (ddPCR) technology. tNGS MIXA was diluted 10 times, 100 times, and 1000 times to tNGSMIXA1, MIXA2, and MIXA3, respectively. The matrix was human cell line, such as Hela cells (concentration was 1.00E+06 cell / mL). The pathogens and concentrations contained in all references are shown in Table 6 below:

[0148] Table 6

[0149]

[0150]

[0151] The above urinary system panel was tested with positive references and negative references of all concentration gradients, and the detection limit / analysis sensitivity was analyzed by the number of analyzed sequences and the judgment results. The statistical results of the number of pathogen detection reads of each gradient positive reference are shown in Table 7:

[0152] Table 7

[0153] Species name tNGS MixA tNGS MixA1 tNGS MixA2 tNGS MixA3 Human herpesvirus type 1 92531 139691 125475 37834 Staphylococcus aureus 151 107 14 5 Streptococcus pneumoniae 3987 620 778 139 Klebsiella pneumoniae 7767 1769 1256 256 Pseudomonas aeruginosa 32323 7668 5937 1255 Mycoplasma hominis 2809 282 44 7 Aspergillus fumigatus 1241 283 99 4

[0154] According to the positive threshold of ≥10 reads, the detection limits of various pathogens were obtained by comparing and analyzing the above detection results, as shown in Table 8:

[0155] Table 8

[0156] Pathogens Detection limit (CFU / mL, copies / mL) Human herpesvirus type 1 1E+01 Staphylococcus aureus 1E+02 Streptococcus pneumoniae 1E+01 Klebsiella pneumoniae 1E+01 Pseudomonas aeruginosa 1E+01 Mycoplasma hominis 1E+02 Aspergillus fumigatus 1E+02

[0157] The results showed that the detection limit of the above detection kit for DNA viruses was 10^1 copies / mL, the detection limits for Gram-negative bacteria, mycoplasma and Aspergillus were 10^1 CFU / mL, 10^2 CFU / mL and 10^2 CFU / mL respectively, and the detection limit for Gram-positive bacteria was between 10^1 and 10^2 CFU / mL. The detection limits of the above species were higher than those of traditional PCR, multiplex PCR or PCR-based flow fluorescence detection technology.

[0158] Embodiment 3:

[0159] Comparison of species identification performance between tNGS testing and urine culture and mNGS testing

[0160] For a total of 167 urine samples with suspected urinary tract infection and positive culture, the above-mentioned urine tNGS test and pathogenic microorganism metagenomic (mNGS) test were performed in parallel to analyze the sensitivity and accuracy of tNGS and mNGS tests in clinical sample test results. The 167 samples included 149 bacteria-positive and 18 fungus-positive samples, of which 164 were cultured for a single species and 3 were multi-species positive (Escherichia coli + Proteus mirabilis, Streptococcus agalactiae + Staphylococcus aureus, and Escherichia coli + Enterococcus faecium). The positive species were as follows: Figure 1 and Figure 2 shown.

[0161] After analysis of tNGS and mNGS test results:

[0162] 1) Among the 167 culture-positive urine samples, the species of 7 samples were out of the detection range of tNGS. Among the 160 samples within the detection range, tNGS detected and reported 159 positive samples. The clinical sensitivity within the detection range was 99.38% (159 / 160).

[0163] 2) Among 167 samples, mNGS detected and reported 166 positive cases, and the clinical sensitivity of the test was 99.41% (166 / 167).

[0164] 3) The detection results of tNGS and mNGS in the same sample were different from those of culture. In this sample, the culture-positive species was Escherichia coli, while both tNGS and mNGS detected Serratia marcescens. The detection consistency of tNGS and mNGS was 95.81% (160 / 167).

[0165] The above results show that the consistency of tNGS detection results with mNGS within the detection range is 100% (160 / 160), and the performance of tNGS is basically consistent with mNGS in real-world samples (including species outside the detection range of tNGS) (95.81% consistency). At the same time, it shows that tNGS detection of 53 pathogens can cover most of the bacteria and fungi of clinical concern (95.81%).

[0166] Embodiment 4:

[0167] Comparison of tNGS detection and urine drug sensitivity test in the consistency of antibiotic drug sensitivity

[0168] The 121 urine samples with culture and drug sensitivity analysis were analyzed for drug resistance genes by tNGS and mNGS, among which the culture-positive species were Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, Acinetobacter baumannii, Proteus mirabilis, Enterococcus faecium, Enterococcus faecalis and Staphylococcus aureus, and the drug resistance genes related to ESBL, CRE, VRE and MRSA were analyzed respectively. The analysis results are as follows:

[0169] 1) The detection rate of tNGS in cephalosporin resistance genes, which are most related to urinary tract infections, is much higher than that of mNGS (28.93% vs 13.23%), which reflects the advantages of tNGS in drug resistance gene detection. The detection numbers of drug resistance genes by tNGS and mNGS are shown in Table 9:

[0170] Table 9

[0171]

[0172] 2) The overall consistency between tNGS and drug sensitivity results was 76.85% (93 / 121), and the overall consistency between mNGS and drug sensitivity results was 69.43% (84 / 121). The consistency between tNGS and drug sensitivity results was higher than that of mNGS.

[0173] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0174] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims, and the description and drawings may be used to interpret the contents of the claims.

Claims

1. A primer set for detecting pathogens and drug-resistant genes of urinary tract infections, characterized in that: The primer set includes primers whose nucleotide sequences are shown as SEQ ID NOs: 1-208.

2. The primer set according to claim 1, characterized in that Each primer in the primer set is also connected to a linker; Optionally, the nucleotide sequence of the linker is shown as SEQ ID NO:209 or SEQ ID NO:

210.

3. A kit for detecting pathogens and drug-resistant genes of urinary tract infections, characterized in that: The kit comprises the primer set according to claim 1 or 2.

4. The kit according to claim 3, characterized in that The kit also includes a label primer; the label primer has a barcode for identifying different samples.

5. The kit according to claim 3 or 4, characterized in that The kit also includes a PCR amplification reagent; Optionally, the PCR amplification reagent comprises a multiplex PCR amplification reagent; Further optionally, the multiplex PCR amplification reagent includes one or more of a PCR buffer, a multiplex amplification enzyme and dNTPs.

6. The kit according to any one of claims 3 to 5, characterized in that The kit also includes an internal reference primer.

7. A method for detecting pathogens and drug-resistant genes of urinary tract infections, characterized in that: The method comprises the following steps: Using the kit as described in any one of claims 3 to 6 to perform PCR amplification on the sample DNA to construct a library, to obtain a library; and, The library was sequenced.

8. The method for detecting urinary system infection pathogens and drug resistance genes according to claim 7, characterized in that: Meet one or more of the following conditions: The sequencing is high-throughput sequencing, and optionally, the high-throughput sequencing is pathogen-targeted sequencing; and, The PCR amplification is multiplex PCR amplification. Optionally, the multiplex PCR amplification includes a first step amplification and a second step amplification.

9. The method for detecting urinary system infection pathogens and drug resistance genes according to claim 8, characterized in that: The first step of amplification satisfies one or more of the following conditions: The reaction system for PCR amplification comprises the primer set as claimed in claim 1 or 2, sample DNA, nuclease-free water, multiplex amplification enzyme, human gene internal reference gene primers and PCR buffer; optionally, the final concentration of the primer set in the reaction system is 0.05 μM to 0.2 μM; the final concentration of the sample DNA is greater than or equal to 0.2 ng / μL; the final concentration of the multiplex amplification enzyme is 0.9 to 1.1 U / μL; the final concentration of the human gene internal reference gene primer is 0.025 μM to 0.1 μM; and, The amplified products were purified using magnetic beads.

10. The method for detecting urinary system infection pathogens and drug resistance genes according to claim 9, characterized in that: The second step amplification satisfies one or more of the following conditions: The reaction system of PCR amplification includes the first step amplification product, label primers, nuclease-free water, and PCR premix; optionally, the final concentration of the first step amplification product in the reaction system is 0.01 μM to 0.05 μM; the final concentration of the label primer is 0.5 μM to 2 μM; the PCR premix contains one or more of a hot start enzyme, dNTPs, and a reaction buffer; and, The amplified products were purified using magnetic beads.

11. Use of the primer set for detecting pathogens and drug-resistant genes of urinary tract infections as claimed in claim 1 or 2 in the preparation of a product for detecting urinary tract infections.

Images