Nanoprobe suitable for in-situ liquid biopsy as well as preparation method and application of nanoprobe

Abstract

The invention relates to the technical field of biological medicine, in particular to a nanoprobe suitable for in-situ liquid biopsy and a preparation method and application of the nanoprobe. The nanoprobe is composed of an anti-protein adsorption membrane fusion liposome and a CRISPR / Cas fluorescence detection system entrapped in the liposome, has excellent anti-protein adsorption capacity, and can still mediate stable and efficient membrane fusion between the liposome and extracellular vesicles in a circulating body fluid sample with complex components. The detection platform based on the CRISPR / Cas gene editing technology provided by the invention can directly realize rapid, in-situ and accurate quantitative detection and analysis of the target nucleic acid marker in the extracellular vesicles in a circulating body fluid sample in a separation-free and lysis-free manner, so that the detection cost is reduced to a certain extent, and the detection efficiency is improved. And the detection steps are greatly simplified, so that the liquid biopsy is quicker, simpler and more convenient, and the detection accuracy is good.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a nanoprobe suitable for in situ liquid biopsy and a preparation method and application thereof. Background Art

[0002] Liquid biopsy, especially blood-based liquid biopsy, is a revolutionary disease diagnosis and monitoring technology used to detect biomarkers in circulating body fluids to reflect disease conditions. This technology has become an effective and reliable method with important clinical application value due to its advantages such as non-invasiveness, strong repeatability and dynamic monitoring.

[0003] Extracellular vesicles are abundant and stable lipid bilayer biological vesicles in circulating body fluids. They contain abundant and stable nucleic acids, lipids, metabolites, proteins and other material information and molecular characteristics, playing an important role in intercellular communication and regulating cell function. Therefore, as an emerging analyte in liquid biopsy samples, extracellular vesicles (EVs) have become a hot topic in the translation of diagnostic biomarkers and have broad diagnostic application prospects. Currently reported detection methods for extracellular vesicle contents include: gold standard: quantitative real-time transcription-polymerase chain reaction; nuclease-assisted signal amplification; microfluidics-assisted methods; nanomaterial-based methods; next-generation sequencing technology, etc.

[0004] The current detection methods for extracellular vesicle contents have the following disadvantages: (1) Extracellular vesicles must be separated, purified and lysed before the contents can be obtained for detection and analysis; (2) The target nucleic acid markers in the extracellular vesicles need to be extracted (and amplified), which has a high detection cost and the extraction step is time-consuming and laborious; (3) Extracellular vesicle liquid biopsy samples are usually blood samples with complex components, and serum factors may also interfere with the accuracy of in situ detection and affect the reliability of diagnosis. Therefore, a method that can quickly and conveniently detect extracellular vesicles is urgently needed. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a nanoprobe suitable for in situ liquid biopsy. The anti-protein adsorption membrane fusion liposome contained in the nanoprobe can enable the CRISPR / Cas fluorescent detection system carried by the probe to be stably and efficiently delivered to the interior of extracellular vesicles in blood circulating body fluid samples, thereby realizing in situ, rapid and effective extracellular vesicle liquid biopsy.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] In the first aspect, the present invention provides a nanoprobe suitable for in situ liquid biopsy, which is obtained by encapsulating a CRISPR / Cas fluorescence detection system in a protein-resistant adsorption membrane fusion liposome; the protein-resistant adsorption membrane fusion liposome is prepared using DSPE-PEG, DOPC and DOTAP as raw materials by a thin film hydration method; the CRISPR / Cas fluorescence detection system includes a CRISPR / Cas12 fluorescence detection system targeting DNA or a CRISPR / Cas13 fluorescence detection system targeting RNA.

[0008] The protein-adsorption-resistant membrane fusion liposomes of the present invention have the ability of protein-adsorption resistance and extracellular vesicle membrane fusion. Through the strong protein-adsorption resistance to resist the formation of surface protein corona, it is prevented from interfering with the membrane fusion process, and stable and efficient membrane fusion between liposomes and extracellular vesicles can still be achieved in circulating body fluids, especially in blood samples with complex components. The present invention can achieve effective delivery of the CRISPR / Cas fluorescence detection system by means of the fusion of the protein-adsorption-resistant membrane fusion liposomes and the extracellular vesicle membrane, so that the CRISPR / Cas fluorescence detection system is efficiently transfected into the extracellular vesicles, thereby performing in situ extracellular vesicle liquid biopsy, and can directly achieve detection and analysis of target nucleic acid markers (DNA or RNA) in extracellular vesicles in blood samples.

[0009] Preferably, the CRISPR / Cas12 fluorescence detection system includes LwCas12a, crRNA targeting viral DNA, and a single-stranded DNA fluorescent probe; the CRISPR / Cas13 fluorescence detection system includes LwCas13a, crRNA targeting viral RNA, and a single-stranded RNA fluorescent probe.

[0010] The nanoprobe suitable for in situ liquid biopsy described in the present invention can select the corresponding CRISPR / Cas fluorescence detection system according to the target marker to be detected, and design the corresponding crRNA and fluorescent probe to perform rapid, in situ and accurate quantitative detection and analysis.

[0011] Preferably, in the CRISPR / Cas12 fluorescence detection system, the molar ratio of LwCas12a, crRNA targeting viral DNA, and single-stranded DNA fluorescent probe is 1:1:1; in the CRISPR / Cas13 fluorescence detection system, the molar ratio of LwCas13a, crRNA targeting viral RNA, and single-stranded RNA fluorescent probe is 1:1:1.

[0012] In a second aspect, the present invention provides a method for preparing the above-mentioned nanoprobe suitable for in situ liquid biopsy, comprising the following steps:

[0013] (1) DSPE-PEG, DOPC and DOTAP are dissolved in organic solvents respectively, mixed, rotary evaporated, and placed in a vacuum drying environment to form a uniform lipid film;

[0014] (2) adding a hydration solution containing a CRISPR / Cas12 or CRISPR / Cas13a fluorescence detection system to the uniform lipid film obtained in step (1) for rehydration, and ultrasonic filtration to obtain a protein-resistant adsorption membrane fusion liposome suspension carrying a CRISPR / Cas fluorescence detection system;

[0015] (3) The anti-protein adsorption membrane fusion liposome suspension carrying the CRISPR / Cas fluorescent system obtained in step (2) is repeatedly extruded, dialyzed, and purified in a nanofilm to obtain the nanoprobe suitable for in situ liquid biopsy.

[0016] The present invention uses DSPE-PEG, DOPC and DOTAP as preparation raw materials, DOPC is a zwitterionic group phospholipid, which is the main component of the liposome structure skeleton; DOTAP is a cationic lipid component, which can bind to the negatively charged lipid membrane through electrostatic adsorption to induce the next membrane fusion; DSPE-PEG anchors the plasma membrane and promotes fusion. The above-mentioned fat-soluble preparation raw materials are dissolved in an organic solvent, then mixed and emulsified with a drug-containing aqueous solution, and then the organic solvent is removed by reduced pressure evaporation to prepare protein-resistant membrane fusion liposomes. Compared with the traditional membrane fusion nanoliposome MFlip, the protein-resistant membrane fusion liposome AFMFlip can still maintain the membrane fusion effect and the ability of anti-protein adsorption in blood samples with complex components and rich proteins.

[0017] Preferably, in step (1), the molar ratio of DSPE-PEG, DOPC and DOTAP is DSPE-PEG:DOPC:DOTAP=5:90:5.

[0018] Preferably, the organic solvent includes but is not limited to chloroform, and may also be dissolved in other volatile organic solvents and evaporated by subsequent rotary evaporation.

[0019] Preferably, in step (1), the solution is dissolved to a concentration of 1 mg / mL.

[0020] Preferably, in step (2), the hydration solution containing the CRISPR / Cas12 or CRISPR / Cas13 fluorescence detection system is obtained by dissolving the CRISPR / Cas12 or CRISPR / Cas13 fluorescence detection system in sterile deionized water.

[0021] Preferably, in step (3), the pore size of the nanofilm decreases successively to 800 nm, 400 nm and 200 nm respectively.

[0022] By extruding sequentially, the particle size of liposomes can be regulated and liposomes with uniform particle size can be prepared.

[0023] Preferably, in step (3), the nanofilm is a polycarbonate nanofilm.

[0024] Preferably, in step (3), the dialysis is performed using sterile deionized water dialysis, and the molecular weight cutoff of the dialysis bag used is 2000 kDa.

[0025] Preferably, in step (3), the purification process adopts size exclusion chromatography.

[0026] In a third aspect, the present invention provides use of the above-mentioned nanoprobe suitable for in situ liquid biopsy in the preparation of a preparation for in situ liquid biopsy.

[0027] Preferably, the fluid is a circulating body fluid.

[0028] Preferably, the circulating body fluids include blood, saliva, urine, and sweat.

[0029] In a fourth aspect, the present invention provides the use of the above-mentioned serum stability nanoprobe in the preparation of a product for detecting a virus or diagnosing a disease, wherein the object of detection of the product is circulating body fluid.

[0030] The present invention applies a nanoprobe suitable for in situ liquid biopsy, the anti-protein adsorption membrane fusion CRISPR / Cas nanodetector (AFFECTOR), to extracellular vesicle liquid biopsy based on circulating body fluids, especially blood samples ( Figure 1 ) to analyze and monitor the levels of intrinsic target molecules in extracellular vesicles. The protein-adsorption-resistant membrane fusion liposome AFMFlip in AFFECTOR can still maintain the membrane fusion effect in blood samples with complex components and rich proteins, and can efficiently deliver the CRISPR / Cas fluorescence detection system (CRISPR / Cas-mediated fluorescence detector, CasFD) into extracellular vesicles to accurately analyze and monitor the levels of intrinsic targeted nucleic acids, and quantitatively report and output through fluorescent molecular signals, realizing ultra-sensitive liquid biopsy based on extracellular vesicles to diagnose and evaluate diseases.

[0031] Preferably, the circulating body fluid comprises a blood sample.

[0032] Preferably, when the product is used to detect DNA viruses, the nanoprobe is encapsulated with a CRISPR / Cas12 fluorescence detection system; when the product is used to detect RNA viruses, the nanoprobe is encapsulated with a CRISPR / Cas13 fluorescence detection system.

[0033] The beneficial effects of the present invention are:

[0034] The anti-protein adsorption membrane fusion liposomes of the present invention resist the interference of serum factors through strong anti-protein adsorption ability, and can still mediate stable and effective membrane fusion between liposomes and extracellular vesicles in circulating body fluid samples, especially blood samples with complex components. The effective delivery of the CRISPR / Cas fluorescence detection system can be achieved by means of fusion of liposomes and extracellular vesicle membranes, so that the CRISPR / Cas fluorescence detection system is efficiently transfected to the inside, thereby performing in situ extracellular vesicle liquid biopsy. The detection platform based on CRISPR / Cas gene editing technology provided by the present invention can directly realize rapid, in situ and accurate quantitative detection and analysis of target nucleic acid markers in extracellular vesicles in blood samples without separation and lysis, which reduces the detection cost to a certain extent, and greatly simplifies the detection steps, making liquid biopsy faster and easier, and has good detection accuracy, which can be used as an effective, fast and convenient molecular detection strategy. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a schematic diagram of the nanoprobe suitable for in situ liquid biopsy described in the present invention, namely, the anti-protein adsorption membrane fusion CRISPR / Cas nanodetector (antifouling membrane-fusogenic CRISPR / Cas detector, AFFECTOR) used for extracellular vesicle liquid biopsy.

[0036] Figure 2 The composition, preparation and characterization of anti-protein adsorption membrane fusion liposomes (AFMFlip) and traditional membrane fusion liposomes (MFlip); Figure a shows the raw material composition of AFMFlip; Figure b compares the raw materials and mixing ratios of AFMFlip and traditional MFlip; Figure c shows the particle size, zeta potential and structural morphology of AFMFlip; Figure d shows the particle size, zeta potential and structural morphology of MFlip.

[0037] Figure 3Figure 5 is the result of membrane fusion after AFMFlip was co-incubated with PBS samples containing extracellular vesicles or simulated serum samples; Figure a is the DLS analysis performed using a nanoparticle size analyzer to determine the fusion process of liposomes and extracellular vesicles; Figure b is the change in particle size after AFMFlip or MFlip was co-incubated with PBS samples containing extracellular vesicles or simulated serum samples at 37°C and different co-incubation time intervals; Figure c is the particle size distribution diagram of AFMFlip or MFlip after co-incubation with PBS samples containing extracellular vesicles or simulated serum samples at 37°C for 2 hours; the increase in particle size indicates the membrane fusion effect between liposomes and extracellular vesicles.

[0038] Figure 4 To verify the membrane fusion of AFMFlip and extracellular vesicles by fluorescence recovery after photobleaching (FRAP); Figure a is a schematic diagram of the FRAP experiment: after incubating the DiD-labeled AFMFlip liposome solution and the DiO-labeled PBS sample containing extracellular vesicles or simulated serum sample at 37°C for 2 hours, the liposomes / extracellular vesicles in the membrane contact / semi-fusion intermediate state are found and the extracellular vesicle position at that location is fluorescence bleached, and the subsequent fluorescence recovery is observed; Figure b shows the fluorescence recovery of the mixed solution of AFMFlip and the PBS sample containing extracellular vesicles or simulated serum sample after co-incubation at 37°C.

[0039] Figure 5 This is the result of imaging observation using a confocal laser scanning microscope after AFMFlip and MFlip were co-incubated with PBS samples containing extracellular vesicles and simulated serum samples at 37°C for 2 hours; wherein, the extracellular vesicles were labeled with DiO and the liposomes were labeled with DiD.

[0040] Figure 6To analyze and evaluate the membrane fusion effect between AFMFlip or MFlip and extracellular vesicles based on fluorescence resonance energy transfer (FRET) reaction; Figure a shows the statistical membrane fusion efficiency of AFMFlip or MFlip with PBS samples containing extracellular vesicles and simulated serum samples at different incubation time intervals at 37°C; Figure b shows the comparison of membrane fusion efficiency of AFMFlip or MFlip with PBS samples of extracellular vesicles and simulated serum samples after co-incubation for 2 hours under different temperature conditions (25°C and 37°C); wherein, the liposomes were fluorescently double-labeled with a pair of FRET molecules DiO and DiI, the initial fluorescence of the liposome solution was set to 0% fusion, and the fluorescence of the liposome solution after adding Triton X-100 was set to 100% fusion.

[0041] Figure 7 Evaluation of the adsorption performance of AFMFlip or MFlip against human serum proteins; Figure a is a schematic diagram of the experiment of recovery and analysis of AFMFlip or MFlip after incubation with normal human serum; Figures BC are the characterization of the particle size (b) and zeta potential (c) of liposomes before and after serum incubation using a nanoparticle size analyzer; Figure d is the quantification of proteins adsorbed on the surface of liposomes after serum incubation using the BCA protein assay method; wherein, ns indicates p>0.05, *** indicates p<0.001 (two-tailed t-test); Figure eg is the identification of the protein corona formed by adsorption on the surface of the recovered nanoparticles using liquid chromatography-tandem mass spectrometry, and the analyzed protein parameters include isoelectric point pI (e), molecular weight MW (f) and instability index (g).

[0042] Figure 8 To characterize the stability of AFMFlip with mouse serum under different incubation conditions, a nanoparticle size analyzer was used to measure the particle size distribution and zeta potential of AFMFlip after incubation with different concentrations of normal Balb / c mouse serum.

[0043] Fig. 9The CRISPR / Cas12a fluorescence detection system is used to detect and analyze targeted viral DNA and DNA extracted from virus-positive extracellular vesicles; Figure a shows the verification of the system components of the CRISPR / Cas12a fluorescence detection system for generating fluorescence detection signals; Figures bc show the reaction kinetics of the CRISPR / Cas12a fluorescence detection system under different temperature conditions (b) and the endpoint fluorescence signal intensity statistics after 2 hours of reaction (c); Figure de shows the CRISPR / Cas12a fluorescence detection system detecting extracellular vesicle DNA from HepG2 cell line (HBV negative) and HepAD38 cell line (HBV positive) at 37°C; where *** indicates p<0.001 (two-tailed t-test); Figure f shows the specificity verification of the CRISPR / Cas12a fluorescence detection system in the detection of virus-positive extracellular vesicle DNA.

[0044] Fig.10 Figure 4 is the characterization of AFFECTOR and its detection application in extracellular vesicles; Figures ab are the comparison of the particle size (a) and zeta potential (b) of AFFECTOR constructed by AFMFlip and AFMFlip-encapsulated CRISPR / Cas12a fluorescence detection system; Figure c is a transmission electron microscope image of AFFECTOR; Figure d is the specific detection of AFFECTOR for targeted virus-positive extracellular vesicles; Figures ef are the reaction kinetics (e) and endpoint fluorescence output signal statistics (f) of AFFECTOR detecting HBV-positive extracellular vesicles.

[0045] Fig.11 The Bland-Altman test was used to evaluate the differences between AFFECTOR and quantitative polymerase chain reaction analysis.

[0046] Fig.12 This is the evaluation of the inter-batch measurement repeatability of AFFECTOR detection of virus-positive extracellular vesicles in PBS and simulated serum samples. RSD (relative standard deviation) is the relative standard deviation.

[0047] Fig.13 This is the evaluation of the inter-day measurement repeatability of AFFECTOR in detecting virus-positive extracellular vesicles in PBS and simulated serum samples. RSD (relative standard deviation) is the relative standard deviation.

[0048] Fig.14Figure 4 shows the application of AFFECTOR in the study of HBV-related clinical samples; Figure a is a heat map analysis of the fluorescence detection results of serum samples from patients and healthy volunteers included in the study; Figure b is the ROC curve of AFFECTOR detecting HBV-negative and HBV-positive serum samples; Figure c is the ROC curve of AFFECTOR detecting HBV low-load and HBV high-load serum samples.

[0049] Fig.15 Figure 4 shows the use of AFFECTOR to detect serum samples in HPV-related clinical research; Figure a is a schematic diagram of AFFECTOR being used to detect clinical samples and explore information related to the disease infection process contained in virus-positive extracellular vesicles; Figure b is the fluorescence signal output after AFFECTOR detects each clinical sample; Figure c is a scatter plot of significance statistical analysis based on the fluorescence signal output data results; Figure d is the specificity of the AFFECTOR method for detecting targeted virus-positive samples; where ns means p>0.05, ** means p<0.01, and *** means p<0.001 (one-way analysis of variance).

[0050] Fig.16 It is a detection based on the CRISPR / Cas13a fluorescence detection system targeting microRNA-21; Figure a shows the fluorescence signal output of the CRISPR / Cas13a fluorescence detection system in non-tumor-derived extracellular vesicle internal RNA samples (non-tEV RNA) and tumor-derived extracellular vesicle internal RNA samples (tEV RNA); Figure b shows the fluorescence endpoint value statistics after 2 hours of reaction; where ns means p>0.05, * means p<0.05, and *** means p<0.001 (one-way analysis of variance).

[0051] Fig.17 The construction and characterization of the nanosystem of AFMFlip loaded with CRISPR / Cas13a fluorescence detection system; Figures ab show the measurement of particle size (a) and zeta potential (b) using a nanoparticle size analyzer after the CRISPR / Cas13a fluorescent probe was encapsulated in AFMFlip.

[0052] Fig.18 The AFMFlip loaded with the CRISPR / Cas13a fluorescence detection system targeting microRNA-21 is used for in situ detection of non-tumor-derived extracellular vesicles and tumor-derived extracellular vesicles in PBS samples or simulated serum samples; Figure a is a schematic diagram of the in situ detection of microRNA-21 targets inside extracellular vesicles; Figure b is the statistics of the fluorescence signal readings after 2 hours of reaction at 37°C in the dark (where the concentration of extracellular vesicles is 0.1 mg / mL), *** indicates p<0.001 (two-tailed t-test).

[0053] Fig.19 It is an analysis of extracellular vesicles in blood samples of normal Balb / c mice and HepG2 tumor-bearing Balb / c mice; Figures ab are characterization analyses of the particle size (a) and potential (b) of extracellular vesicles extracted from serum samples of normal control mice and HepG2 tumor-bearing mice; Figure c is the determination of the level of microRNA-21 in the content of extracellular vesicles by quantitative reverse transcription polymerase chain reaction, *** indicates p<0.001 (two-tailed t-test); Figure d is a heat map statistics of the level of microRNA-21 in the content of extracellular vesicles in serum samples of normal control group and HepG2 tumor-bearing group mice using AFMFlip loaded with CRISPR / Cas13a fluorescence detection system targeting microRNA-21. DETAILED DESCRIPTION

[0054] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0055] Example 1

[0056] This embodiment provides a nanoprobe suitable for in situ liquid biopsy, namely, an anti-protein adsorption membrane fusion CRISPR / Cas nanodetector (AFFECTOR), which is obtained by encapsulating a CRISPR / Cas12a fluorescence detection system in anti-protein adsorption membrane fusion liposomes (AFMFlip).

[0057] The method for preparing the anti-protein adsorption membrane fusion type CRISPR / Cas nano detector comprises the following steps:

[0058] 1. Dissolve DSPE-PEG, DOPC and DOTAP in chloroform to a concentration of 1 mg / mL and store at 4°C. Take a round-bottom flask and add the corresponding solution in a molar ratio of DSPE-PEG: DOPC: DOTAP = 5:90:5 to mix, and evaporate the organic solvent. Place the round-bottom flask in a vacuum desiccator overnight to form a uniform lipid film on the inner wall of the flask.

[0059] 2. Prepare the hydration solution containing the CRISPR / Cas12a fluorescence detection system:

[0060] The CRISPR / Cas12a fluorescence detection system of this embodiment targets HBV, HPV16 and HPV18 respectively.

[0061] crRNA and single-stranded DNA fluorescent probes targeting HBV, HPV16 and HPV18 were designed respectively, and their nucleotide sequences are shown in Table 1.

[0062] Table 1

[0063]

[0064] LbCas12a (purchased from Guangzhou Meige), crRNA and single-stranded DNA fluorescent probe were mixed in a molar ratio of 1:1:1 and dissolved in sterile deionized water to obtain a hydration solution.

[0065] 3. Add the hydration solution obtained in step 2 to the uniform lipid film obtained in step 1 for rehydration treatment, and perform ultrasonic filtration to obtain a mixed solution;

[0066] 4. The mixed solution obtained in step 3 is repeatedly extruded into polycarbonate nanofilms with successively decreasing pore sizes (800 nm, 400 nm and 200 nm, respectively), and then the mixed solution is purified by sterile deionized water dialysis (the molecular weight cutoff of the dialysis bag used is 2000 kDa) and size exclusion chromatography, and finally the anti-protein adsorption membrane fusion CRISPR / Cas nanodetector (AFFECTOR) is prepared.

[0067] Example 2

[0068] This embodiment provides a nanoprobe suitable for in situ liquid biopsy, namely, an anti-protein adsorption membrane fusion CRISPR / Cas nanodetector (AFFECTOR), which is obtained by encapsulating a CRISPR / Cas13a fluorescence detection system in anti-protein adsorption membrane fusion liposomes (AFMFlip).

[0069] The method for preparing the anti-protein adsorption membrane fusion type CRISPR / Cas nano detector comprises the following steps:

[0070] 1. Dissolve DSPE-PEG, DOPC and DOTAP in chloroform to a concentration of 1 mg / mL and store at 4°C. Take a round-bottom flask and add the corresponding solution in a molar ratio of DSPE-PEG: DOPC: DOTAP = 5:90:5 to mix, and evaporate the organic solvent. Place the round-bottom flask in a vacuum desiccator overnight to form a uniform lipid film on the inner wall of the flask.

[0071] 2. Prepare the hydration solution containing the CRISPR / Cas13a fluorescence detection system:

[0072] The CRISPR / Cas13a fluorescence detection system includes reaction buffer, LwCas13a, crRNA targeting microRNA-21, and single-stranded RNA fluorescent probe.

[0073] The crRNA and single-stranded RNA fluorescent probe targeting microRNA-21 were designed respectively; wherein, the crRNA sequence targeting microRNA-21 was: 5'-GACCACCCCAAAAAUGAAGGGGACUAAAACUCAACAUCAGUCUGAU AAGCUAU-3', and the single-stranded RNA fluorescent probe sequence was 5'-FAM-UUUUUU-BHQ1-3'.

[0074] LbCas13a (purchased from Guangzhou Meige), crRNA and single-stranded RNA fluorescent probe were mixed in a molar ratio of 1:1:1 and dissolved in sterile deionized water to obtain a hydration solution.

[0075] 3. Adding the hydration solution obtained in step (2) to the uniform lipid film obtained in step (1) for rehydration treatment, and ultrasonic filtering to obtain a mixed solution;

[0076] 4. The mixed solution obtained in step (3) is repeatedly extruded into polycarbonate nanofilms with successively decreasing pore sizes (800 nm, 400 nm and 200 nm, respectively), and then the mixed solution is purified by sterile deionized water dialysis (the molecular weight cutoff of the dialysis bag used is 2000 kDa) and size exclusion chromatography, and finally the anti-protein adsorption membrane fusion CRISPR / Cas nanodetector (AFFECTOR) is prepared.

[0077] Test Example 1: Particle Size Detection

[0078] In this test example, the anti-protein adsorption membrane fusion liposome (AFMFlip) and membrane fusion liposome (MFlip) were subjected to particle size detection (using a nanoparticle size analyzer). The anti-protein adsorption membrane fusion CRISPR / Cas nanodetector (AFFECTOR) prepared in Examples 1 and 2 was subjected to particle size detection and transmission electron microscopy detection.

[0079] The preparation method of anti-protein adsorption membrane fusion liposome (AFMFlip) comprises the following steps:

[0080] 1. Dissolve DSPE-PEG, DOPC and DOTAP in chloroform to a concentration of 1 mg / mL and store at 4°C. Take a round-bottom flask and add the corresponding solution in a molar ratio of DSPE-PEG: DOPC: DOTAP = 5:90:5 to mix, and evaporate the organic solvent. Place the round-bottom flask in a vacuum desiccator overnight to form a uniform lipid film on the inner wall of the flask.

[0081] 2. Prepare protein-adsorption-resistant membrane fusion liposomes by thin film hydration method: add hydration liquid (sterile deionized water in this embodiment) to the uniform lipid film obtained in step (1) for rehydration treatment, and ultrasonic filtration to obtain protein-adsorption-resistant membrane fusion liposome suspension;

[0082] 3. The protein-adsorption-resistant membrane fusion liposome suspension obtained in step (2) is repeatedly extruded into polycarbonate nanofilms with successively decreasing pore sizes (800 nm, 400 nm and 200 nm, respectively). Subsequently, the protein-adsorption-resistant membrane fusion liposome suspension is purified by sterile deionized water dialysis (the molecular weight cutoff of the dialysis bag used is 2000 kDa) and size exclusion chromatography to finally prepare the protein-adsorption-resistant membrane fusion liposome (AFMFlip).

[0083] Membrane fusion liposomes (MFlip): DSPE-PEG, DMPC and DOTAP are used as raw materials, and a thin film hydration / extrusion method is used to prepare traditional membrane fusion liposomes MFlip; the preparation method of the membrane fusion liposomes is different from the preparation method of anti-protein adsorption membrane fusion liposomes (AFMFlip) only in that: step (1) is prepared using DSPE-PEG, DMPC and DOTAP as raw materials, and the molar ratio of DSPE-PEG:DMPC:DOTAP is 4:76:20.

[0084] Comparison of raw materials and mixing ratios of AFMFlip and traditional MFlip Figure 2 a-2b. The particle size detection and transmission electron microscopy results of AFMFlip and traditional MFlip are shown in Figure 2 As shown in c-2d, the particle size of AFMFlip and MFlip is about 200nm. The zeta potential of AFMFlip is slightly positive, about 1.5mV, while the zeta potential of traditional MFlip is more positive, about 10mV.

[0085] The particle size detection results of the anti-protein adsorption membrane fusion CRISPR / Cas nano detector (AFFECTOR) prepared in Examples 1 and 2 are as follows Fig.10 a-10b, Fig.17 As shown in the figure, compared with AFMFlip, the AFFECTOR obtained by engineering treatment in Example 1 presents a slightly larger particle size (204.2nm) and a similar zeta potential (1.5mV) than AFMFlip. Similarly, the particle size of the AFFECTOR obtained by engineering treatment in Example 2 is about 205.8nm, and the zeta potential is slightly positive at 1.7mV ( Fig.17 ). This indicates that the CRISPR / Cas fluorescence detection system is effectively encapsulated into AFMFlip. Fig.10The image results observed by transmission electron microscopy in c also confirmed the successful construction of AFFECTOR.

[0086] Test Example 2:

[0087] In this test example, anti-protein adsorption membrane fusion liposomes (AFMFlip), membrane fusion liposomes MFlip and an equal number of extracellular vesicles were co-incubated to observe their membrane fusion (fusion principle: the membrane material of the liposome is similar to the structure of the vesicle membrane, and the next step of fusion is triggered after membrane contact) to verify their stable membrane fusion ability in serum samples.

[0088] The experimental method and process are as follows:

[0089] 1. Isolation and extraction of extracellular vesicles

[0090] Extracellular vesicles were isolated and purified from the cell supernatant: First, the cells were cultured in DMEM medium containing 10% FBS. When the cell confluence reached 80%, the cells were washed 3 times with PBS for starvation. After 48 hours of cell starvation, the supernatant culture medium was collected and centrifuged at 800×g for 5 minutes to remove the cells, and then centrifuged at 2000×g for 10 minutes to remove cell debris. After that, the collected supernatant was filtered through a 0.45μm filter membrane and ultracentrifuged at 100000×g for 2 hours in a SW40 Ti rotor (Beckman). After the ultracentrifugation, the supernatant was removed, the bottom sediment containing extracellular vesicles was resuspended with PBS, and the extracellular vesicles were quantified by the BCA protein assay kit and stored at -80°C for subsequent use.

[0091] Preparation of simulated serum samples containing extracellular vesicles: 10 μL of extracellular vesicle resuspension solution and 90 μL of normal human serum (original extracellular vesicles removed) were mixed to prepare extracellular vesicle simulated serum samples. The steps for removing extracellular vesicles that may have been originally contained in normal human serum are as follows: normal human serum is ultracentrifuged at 100,000×g for 2 hours at 4°C, and then filtered with a 0.22 μm filter to finally obtain normal human serum from which original extracellular vesicles have been removed.

[0092] 2. Use nanoparticle size analyzer to track particle size changes

[0093] The solution prepared with AFMFlip or MFlip (100 μL) was mixed with a PBS sample containing extracellular vesicles or a simulated serum sample (50 μL), wherein the ratio of liposomes to extracellular vesicles was 1:1, and then incubated at 37°C for 0.5 h, 1 h, 1.5 h, and 2 h, respectively. The fusion process of liposomes and extracellular vesicles was determined by DLS analysis using a nanoparticle size analyzer ( Figure 3 a).

[0094] The results are as follows Figure 3 As shown in b-3c, a significant increase in particle size was detected within the first 30 minutes after AFMFlip was co-incubated with a PBS sample containing extracellular vesicles, indicating that a membrane fusion effect occurred between AFMFlip and the extracellular vesicles. After 2 hours of fusion, the average diameter of the mixed solution of AFMFlip and extracellular vesicles increased from 188.0nm to 375.9nm. In addition, in the simulated serum sample environment, the mixed solution of AFMFlip and extracellular vesicles still showed a gradual increase in particle size, suggesting a membrane fusion effect. After 2 hours of co-incubation, the average diameter of the fusion increased from 186.3nm to 370.6nm, which confirmed that AFMFlip still has the ability to fuse with the extracellular vesicle membrane even under protein-rich serum conditions.

[0095] In contrast, traditional MFlip can fuse with extracellular vesicles in PBS samples, inducing the particle size of the mixture to increase from 192.9nm to 372.7nm. After co-incubation with extracellular vesicles in simulated serum samples, the size increase in the mixed solution of MFlip and extracellular vesicles was significantly reduced, which may be because MFlip lost a certain degree of membrane fusion mediating ability under the interference of the serum environment.

[0096] 3. Fluorescence photobleaching recovery technique experiment

[0097] The extracellular vesicles were labeled with DiO dye, and AFMFlip was labeled with DiD dye. The solution prepared with AFMFlip (100 μL) was mixed with PBS samples containing extracellular vesicles or simulated serum samples (50 μL), where the ratio of liposomes to extracellular vesicles was 1:1. After AFMFlip and extracellular vesicles were incubated together at 37°C for 2 hours, the population with membrane contact / semi-fusion intermediate state was searched under a microscope, and then a high-energy laser beam was used to irradiate and quench the fluorescent area of ​​the extracellular vesicles, and the recovery of DiO and DiD fluorescent molecules was observed and recorded at the same time ( Figure 4 a).

[0098] The results are as follows Figure 4As shown in Figure b, in the two treatment groups of AFMFlip co-incubated with PBS samples of extracellular vesicles and AFMFlip co-incubated with simulated serum samples of extracellular vesicles, it can be observed that the DiD fluorescence from AFMFlip gradually shifts to the quenched area, and the DiD fluorescence intensity increases significantly over time and reaches a plateau at about 5 minutes. These results prove that AFMFlip has the ability to mediate membrane fusion with extracellular vesicles and is not interfered by protein-rich serum components.

[0099] 4. Confocal laser scanning microscopy observation

[0100] The solution (100 μL) of DiD-labeled AFMFlip or MFlip was mixed with PBS sample or mock serum sample (50 μL) containing DiO-labeled extracellular vesicles, with the ratio of liposomes to extracellular vesicles being 1:1. The mixture was incubated at 37°C for 2 h, and the membrane fusion ability of AFMFlip and MFlip was compared under an inverted fluorescence microscope.

[0101] The results are as follows Figure 5 As shown in the figure, after incubation at 37°C for 2 hours, the DiD fluorescence from AFMFlip and the DiO fluorescence of extracellular vesicles in the PBS sample were clearly co-localized, indicating that membrane fusion occurred between AFMFlip and extracellular vesicles. It is worth noting that when AFMFlip was co-incubated with simulated serum samples of extracellular vesicles, the membrane fusion phenomenon still existed, verifying that AFMFlip retained membrane fusion ability in a serum-containing environment.

[0102] In contrast, the DiD fluorescence of MFlip colocalized well with the DiO fluorescence of extracellular vesicles in the PBS sample, while MFlip and extracellular vesicles showed significantly reduced colocalization signals in the serum environment, indicating that MFlip had insufficient membrane fusion ability under the influence of serum.

[0103] 5. Evaluation of membrane fusion effect based on fluorescence resonance energy transfer (FRET) technology

[0104] The liposomes were double-labeled using a pair of FRET molecules DiO and DiI. During the membrane fusion process, the FRET activity will weaken, resulting in the fluorescence signals of the donor DiO and the acceptor DiI to increase and decrease, respectively, which can reflect the efficiency of membrane fusion. Specifically, a solution containing AFMFlip or MFlip double-labeled with DiO and DiI (100 μL) was mixed with a PBS sample or a simulated serum sample (50 μL) containing DiO-labeled extracellular vesicles, wherein the ratio of the number of liposomes to extracellular vesicles was 1:1, and then co-incubated at 37°C for 0.5 hours, 1 hour, 1.5 hours and 2 hours, and the fluorescence spectrum of the liposome / extracellular vesicle mixture was recorded using a fluorescence spectrophotometer (excitation wavelength of 483 nm). In addition, the initial FRET effect of the liposomes was measured using a fluorescence spectrophotometer as the baseline 0% fusion. At the same time, a 0.1% volume ratio of Triton X-100 solution was added to the liposomes, and its spectrum was measured as 100% fusion. The calculation formula for membrane fusion efficiency is as follows:

[0105] Membrane fusion efficiency Fusion (%) = (F-F0) / (F100-F)

[0106] In the above formula, F is the fluorescence value of the liposome / extracellular vesicle mixture at the DiO receiving wavelength (505 nm), F0 is the fluorescence value of the DiO and DiI double-labeled liposome solution at 501 nm, and F100 is the fluorescence value of the DiO and DiI double-labeled liposome solution at 501 nm after adding Triton X-100.

[0107] The results are as follows Figure 6 As shown in a, in PBS and simulated serum samples, after AFMFlip was mixed with extracellular vesicles, the fusion efficiency was able to gradually increase, reaching a stable fusion efficiency of 90.4% and 85.8% respectively after incubation at 37°C for 2 hours. Although the fusion efficiency of MFlip in PBS samples with extracellular vesicles also reached a similar high level (89.2%), its fusion efficiency was significantly reduced when it was mixed with extracellular vesicles in simulated serum samples.

[0108] 6. Effect of incubation temperature on membrane fusion effect

[0109] The experimental process was the same as that of Part 5 of this experimental example. The incubation conditions were: incubation at 25°C and 37°C for 2 hours to explore the effects of different temperatures on membrane fusion effects.

[0110] The results are as follows Figure 6As shown in Figure b, when the incubation temperature is 37°C, the fusion efficiency of liposomes and extracellular vesicles is significantly higher than that at 25°C, and AFMFlip and extracellular vesicles show efficient membrane fusion effects in both PBS samples and simulated serum samples. Under the optimized incubation conditions of 37°C and 2 hours, AFMFlip can stably and efficiently fuse with extracellular vesicles in a protein-rich serum environment, while the fusion ability of traditional MFlip will be significantly affected by serum interference, greatly weakening its application potential.

[0111] Test Example 3

[0112] This test example detects the anti-serum protein adsorption ability of anti-protein adsorption membrane fusogenic liposomes (AFMFlip).

[0113] Experimental materials: anti-protein adsorption membrane fusion liposomes (AFMFlip) and membrane fusion liposomes (MFlip), whose preparation refers to Experimental Example 1.

[0114] Experimental methods:

[0115] 1. Collect normal human serum or mouse serum and remove extracellular vesicles. The steps are as follows: ultracentrifuge the serum sample at 100,000 × g for 2 hours at 4°C, collect the supernatant, and then filter the obtained supernatant with a 0.22 μm filter to finally obtain normal human serum or mouse serum with extracellular vesicles removed. Add the above-mentioned normal human serum or mouse serum with extracellular vesicles removed (50 μL) to the solution containing AFMFlip or MFlip (100 μL). Then, incubate the mixed solution at 37°C with shaking at 100 × g per minute for 1 hour. In order to remove unbound serum proteins, the incubated mixed solution is centrifuged at 20,000 × g for 50 minutes at 4°C, collect the precipitate and wash it carefully with sterile deionized water ( Figure 7 a). Then, the particle size and zeta potential were measured at room temperature using a nanoparticle size analyzer, and the surface adsorbed protein concentration of the mixture solution after incubation was detected using the BCA protein assay, and the surface adsorbed protein corona was identified and analyzed by liquid chromatography-tandem mass spectrometry.

[0116] Nanoparticle size analyzer and Zeta potential analyzer were used to detect the effect of serum protein-rich environment on the physicochemical properties of AFMFlip nanocarriers. The results showed that the particle size and potential of AFMFlip were almost unchanged ( Figure 7 b-7c, Figure 8 ).

[0117] The results of quantitative analysis of protein corona by BCA test are as follows Figure 7The results showed that compared with the traditional membrane fusion liposome MFlip, AFMFlip formed less protein corona after incubation with normal human serum, showing good anti-protein adsorption ability.

[0118] 2. Analysis based on protein spectrum

[0119] After incubation with normal human serum at 37°C, protein coronas were formed by surface adsorption of AFMFlip and MFlip, and the proteins were classified and analyzed according to different parameters.

[0120] The results are as follows Figure 7 As shown in eg. Figure 7 The results in e indicate that low pI proteins are the main components of the protein corona on the surface of nanoliposomes. At the same time, medium molecular weight proteins (60-90 kDa) are also widely distributed in the nanoparticle adsorbed protein components ( Figure 7 f). In addition, the trend of the instability index showed that the stable protein categories were enriched on the surface of nanoparticles ( Figure 7 g).

[0121] Test Example 4

[0122] This test example provides a CRISPR / Cas12a-mediated detection and analysis of viral DNA in virus-positive extracellular vesicles, specifically:

[0123] 1. Exploration of functional system components of CRISPR / Cas12a fluorescence detection system:

[0124] A mixture of Cas12a, crRNA, and single-stranded DNA fluorescent probe (the molar ratio of Cas12a, crRNA, and single-stranded DNA fluorescent probe was 1:1:1) was added / not added to a black 96-well plate, followed by the addition / not addition of DNA target (the molar concentration of the template DNA target added to each well was 100 nM), and the reaction was incubated at 37°C for 30 minutes, and the FAM fluorescence reading was detected by a microplate reader.

[0125] The results are as follows Fig. 9 As shown in a. The results show that trans-cleavage activity can only be induced in the presence of a DNA target and when the CRISPR / Cas12a / crRNA complex is activated, thereby generating an effective fluorescence signal readout. The detection principle of the CRISPR / Cas12a fluorescence detection system is that after Cas12a / crRNA recognizes the target sequence, the lateral cutting ability is activated, non-specifically cutting the single-stranded DNA fluorescent probe to emit a fluorescent signal.

[0126] 2. Optimization of detection conditions for CRISPR / Cas12a fluorescence detection system:

[0127] A mixture of Cas12a, crRNA, and single-stranded DNA fluorescent probe (the molar ratio of Cas12a, crRNA, and single-stranded RNA fluorescent probe was 1:1:1) was added to a black 96-well plate, followed by the addition of DNA target (the molar concentration of the template DNA target added to each well was 100 nM), and the plates were incubated at 25°C, 37°C, and 42°C, respectively, and the FAM fluorescence readings that changed over time were detected by a microplate reader.

[0128] The results are as follows Fig. 9 As shown in b-9b, at 25°C, 37°C, and 42°C, the CRISPR / Cas12a fluorescence detection system exhibited different reaction kinetics, reaching the maximum signal intensity under their respective conditions at approximately 30 minutes, 15 minutes, and 12 minutes, respectively ( Fig. 9 b). The results of the end-point fluorescence report value show that ( Fig. 9 c), detection at 37°C and 42°C showed more robust and similar signal readings, so the present invention subsequently selected 37°C as the optimized reaction temperature.

[0129] 3. CRISPR / Cas12a fluorescence detection system for extracellular vesicle DNA detection:

[0130] (1) Isolation and purification of extracellular vesicles from the cell supernatant of HepG2 cells (HBV negative) and HepAD38 cells (HBV positive):

[0131] HepG2 cells and HepAD38 were cultured in DMEM medium containing 10% FBS (original extracellular vesicles were removed). When the cell confluence reached 80%, the cells were washed 3 times with PBS for starvation treatment. After 48 hours, the supernatant culture medium was collected and centrifuged at 800×g for 5 minutes to remove the cells, and then centrifuged at 2000×g for 10 minutes to remove cell debris to obtain the supernatant. After that, the collected supernatant was filtered through a 0.45μm filter membrane and ultracentrifuged at 100000×g for 2 hours in a SW40 Ti rotor (Beckman); after the ultracentrifugation, the supernatant was removed and the bottom sediment containing extracellular vesicles was resuspended with PBS to prepare an extracellular vesicle sample.

[0132] (2) Total DNA was extracted from HepG2 extracellular vesicles and HepAD38 extracellular vesicles using the Extracellular Vesicle DNA Isolation Kit (Serum / Plasma) from Runji Biotechnology Co., Ltd. (Liaoning, China).

[0133] (3) Design of a CRISPR / Cas12a fluorescence detection system targeting HBV viral fragments

[0134] The CRISPR / Cas12a fluorescence detection system includes Cas12a, HBV crRNA, and a single-stranded DNA fluorescent probe, wherein the molar ratio of Cas12a, crRNA, and single-stranded DNA fluorescent probe is 1:1:1.

[0135] DNA samples extracted from extracellular vesicles of HepG2 cells (HBV negative) and HepAD38 cells (HBV positive) extracted above were added to the aqueous solution of the CRISPR / Cas12a fluorescence detection system (the concentration added was 100 nM), incubated at 37°C, and the FAM fluorescence readings that changed over time from 0 min to 120 min were detected by an ELISA instrument. Among them, the DNA of the extracellular vesicle sample was extracted using an extracellular vesicle DNA extraction kit (Runji Biotechnology Co., Ltd.).

[0136] The results are as follows Fig. 9 As shown in d-9e, when detecting HepAD38-derived extracellular vesicle DNA containing HBV gene targets, the signal from the CRISPR / Cas12a fluorescence detection system increased significantly, and a significantly increased fluorescence signal was detected at the 2-hour detection endpoint. The signal intensity was 3.3 times that of the fluorescence signal of HepG2-derived extracellular vesicle DNA detection.

[0137] In the preliminary experiments, the present invention optimized the optimal conditions for the fusion reaction of AFMFlip and extracellular vesicles as follows: incubation time 2 hours, incubation temperature 37° C. Therefore, the CRISPR / Cas12a fluorescence detection system can be well matched with the fusion reaction conditions of AFMFlip, indicating that it can be used for further diagnostic applications.

[0138] 4. Verification of specificity and universality of CRISPR / Cas12a fluorescence detection system:

[0139] (1) Isolation and purification of extracellular vesicles from the cell supernatant of HepAD38 cells, SiHa cells and HeLa cells:

[0140] HepAD38 cells, SiHa cells and HeLa cells were cultured in DMEM medium containing 10% FBS (original extracellular vesicles were removed). When the cell confluence reached 80%, the cells were washed 3 times with PBS for starvation treatment. After 48 hours, the supernatant culture medium was collected and centrifuged at 800×g for 5 minutes to remove the cells, and then centrifuged at 2000×g for 10 minutes to remove cell debris to obtain the supernatant. After that, the collected supernatant was filtered through a 0.45μm filter membrane and ultracentrifuged at 100000×g for 2 hours in a SW40 Ti rotor (Beckman); after the ultracentrifugation, the supernatant was removed and the bottom sediment containing extracellular vesicles was resuspended with PBS to prepare an extracellular vesicle sample.

[0141] (2) Total DNA was extracted from HepAD38 extracellular vesicles, SiHa extracellular vesicles, and HeLa extracellular vesicles using the Extracellular Vesicle DNA Isolation Kit (Serum / Plasma) from Runji Biotechnology Co., Ltd. (Liaoning, China).

[0142] (3) Design of CRISPR / Cas12a fluorescence detection systems targeting HBV, HPV16, and HPV18 viral fragments

[0143] The fluorescent detection system includes Cas12a, HBV crRNA / HPV16 crRNA / HPV18 crRNA and a single-stranded DNA fluorescent probe. The molar ratio of Cas12a, crRNA and single-stranded DNA fluorescent probe is 1:1:1.

[0144] The above fluorescence detection system was used to measure DNA samples extracted from HepAD38 extracellular vesicles, SiHa extracellular vesicles and HeLa extracellular vesicles (added at a concentration of 100 nM). After incubation at 37°C for 2 hours, the FAM fluorescence readings were detected by a microplate reader.

[0145] The results are as follows Fig. 9 As shown in figure f, the CRISPR / Cas12a fluorescence detection system with specific targeting design can accurately distinguish samples with different viral targets, and its positive enhancement signal is significantly different from the signals generated by other non-specific targets, confirming that the CRISPR / Cas12a fluorescence detection system has target specificity.

[0146] 5. The serum anti-protein adsorption membrane fusion CRISPR / Cas nanodetector AFFECTOR (AFMFlip encapsulated CRISPR / Cas12a fluorescence detection system) of Example 1 is used for the detection of extracellular vesicles:

[0147] Extracellular vesicles were isolated and purified from the cell supernatants of HepAD38 cells, SiHa cells and HeLa cells: The method was the same as that in section 4.(1) of this test example. The protein-adsorption-resistant membrane-fused CRISPR / Cas nanodetector AFFECTOR of Example 1 was co-incubated with the extracted extracellular vesicle samples, and the FAM fluorescence reading was detected by an ELISA reader.

[0148] The results are as follows Fig.10 As shown in (d), after reacting at 37°C for 2 hours, the average fluorescence signal intensity of AFFECTOR in detecting HBV-positive extracellular vesicles was 5.6 times higher than that in detecting HBV-negative extracellular vesicles, indicating that it has high sensitivity and high specificity in detection.

[0149] In addition, when analyzing extracellular vesicles in PBS samples and simulated serum samples, AFFECTOR initiated the membrane fusion of liposomes and extracellular vesicles to mediate the delivery of the internal CRISPR / Cas12a fluorescence detection system, thereby performing target recognition to activate the relevant fluorescence response, and the signal intensity gradually increased within 2 hours of the reaction ( Fig.10 e). After analysis by the AFFECTOR platform, PBS samples and mock serum samples of HBV-positive extracellular vesicles obtained similar endpoint fluorescence output results ( Fig.10 f).

[0150] These results validated the potential of AFFECTOR for the efficient detection of extracellular vesicle content markers from protein-rich complex biological samples due to its anti-protein adsorption and membrane fusion ability.

[0151] Test Example 5

[0152] This experimental example provides the consistency between the anti-protein adsorption membrane fusion CRISPR / Cas nanodetector (AFFECTOR) of Example 1 and the quantitative polymerase chain reaction as the gold standard method.

[0153] Experimental methods:

[0154] 1. Isolation and purification of extracellular vesicles from the cell supernatant of HepAD38 cells, SiHa cells and HeLa cells:

[0155] HepAD38 cells, SiHa cells and HeLa cells were cultured in DMEM medium containing 10% FBS (original extracellular vesicles were removed). When the cell confluence reached 80%, the cells were washed 3 times with PBS for starvation treatment. After 48 hours, the supernatant culture medium was collected and centrifuged at 800×g for 5 minutes to remove the cells, and then centrifuged at 2000×g for 10 minutes to remove cell debris to obtain the supernatant. After that, the collected supernatant was filtered through a 0.45μm filter membrane and ultracentrifuged at 100000×g for 2 hours in a SW40 Ti rotor (Beckman); after the ultracentrifugation, the supernatant was removed and the bottom sediment containing extracellular vesicles was resuspended with PBS to prepare an extracellular vesicle sample.

[0156] 2. Comparison of the results of the protein-adsorbed membrane-fused CRISPR / Cas nanodetector (AFFECTOR) of Example 1 and the quantitative polymerase chain reaction as the gold standard method for detecting the DNA level of viruses inside extracellular vesicles:

[0157] AFFECTOR detection method: The AFFECTOR aqueous solution (100 μL) of Example 1 was co-incubated with the extracted extracellular vesicle sample (50 μL), wherein the ratio of the number of liposomes to extracellular vesicles was 1:1. After reacting at 37°C for 2 hours, the FAM fluorescence reading was detected by an ELISA reader to analyze the DNA level of the virus inside the extracellular vesicles.

[0158] Quantitative polymerase chain reaction (gold standard method) was used to detect:

[0159] Total DNA was extracted from HepAD38 extracellular vesicles, SiHa extracellular vesicles, and HeLa extracellular vesicles using the Extracellular Vesicle DNA Isolation Kit (Serum / Plasma) from Runji Biotechnology Co., Ltd. (Liaoning, China).

[0160] The viral DNA levels of total extracellular vesicle DNA were analyzed by quantitative polymerase chain reaction (gold standard method): (1) pre-denaturation at 95°C for 10 min; (2) 40 cycles of reaction at 95°C for 15 s and at 60°C for 60 s; (3) melting curve assessment, continuously collecting fluorescence signals at a rate of 1°C every 20 s from 72°C to 95°C.

[0161] The results of the two detection methods in the same sample were evaluated by Bland-Altman. Fig.11As shown, the two detection methods had good consistency in the detection of HBV-positive extracellular vesicles (HepAD38 extracellular vesicles), HPV16-positive extracellular vesicles (SiHa cells extracellular vesicles) and HPV18-positive extracellular vesicles (HeLa cells extracellular vesicles), and the difference in the detection results was within the 95% confidence level (mean ± 1.96 standard deviation).

[0162] Test Example 6

[0163] This experimental example provides a reproducibility evaluation of the anti-protein adsorption membrane fusion CRISPR / Cas nanodetector (AFFECTOR) of Example 1.

[0164] Experimental methods:

[0165] 1. The preparation of extracellular vesicle samples is shown in step 1 of Experimental Example 5.

[0166] 2. The AFFECTOR aqueous solution (100 μL) of Example 1 was co-incubated with the extracted extracellular vesicle PBS sample or simulated serum sample (50 μL), wherein the number ratio of liposomes to extracellular vesicles was 1:1. After reacting at 37°C for 2 hours, the FAM fluorescence reading was detected by a microplate reader to analyze the DNA level of the virus inside the extracellular vesicles.

[0167] 3. Evaluate the reproducibility of the detection method (respectively, the evaluation of batch-to-batch measurement repeatability and the evaluation of day-to-day measurement repeatability):

[0168] (1) Evaluation of inter-batch measurement repeatability: Comparison of fluorescence signal output detection and analysis results after AFFECTOR processed different extracellular vesicle samples from the same batch.

[0169] (2) Evaluation of intra-day measurement repeatability: Compare the fluorescence signal output detection and analysis results after AFFECTOR processes the same sample at different time points.

[0170] The results of the batch-to-batch measurement repeatability evaluation are as follows: Fig.12 As shown, the relative standard deviation (RSD) values ​​of the inter-batch measurements were all lower than 4.5%.

[0171] The results of the daily measurement repeatability evaluation are as follows Fig.13 As shown, the results of the daytime measurements showed an RSD value of less than 5.4%.

[0172] These results confirm that the experimental results of AFFECTOR are highly reproducible across different batches and time periods, indicating that AFFECTOR is highly reliable for extracellular vesicle detection.

[0173] Test Example 7

[0174] This experimental example provides the application of the anti-protein adsorption membrane fusion CRISPR / Cas nanodetector (AFFECTOR) of Example 1 in the diagnosis of clinical samples related to HBV infection.

[0175] Experimental methods:

[0176] 1. This trial case recruited 15 healthy volunteers and 40 HBV-infected patients with different viral load levels (respectively: 6 HBV-negative, no HBV load detected; 14 low HBV load, 1-3logIU / mL; 20 high HBV load, >3logIU / mL) for HBV-related clinical research. This clinical medical research has been approved by the Ethics Committee of the Third Affiliated Hospital of Sun Yat-sen University (Protocol No.: SL-II2023-170-01) and is implemented in accordance with the ICH-GCP and China GCP principles and the protocol approved by the Ethics Committee. All blood samples were collected in vacuum blood collection tubes and informed consent was obtained from healthy blood donors and patients of the Third Affiliated Hospital of Sun Yat-sen University (Guangzhou, China).

[0177] Sample pretreatment was performed within 48 hours after blood sample collection: first, the blood samples were centrifuged at 2500 × g for 10 min at room temperature, and the supernatant was gently transferred to a test tube with a pipette to obtain serum.

[0178] 2. Mix 100 μL of aqueous solution containing AFFECTOR (1 μg / μL) with the collected clinical serum sample (50 μL) and add it to a black 96-well plate, and incubate it at 37°C in the dark for 2 hours. After that, use an ELISA reader to measure the fluorescence intensity signal emitted after the DNA probe is cut, and use the fluorescence reading to quantitatively analyze the internal viral DNA level of HBV-positive extracellular vesicles, and statistically analyze the results.

[0179] The results are as follows Fig.14 As shown in a, the DNA level of HBV-positive extracellular vesicles detected using the AFFECTOR method can not only effectively distinguish HBV-positive patients from HBV-negative patients, but also significantly distinguish patients with low HBV load and high HBV load.

[0180] 3. The detection data of AFFECTOR in HBV-related clinical samples were further analyzed by receiver operating characteristic curve (ROC curve). The area under the ROC curve (AUC) is an indicator to measure the detection performance. The closer the AUC value is to 1.0, the higher the authenticity of the detection method.

[0181] The results showed that the fluorescence signal output intensity of AFFECTOR was highly correlated with the degree of HBV infection. AFFECTOR was able to differentially distinguish between the HBV positive group and the HBV negative group (AUC = 0.994) and the HBV low load group and the HBV high load group (AUC = 0.996), reflecting the accuracy of HBV diagnosis by AFFECTOR on virus-positive extracellular vesicles. It can not only effectively distinguish patients with virus-positive infection ( Fig.14 b), and can also indicate the level of viral load ( Fig.14 c).

[0182] Test Example 8

[0183] This experimental example provides the application of the anti-protein adsorption membrane fusion CRISPR / Cas nanodetector (AFFECTOR) of Example 1 to the diagnosis of clinical samples related to HPV infection.

[0184] Experimental methods:

[0185] 1. This trial case recruited 10 healthy volunteers and 40 HPV-infected patients with different lesion characteristics (6 HPV16+ cervical intraepithelial neoplasia grade 1 patients, 5 HPV16+ cervical intraepithelial neoplasia grade 2 patients, 11 HPV16+ cervical intraepithelial neoplasia grade 3 patients, 5 HPV16- cervical intraepithelial neoplasia grade 3 patients, 8 HPV16+ cervical cancer stage I & II patients, 5 HPV16+ cervical cancer stage III & IV patients) for HPV-related clinical research. This clinical medical research has been approved by the Ethics Committee of the Third Affiliated Hospital of Sun Yat-sen University (Protocol No.: SL-II2023-170-01) and is carried out in accordance with the ICH-GCP and China GCP principles and the protocol approved by the Ethics Committee. All blood samples were collected in vacuum blood collection tubes and informed consent was obtained from healthy blood donors and patients of the Third Affiliated Hospital of Sun Yat-sen University (Guangzhou, China).

[0186] Sample pretreatment was performed within 48 hours after blood sample collection: first, the blood samples were centrifuged at 2500 × g for 10 min at room temperature, and the supernatant was gently transferred to a test tube with a pipette to obtain serum.

[0187] 2. Mix 100 μL of aqueous solution containing AFFECTOR (1 μg / μL) with the collected clinical serum sample (50 μL) and add it to a black 96-well plate, and incubate it at 37°C in the dark for 2 hours. After that, use an ELISA reader to measure the fluorescence intensity signal emitted after the DNA probe is cut, and use the fluorescence reading to quantitatively analyze the internal viral HPV16DNA target level of HPV-positive extracellular vesicles ( Fig.15 a), Statistical analysis results.

[0188] The results are as follows Fig.15 As shown in b, the signals obtained by AFFECTOR in HPV-infected patient samples are significantly higher than those obtained in healthy volunteer samples, and the intensity of these signals gradually increases with the progression of HPV infection.

[0189] 3. Statistical analysis of AFFECTOR detection data was performed.

[0190] The results are as follows Fig.15 As shown in c, the average fluorescence intensity of the AFFECTOR output of samples from patients with cervical intraepithelial neoplasia grade 1 is much higher than the signal from healthy volunteer samples, and the AFFCTOR signal intensity increases significantly with the stage of HPV infection (cervical intraepithelial neoplasia grade 1, cervical intraepithelial neoplasia grade 2, cervical intraepithelial neoplasia grade 3, cervical cancer stage I&II, and cervical cancer stage III&IV).

[0191] 4. Verification of the specificity of AFFECTOR clinical analysis: 100 μL of aqueous solution containing AFFECTOR (1 μg / μL) was mixed with clinical serum samples (50 μL) collected from healthy volunteers, HPV16+ cervical intraepithelial neoplasia grade 3 patients and HPV16- cervical intraepithelial neoplasia grade 3 patients, and added to a black 96-well plate. The plate was incubated at 37°C in the dark for 2 hours, and the detected fluorescence signal data was statistically analyzed for significance.

[0192] The results are as follows Fig.15 As shown in Figure d, only clinical blood samples from HPV16-infected patients were detected to have a significant increase in fluorescence, while very low fluorescence output signals were observed in samples from healthy volunteers and HPV16-negative patients, confirming that the AFFECTOR method developed in the present invention has target specificity and accuracy in clinical applications.

[0193] Test Example 9

[0194] This test example provides a CRISPR / Cas13a-mediated detection and analysis of microRNA21 in tumor-derived extracellular vesicles, specifically:

[0195] A mixture of Cas13a, crRNA, and single-stranded RNA fluorescent probe (the molar ratio of Cas13a, crRNA, and single-stranded RNA fluorescent probe is 1:1:1) was added to a black 96-well plate, followed by the addition of non-tumor-derived extracellular vesicles and tumor-derived extracellular vesicle RNA samples (added at a concentration of 100nM), incubated at 37°C, and the FAM fluorescence readings that changed over time from 0min to 120min were detected by an ELISA reader. Among them, the non-tumor-derived extracellular vesicles are extracellular vesicles extracted from the 293T cell line, and the tumor-derived extracellular vesicles are extracellular vesicles extracted from the HepG2 cell line. The steps for extracting extracellular vesicles are as follows: First, the cells were cultured in DMEM medium containing 10% FBS. When the cell confluence reached 80%, the cells were washed 3 times with PBS for starvation treatment. After starvation for 48 hours, the supernatant medium was collected and centrifuged at 800 × g for 5 minutes to remove cells, and then centrifuged at 2000 × g for 10 minutes to remove cell debris. After that, the collected supernatant was filtered through a 0.45 μm filter and ultracentrifuged at 100,000 × g for 2 hours in a SW40 Ti rotor (Beckman). After ultracentrifugation, the supernatant was removed and the bottom pellet containing extracellular vesicles was resuspended with PBS.

[0196] like Fig.16 As shown in a-16b, when there is a high level of expressed micro RNA-21 target in the added RNA sample, the CRISPR / Cas13a fluorescence detection system is activated, and its trans-cleavage activity is used to produce and output a significantly increased fluorescence signal reading. After incubation for 2 hours under 37°C reaction conditions, the fluorescence intensity in the RNA sample inside the tumor-derived extracellular vesicles is approximately 2.8 times that of the RNA sample inside the non-tumor-derived extracellular vesicles. These results verify that the CRISPR / Cas13a fluorescence detection system constructed by the present invention can achieve quantitative and specific detection of micro RNA-21 inside tumor-derived extracellular vesicles, and has the potential for application in tumor diagnosis.

[0197] Test Example 10

[0198] This test example provides the detection and analysis of tumor cell extracellular vesicles mediated by the anti-protein adsorption membrane fusion CRISPR / Cas nano-detector (AFFECTOR) of Example 2 ( Fig.18 a).

[0199] The nanodetector was used to detect non-tumor-derived extracellular vesicles and tumor-derived extracellular vesicles in PBS samples or simulated serum samples, and the fluorescence readings were analyzed. Specifically, the AFFECTOR aqueous solution (100 μL) of Example 2 was co-incubated with the extracted extracellular vesicle PBS sample or simulated serum sample (50 μL), wherein the number ratio of liposomes to extracellular vesicles was 1:1, and after reacting at 37°C for 2 hours, the FAM fluorescence readings were detected by a microplate reader to analyze the level of microRNA-21 inside the extracellular vesicles.

[0200] The results are as follows Fig.18 As shown in Figure 2, the anti-protein adsorption membrane fusion CRISPR / Cas nanodetector (AFFECTOR) of Example 2, that is, the nanosystem of the CRISPR / Cas13a fluorescence detection system encapsulated with AFMFlip can effectively distinguish non-tumor-derived extracellular vesicles and tumor-derived extracellular vesicles through a significant difference in output signals of nearly 3 times, indicating the diagnostic value of micro RNA-21 inside tumor-derived extracellular vesicles as a potential biomarker for tumors.

[0201] Test Example 11

[0202] In this experimental example, the anti-protein adsorption membrane fusion CRISPR / Cas nanodetector (AFFECTOR) of Example 2 was applied to the analysis of blood samples in a mouse tumor model. The applicability of micro RNA-21 contained in tumor-derived extracellular vesicles as a biomarker for tumor diagnosis and prediction was evaluated in the mouse model.

[0203] Experimental methods:

[0204] 1. Eight Balb / c mice were randomly divided into normal control group (H1, H2, H3, H4) and HepG2 tumor burden group (T1, T2, T3, T4). In order to establish the tumor transplantation model, the collected HepG2 cells were dispersed in PBS and injected subcutaneously into the right side of the mice. The injection volume for each mouse was 1×10 7 One month after the tumor animal model was established, the tumor volume was measured to keep the tumor volume of mice in the HepG2 tumor burden group similar.

[0205] 2. Serum samples from mice in the normal control group and tumor burden group were collected, and extracellular vesicles were extracted using an extracellular vesicle extraction kit (serum / plasma) purchased from Runji Biotechnology Co., Ltd. (Liaoning, China). The collected extracellular vesicles were characterized and analyzed; then, the expression level of microRNA-21 (miR-21) in serum-derived extracellular vesicles from the normal control group and tumor burden group was compared using quantitative reverse transcription polymerase chain reaction. Specifically, the primer sequences used for quantitative reverse transcription polymerase chain reaction were: F: ACACTCCAGCTGGGTAGCTTATCAGACTGA and R: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAACATC, and the reaction steps were as follows: (1) pre-denaturation at 95°C for 10 minutes; (2) the process of reacting at 95°C for 15 seconds and at 60°C for 60 seconds was cycled 40 times; (3) melting curve evaluation was performed, and the fluorescence signal was continuously collected at a rate of 1°C every 20 seconds from 72°C to 95°C.

[0206] Characterization analysis results showed that the particle size of extracellular vesicles derived from the serum of mice in the normal control group was about 120nm, and the zeta potential was about -20mV. The extracellular vesicles derived from the serum of mice in the tumor burden group also had similar particle size and zeta potential ( Fig.19 a-19b)

[0207] The expression level of microRNA-21 in the extracellular vesicles derived from the serum of the tumor burden group mice was higher than that of the normal control group mice, which was about 1.3 times higher than that of the normal control group ( Fig.19 c).

[0208] 3. The anti-protein adsorption membrane fusion CRISPR / Cas nano-detector (AFFECTOR) of Example 2 was applied to the detection and analysis of mouse serum samples:

[0209] A 100 μL aqueous solution of AFFECTOR (1 μg / μL) was mixed with the collected mouse serum sample (50 μL) and added to a black 96-well plate and incubated at 37°C in the dark for 2 hours. Afterwards, the fluorescence intensity signal emitted after the RNA probe was cleaved was measured using a microplate reader, and the level of microRNA-21 target in tumor-derived extracellular vesicles was quantitatively analyzed by fluorescence reading ( Fig.15 a), Statistical analysis results.

[0210] The results are as follows Fig.19As shown in Figure d, the fluorescence signal of serum samples from mice in the tumor burden group was significantly higher than that in the normal control group, indicating the feasibility of quantifying microRNA-21 levels using the nanosystem of AFMFlip-encapsulated CRISPR / Cas13a fluorescence detection system, which can effectively distinguish serum samples derived from tumor burden. These results indicate that abnormal microRNA-21 expression is closely related to the occurrence and development of cancer, and the quantitative determination and analysis of microRNA-21 inside tumor-derived extracellular vesicles can provide valuable disease molecular information, with great diagnostic potential and important clinical significance.

[0211] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A nanoprobe suitable for in situ liquid biopsy, characterized in that: The CRISPR / Cas fluorescence detection system is obtained by encapsulating the protein-resistant adsorption membrane fusion liposome; the protein-resistant adsorption membrane fusion liposome is prepared by using DSPE-PEG, DOPC and DOTAP as raw materials and a thin film hydration method; the CRISPR / Cas fluorescence detection system includes a CRISPR / Cas12 fluorescence detection system or a CRISPR / Cas13 fluorescence detection system.

2. The nanoprobe suitable for in situ liquid biopsy according to claim 1, characterized in that: The CRISPR / Cas12 fluorescence detection system includes LwCas12a, crRNA targeting viral DNA, and a single-stranded DNA fluorescent probe; the CRISPR / Cas13 fluorescence detection system includes LwCas13a, crRNA targeting viral RNA, and a single-stranded RNA fluorescent probe.

3. The nanoprobe suitable for in situ liquid biopsy according to claim 2, characterized in that: In the CRISPR / Cas12 fluorescent detection system, the molar ratio of LwCas12a, crRNA targeting viral DNA, and single-stranded DNA fluorescent probe is 1:1:1; in the CRISPR / Cas13 fluorescent detection system, the molar ratio of LwCas13a, crRNA targeting viral RNA, and single-stranded RNA fluorescent probe is 1:1:

1.

4. A method for preparing a nanoprobe suitable for in situ liquid biopsy according to any one of claims 1 to 3, characterized in that: The steps include: (1) DSPE-PEG, DOPC and DOTAP are dissolved in organic solvents respectively, mixed, rotary evaporated, and placed in a vacuum drying environment to form a uniform lipid film; (2) adding a hydration solution containing a CRISPR / Cas12a or CRISPR / Cas13a fluorescence detection system to the uniform lipid film obtained in step (1) for rehydration, and ultrasonic filtration to obtain a protein-resistant adsorption membrane fusion liposome suspension carrying a CRISPR / Cas fluorescence system; (3) The anti-protein adsorption membrane fusion liposome suspension carrying the CRISPR / Cas fluorescent system obtained in step (2) is repeatedly extruded, dialyzed, and purified in a nanofilm to obtain the nanoprobe suitable for in situ liquid biopsy.

5. The preparation method according to claim 4, characterized in that: In the step (1), the molar ratio of DSPE-PEG, DOPC and DOTAP is DSPE-PEG:DOPC:DOTAP=5:90:

5.

6. Use of the nanoprobe suitable for in situ liquid biopsy according to any one of claims 1 to 3 in the preparation of a preparation for in situ liquid biopsy.

7. The use according to claim 6, characterized in that The fluid is a circulating body fluid.

8. The use according to claim 7, characterized in that The circulating body fluids include blood, saliva, urine, and sweat.

9. Use of the nanoprobe suitable for in situ liquid biopsy according to any one of claims 1 to 3 in the preparation of a product for detecting viruses or diagnosing diseases, characterized in that: The object of detection of the product is circulating body fluid.

10. The use according to claim 9, characterized in that When the product is used to detect DNA viruses, the nanoprobe is encapsulated with a CRISPR / Cas12 fluorescence detection system; when the product is used to detect RNA viruses, the nanoprobe is encapsulated with a CRISPR / Cas13 fluorescence detection system.

Images