Molecular markers located on chromosome 4 and associated with drought resistance in alfalfa and their application

Abstract

The present invention provides a molecular marker located on chromosome 4 and related to drought resistance of alfalfa and its application, belonging to the field of biotechnology. The nucleotide sequence of the inserted or deleted fragment is shown in the sequence table SEQ ID NO.3. The primer pair used to amplify the molecular marker has a nucleotide sequence shown in SEQ ID NO.1-2. The molecular marker and the primer pair described in the present invention can identify or assist in identifying the drought resistance trait of alfalfa. At the same time, the present invention also provides a method for rapidly identifying the drought resistance and drought-resistant genotype of alfalfa using the molecular marker. The method is simple and rapid, the identification results are accurate, and it has good prospects for promotion and application.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to an InDel molecular marker related to drought resistance of alfalfa located on chromosome 4 and an application thereof. Technical Background

[0002] Molecular markers offer high accuracy through genetic selection, eliminating the influence of environmental factors on phenotypic assessment. Molecular markers can accelerate screening, significantly shorten breeding cycles, and improve breeding efficiency. They can help discover and utilize genetic diversity and protect genetic resources. Furthermore, molecular markers are widely adaptable and applicable to breeding and improvement of a wide range of crops, reducing the waste of breeding resources. By providing precise genetic typing information, they support more effective genomic selection, further accelerating the development of superior varieties, making breeding more scientific and efficient, and promoting sustainable agricultural development.

[0003] Genome-wide association analysis (GWA) has attracted considerable attention in the field of breeding. By analyzing the associations between a large number of genetic markers and target traits, key genes or loci associated with these traits can be identified. The research and application of this technology has become a major hotspot and competitive area in current breeding. Drought-resistant breeding in alfalfa (Medicago sativa L.) is crucial for improving crop drought tolerance, increasing yields, and reducing resource consumption. Against the backdrop of climate change and increasingly scarce water resources, developing drought-resistant varieties can enhance crop growth and adaptability to drought conditions, reduce disaster risks, maintain agricultural production stability, promote sustainable agricultural development, and increase economic benefits for farmers. This is crucial for ensuring food security and sustainable ecological improvements. Alfalfa breeding started relatively late, and reports on the development and mapping of drought-resistant markers using GWA are very limited. Therefore, the development of molecular markers associated with drought resistance in alfalfa is crucial for establishing assisted selection breeding systems, improving germplasm resources, and breeding new varieties. Summary of the Invention

[0004] One of the objectives of the present invention is to provide an InDel molecular marker related to drought resistance of alfalfa.

[0005] A second object of the present invention is to provide an application of the above-mentioned InDel molecular marker related to drought resistance of alfalfa.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The drought resistance-related InDel molecular marker disclosed in the present invention is located on chromosome 4 of alfalfa, and the molecular marker is named Ms_Chr4_23084811.

[0008] The primer pair for amplifying the InDel molecular marker related to drought resistance of alfalfa, the primer pair sequence corresponding to the molecular marker Ms_Chr4_23084811 is:

[0009] Ms_Chr4_23084811-F: CGATGTATTCACCACTGTTTAACATAA (shown in SEQ ID NO. 1);

[0010] Ms_Chr4_23084811-R: GCGAAGCTTTATTAATGCTATAAACAC (shown in SEQ ID NO. 2).

[0011] The present invention also discloses the use of the aforementioned molecular marker primer pair in drought-resistant assisted breeding of alfalfa. Specifically, the molecular markers of the present invention can be used in future molecular marker-assisted breeding. By extracting DNA from leaves at the seedling stage and detecting the presence of the molecular markers of the present invention, drought-resistance-related traits of alfalfa varieties can be identified. The detection can be performed using PCR, specifically the aforementioned molecular marker primer pair. The detection can also be performed using sequencing.

[0012] The present invention also discloses the application of the molecular marker in identifying drought resistance traits of alfalfa, especially in screening and identifying the drought resistance of alfalfa. Specifically, the specific steps for identifying whether alfalfa has drought resistance traits are as follows:

[0013] (1) The DNA of the test germplasm was used as a template for PCR amplification, and the primer pair corresponding to the molecular marker Ms_Chr4_23084811 was used for PCR amplification. The reaction system of PCR amplification is shown in Table 1:

[0014] Table 1 PCR amplification reaction system

[0015]

[0016] Pre-denaturation at 94°C for 4 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 59°C for 30 s, and extension at 72°C for 20 s; extension at 72°C for 10 min; and storage at 4°C.

[0017] (2) Agarose gel electrophoresis detection of PCR products: Take 3 μL and judge the drought resistance of alfalfa based on the results of the bands.

[0018] PCR amplification was performed using primer pairs Ms_Chr4_23084811-F and Ms_Chr4_23084811-R. If the PCR amplification product had only one characteristic band with a length of 300 bp as shown in SEQ ID NO.4, the alfalfa was a drought-sensitive type; if the PCR amplification product had only one characteristic band with a length of 263 bp as shown in SEQ ID NO.5, or had both one characteristic band with a length of 300 bp as shown in SEQ ID NO.4 and one characteristic band with a length of 263 bp as shown in SEQ ID NO.5, the alfalfa was a drought-resistant type.

[0019] In addition, the present invention also protects a kit for identifying the drought resistance trait of alfalfa, comprising the primer pair Ms_Chr4_23084811-F and Ms_Chr4_23084811-R. The other components of the kit are conventional reagents, including 10× PCR buffer, dNTPs, and Taq DNA polymerase. The present invention does not specifically limit the concentration of the primer pair; primer concentrations well known in the art may be used. The present invention does not specifically limit the sources of the 10× PCR buffer, dNTPs, and Taq DNA polymerase; common PCR amplification reagents well known in the art may be used.

[0020] The kit of the present invention can be used to quickly identify the drought resistance trait of alfalfa and can also quickly identify the drought resistance genotype of alfalfa. The specific method is similar to the specific steps for identifying whether alfalfa has a drought resistance trait. By performing electrophoresis detection and / or sequencing on the PCR amplification product, if the PCR amplification product has only one characteristic band with a length of 300 bp as shown in SEQ ID NO. 4, the alfalfa is a homozygous drought-sensitive genotype; if the PCR amplification product has both a characteristic band with a length of 300 bp as shown in SEQ ID NO. 4 and a characteristic band with a length of 263 bp as shown in SEQ ID NO. 5, the alfalfa is a heterozygous drought-resistant genotype.

[0021] The present invention has the following advantages:

[0022] (1) The inventors of the present invention screened out a molecular marker Ms_Chr4_23084811 related to drought resistance of alfalfa. The molecular marker is located on chromosome 4. The molecular marker Ms_Chr4_23084811 of the present invention can be used to quickly and accurately identify the drought resistance trait of alfalfa.

[0023] (2) Screening with markers linked to drought resistance traits is beneficial to molecular marker-assisted selection breeding. The method is simple and feasible, which helps to improve efficiency and save costs.

[0024] (3) The molecular marker of the present invention has the characteristics of convenient detection, stable amplification products and high specificity, and can be applied to alfalfa drought-resistant breeding practice and variety identification in a simple, rapid and high-throughput manner. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the result of genome-wide association analysis of drought tolerance in alfalfa, which is a Manhattan diagram obtained based on EMMXA model analysis. The green dots indicate the positions of the InDels associated with the present invention.

[0026] Figure 2 This is a boxplot of the drought resistance index distribution corresponding to the genotype at the Ms_Chr4_23084811 locus for the alfalfa population in Example 1. 0 / 0 indicates a homozygous drought-sensitive genotype at the Ms_Chr4_23084811 locus, while 0 / 1 indicates a heterozygous drought-resistant genotype at the Ms_Chr4_23084811 locus. Circles indicate extreme values, and **** indicates P < 0.0001.

[0027] Figure 3 This is the partial sequence alignment result of drought-tolerant varieties and drought-sensitive varieties in the drought-tolerance-associated region.

[0028] Figure 4 This is the electrophoresis diagram of molecular markers amplified from 23 alfalfa germplasm resources. The concentration of agarose gel is 2%. M in the figure represents DNA marker. DETAILED DESCRIPTION

[0029] The present invention will be further described below with reference to specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. However, the specific experimental methods involved in the following examples, unless otherwise specified, are all conventional methods or are performed under the conditions recommended by the manufacturer's instructions.

[0030] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be purchased from the market.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0032] Example 1 Development of molecular markers related to drought resistance in alfalfa

[0033] The present invention uses the alfalfa drought resistance index (DRI) to measure the drought resistance of alfalfa. The higher the value, the more drought-resistant the alfalfa is; the lower the value, the less drought-resistant the alfalfa is (drought-sensitive). After measuring the DRI of the alfalfa population, a GWAS analysis was performed to locate an InDel site in alfalfa ( Figure 1 Green site), named Ms_Chr4_23084811. This site is located on chromosome 4 of the alfalfa reference genome at site 23084811, where the first allele type is 0 / 0; the second allele type is 0 / 1. The distribution box plot of the drought resistance index corresponding to the genotype of the population Ms_Chr4_23084811 site ( Figure 2 ), indicating that the drought tolerance of alfalfa strains with genotype 0 / 1 was significantly higher than that of alfalfa strains with genotype 0 / 0. At position 23084811 on chromosome 4 of alfalfa, the insertion / deletion fragment AATCTCTCTTGAGAAATTTGTTGGATTACACAATATG (shown in SEQ ID NO.3) ( Figure 3 ), which has an impact on the drought resistance of alfalfa. The alfalfa with the fragment shown in SEQ ID NO.3 inserted is drought-sensitive alfalfa; the alfalfa with the fragment shown in SEQ ID NO.3 deleted is drought-resistant alfalfa.

[0034] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using Primer 5.0 software:

[0035] Ms_Chr4_23084811-F: CGATGTATTCACCACTGTTTAACATAA (shown in SEQ ID NO. 1);

[0036] Ms_Chr4_23084811-R: GCGAAGCTTTATTAATGCTATAAACAC (shown in SEQ ID NO. 2).

[0037] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the homozygous drought-sensitive alfalfa sample had only a 300bp characteristic band, while the PCR product of the heterozygous drought-resistant alfalfa sample had both a 300bp characteristic band and a 263bp characteristic band.

[0038] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention

[0039] 214 germplasms were identified, and the specific germplasm materials used are shown in Table 2:

[0040] Table 2 Drought resistance of 2214 germplasm materials and the genotype corresponding to the Ms_Chr4_23084811 locus

[0041]

[0042]

[0043]

[0044] 1) using the genomic DNA of alfalfa to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;

[0045] The PCR amplification reaction system is as follows: 10-100 ng of template DNA, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2× Taq PCR Master Mix, and deionized water to 20 μL. The PCR amplification reaction procedure is preferably as follows: pre-denaturation at 94°C for 4 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 59°C for 30 s, and extension at 72°C for 20 s, followed by extension at 72°C for 10 min, and storage at 4°C. Separation was performed by electrophoresis on a 2% agarose gel, and after spotting, electrophoresis was conducted at 140 V DC for 2 h. PCR banding patterns for each sample were then determined.

[0046] 2) Determining the drought tolerance of alfalfa based on the size of the PCR product: if the fragment shown in SEQ ID NO. 3 is missing from the PCR product of the alfalfa to be identified, the alfalfa to be identified is drought-resistant alfalfa;

[0047] When the fragment shown in SEQ ID NO. 3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is drought-sensitive alfalfa;

[0048] Specifically, when the fragment shown in SEQ ID NO. 3 is inserted into the PCR product of the alfalfa to be identified, the band length of the PCR product is 300 bp (SEQ ID NO. 4), then the alfalfa to be identified is drought-sensitive alfalfa.

[0049] The sequence of SEQ ID NO.4 is as follows:

[0050]

[0051] When the PCR product of the alfalfa to be identified is two bands, namely a band in which the fragment shown in SEQ ID NO.3 is inserted and a band in which the fragment shown in SEQ ID NO.3 is deleted, and one band of the PCR product is 300 bp in length and the other is 263 bp (SEQ ID NO.5), then the alfalfa to be identified is a heterozygous drought-resistant alfalfa.

[0052] The sequence of SEQ ID NO.5 is as follows:

[0053]

[0054] Furthermore, as shown in Table 2, of the 214 alfalfa accessions identified in this study, 163 had the genotype 0 / 0, and 51 had the genotype 0 / 1. The average drought resistance index of these 163 accessions under drought conditions was 1.0723, indicating drought-sensitive (drought-sensitive) alfalfa. Fifty-one accessions had the genotype 0 / 1, and the average drought resistance index of these 23 accessions was 1.6576, indicating drought-resistant alfalfa, which was 0.5853 higher than the average of the 163 drought-sensitive accessions. Analysis of variance indicated that the drought resistance index of drought-sensitive and drought-resistant alfalfa accessions was highly significant (P < 0.0001). The PCR detection results of 19 randomly selected germplasms ('Suntory', 'CF040145', 'Apex', 'CF020824', 'Pioneer', 'Thunder', 'Longmu 806', 'Zhongmu No. 5', 'CF039769', 'Huaiyang No. 4', 'WL440HQ', 'CF039770', 'CF031930', 'CF050248', 'Ranger', 'CF039747', 'P610428008', 'Xinmu No. 2', and 'CF050062') were consistent with the genotypes and actual drought resistance index measurement results. Therefore, the InDel molecular marker of the present invention can effectively identify the drought resistance of alfalfa and can be used for the prediction and screening of drought-resistant alfalfa varieties.

[0055] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, it is of course possible to easily make other implementation methods by replacing or changing the technical content disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. An InDel molecular marker located on chromosome 4 and associated with drought resistance in alfalfa, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 4 and SEQ ID NO.

5. The molecular marker is an insertion / deletion fragment AATCTCTCTTTGAGAAATTTGTTGGATTACACAATATG on chromosome 4 of the alfalfa reference genome. The primer pair sequence for amplifying the molecular marker is: Ms_Chr4_23084811-F: CGATGTATTCACCACTGTTTAACATAA; Ms_Chr4_23084811-R:GCGAAGCTTTATTAATGCTATAAACAC.

2. The use of the primer pair for amplifying the molecular marker in claim 1 in identifying or assisting in identifying the drought resistance trait of alfalfa, characterized in that: The method for identifying drought resistance traits of alfalfa comprises the following steps: (1) Extracting genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification is performed using the primer pair for amplifying the molecular marker in claim 1, and the PCR amplification product is subjected to electrophoresis detection and / or sequencing; (3) Determine based on the electrophoresis bands and / or sequencing results of step (2). The specific criteria are: PCR amplification was performed using primer pairs Ms_Chr4_23084811-F and Ms_Chr4_23084811-R. If the PCR amplification product produced only one characteristic band with a length of 300 bp as shown in SEQ ID NO.4, the alfalfa was a drought-sensitive type; if the PCR amplification product produced only one characteristic band with a length of 263 bp as shown in SEQ ID NO.5, or produced both one characteristic band with a length of 300 bp as shown in SEQ ID NO.4 and one characteristic band with a length of 263 bp as shown in SEQ ID NO.5, the alfalfa was a drought-resistant type.

3. A kit for identifying drought resistance of alfalfa, characterized in that: Comprising the primer pair for amplifying the molecular marker according to claim 1.

4. Use of the kit according to claim 3 in identifying drought-resistant genotypes of alfalfa, characterized in that: The method for identifying the drought-resistant genotype of alfalfa using the kit is as follows: (1) Extracting genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification is performed using the primer pair for amplifying the molecular marker in claim 1, and the PCR amplification product is subjected to electrophoresis detection and / or sequencing; (3) The PCR amplification products were subjected to electrophoresis detection and / or sequencing. If the PCR amplification product had only one characteristic band of 300 bp in length as shown in SEQ ID NO.4, the alfalfa was a homozygous drought-sensitive genotype; if the PCR amplification product had both one characteristic band of 300 bp in length as shown in SEQ ID NO.4 and one characteristic band of 263 bp in length as shown in SEQ ID NO.5, the alfalfa was a heterozygous drought-resistant genotype.

Images