Method for in-situ detection of multiple lung cancer related markers and tumor heterogeneity in living circulating malignant cells

Abstract

The invention relates to the technical field of biomedicine, in particular to a method for in-situ detection of multiple lung cancer related markers in living circulating malignant cells and tumor heterogeneity. The lung cancer targeted nanoprobe loaded with multiple molecular beacons is used for accurately detecting at least one nucleic acid marker related to the lung cancer in living lung cancer cells, and the levels of different markers in the lung cancer cells are reflected from the single cell level, so that the tumor heterogeneity state of a specific patient is reflected. The nano-probe is a nano-particle self-assembled by a high polymer material, electropositive protein, functional polypeptide and / or functional aptamer, and a molecular beacon of a lung cancer related marker. The nano-probe can target circulating malignant cells with different phenotypes in whole blood, simultaneously detect multiple nucleic acid markers in living cells, and reflect the levels of different markers in the malignant cells from the single cell level, so that the tumor heterogeneity state of a specific patient is reflected, and early accurate diagnosis of lung cancer is realized.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to a method for in situ detection of multiple lung cancer-related markers and tumor heterogeneity in living circulating malignant cells. Background Art

[0002] According to the 2020 Global Cancer Statistics, lung cancer is the second most commonly diagnosed cancer and remains the leading cause of cancer death, with an estimated 2.2 million new cancer cases and 1.8 million deaths. Lung cancer poses a major threat to human health mainly because it is associated with metastasis and recurrence. Early lung cancer has a small tumor size and weak compression and stimulation of surrounding normal tissues, resulting in hidden symptoms and failure to seek medical treatment in time. Therefore, many patients are already in the middle and late stages when they are diagnosed, missing the opportunity for surgery, which significantly reduces the cure rate.

[0003] There are currently three main methods for lung cancer screening, including imaging, cytology or histology, and biomarkers. Imaging carries the risk of radiation exposure to patients and their inability to obtain molecular information makes it difficult to apply subsequent personalized diagnosis and treatment. When using cytology or histology, since biopsy is often required, which is an invasive procedure, sampling is often difficult in critical areas such as the lungs and deeper tumor sites, and there are not enough samples for analysis. Therefore, biomarkers are crucial in clinical diagnosis and treatment because they are non-invasive and non-radioactive.

[0004] Currently recommended lung cancer biomarkers include carcinoembryonic antigen (CEA), progastrin-releasing peptide (ProGRP), cytokeratin 19 fragment (Cyfra21-1), neuron-specific enolase (NSE), and squamous cell carcinoma antigen (SCC). However, these markers cannot determine the exact type of lung cancer. With the availability of personalized targeted therapy, the need for accurate classification of lung cancer has become critical. Lung cancer is mainly divided into two categories, small cell lung cancer and non-small cell lung cancer. Small cell lung cancer accounts for about 15% of all lung cancers, and non-small cell lung cancer accounts for about 85%. Non-small cell lung cancer is mainly divided into adenocarcinoma and squamous cell carcinoma. In pathological diagnosis, pathologists usually use some immunohistochemical staining indicators to clarify different lung cancer pathological types, such as lung adenocarcinoma biomarkers TTF-1, Napsin A, lung squamous cell carcinoma biomarkers CK5 / 6, p63, p40, small cell lung cancer biomarkers CgA, SyN, CD56. However, the tumor location of some lung cancer patients is relatively special, and biopsies cannot be obtained clinically, such as tumors located at the apex of the lung. In addition, some patients refuse routine lung tumor biopsy due to contraindications to fiberoptic bronchoscopy or percutaneous lung puncture biopsy, or because of concerns about the risks of invasive biopsy. Therefore, a more comprehensive and safe detection scheme is urgently needed, such as using peripheral blood to detect these markers to improve the accuracy of diagnosis.

[0005] Tumor heterogeneity is an important reason why a single biopsy cannot obtain all the molecular information of the tumor. It is also the fundamental factor causing tumor resistance. Therefore, dynamic evaluation of the molecular typing of the tumor is required.

[0006] As a non-invasive tumor detection method, liquid biopsy has the advantages of safe, convenient, sustainable and dynamic detection and evaluation. Circulating malignant cells (CMCs), including circulating tumor cells (CTCs) and circulating malignant hybrid cells (CHCs), exist in the blood of patients at different stages of tumor development from early primary tumors to late stages. Compared with the detection of free markers in the blood (such as circulating tumor DNA (ctDNA), exosomes, and cell-free DNA (cf-DNA)), the detection of circulating malignant cells in the blood has multiple advantages. First, CMCs can provide more comprehensive cancer biology information at the cellular level. They are direct evidence of tumor cell metastasis in the body and reflect the heterogeneity and dynamic changes of tumors. The number of CMCs and the heterogeneous state of the markers are closely related to tumor development, which is suitable for evaluating prognosis and providing more valuable clinical guidance. Free markers can only provide single information and are easily affected by multiple factors, making it difficult to fully and accurately reflect the true state of the tumor. Therefore, CMCs detection has greater potential and advantages, and has broad application prospects in early screening, efficacy evaluation, and prediction of recurrence and metastasis.

[0007] Since the number of circulating malignant cells in the blood is rare, it is difficult to detect circulating malignant cells in the blood in situ. Usually, they are separated and enriched before detection. However, these enrichment-first-and-characterization methods have many disadvantages, such as the possibility of circulating malignant cell damage or cell state changes during the enrichment process. The detection of cells after enrichment is overly dependent on various staining methods, resulting in a cumbersome process. At the same time, the detection results are prone to false negatives due to the loss of surface antigens or the heterogeneity of tumor cells, which leads to only some malignant cells being stained with antibodies. Therefore, it is particularly important to develop a method that can detect live circulating malignant cells in situ to avoid errors caused by changes in circulating malignant cells during the enrichment process, accurately detect malignant cells with missing surface antigens, and fully reflect the heterogeneity of malignant cells. In addition, in the detection of nucleic acid markers, the existing gene delivery vectors such as viral vectors and cationic liposome delivery vectors lack tumor targeting, have poor biocompatibility, and are prone to cause cellular oxidative stress reactions, and cannot obtain accurate results. Therefore, it is urgent to develop a delivery vector with good biocompatibility, no effect on cell state, and efficient targeted delivery ability of malignant cells, so as to efficiently deliver molecular probes for detecting nucleic acid markers into live malignant cells and achieve accurate detection. Summary of the invention

[0008] The purpose of the present invention is to provide a method for in situ detection of multiple lung cancer-related markers and tumor heterogeneity in live circulating malignant cells, to achieve simultaneous detection of multiple lung cancer-related nucleic acid markers in live circulating malignant cells in the blood, to achieve early diagnosis of lung carcinoma in situ and detection of lung cancer heterogeneity at different development stages.

[0009] The scheme adopted by the present invention to achieve the purpose is: a method for in situ detection of multiple lung cancer-related markers and tumor heterogeneity in living circulating malignant cells, using a lung cancer targeted nanoprobe loaded with multiple molecular beacons to achieve accurate detection of at least one lung cancer-related nucleic acid marker in living lung cancer cells, reflecting the levels of different markers in lung cancer cells at the single-cell level, thereby reflecting the tumor heterogeneity state of a specific patient.

[0010] Preferably, the nanoprobe is a nanoparticle self-assembled from polymer materials, positively charged proteins, functional polypeptides and / or functional aptamers, and molecular beacons of lung cancer-related markers.

[0011] Preferably, the polymer material includes at least one of hyaluronic acid, aptamerized hyaluronic acid, polypeptideized hyaluronic acid, carboxymethyl chitosan, aptamerized carboxymethyl chitosan, polypeptideized carboxymethyl chitosan, and polylysine.

[0012] Preferably, the aptamer is at least one of the following aptamers: aptamers CL4, J18, Tutu-22 targeting wild-type EGFR (epidermal growth factor receptor), aptamer ME07 targeting wild-type and mutant lung cancer, aptamer E21 targeting EGFRIII, aptamers CLN3, CLN4, CLN64 targeting c-MET (mesenchymal epidermal transition factor), aptamers SE25-8, HB5, HY6 targeting HER2 (human epidermal growth factor receptor-2), aptamer SYL3C (anti-epithelial cell adhesion molecule aptamer) targeting EpCAM (epithelial cell adhesion factor), polypeptides including TAT penetrating peptide, NLS nuclear localization peptide, KALA polypeptide, EGFR targeting peptide GE11 and any one of the fusion peptides formed by their fusion.

[0013] Preferably, the positively charged protein includes any one of protamine, histone, and lysozyme.

[0014] Preferably, the molecular beacons of malignant cell-specific related genes include at least one of lung cancer marker molecular beacons, lung adenocarcinoma marker molecular beacons, mutant lung cancer marker molecular beacons, lung squamous cell carcinoma marker molecular beacons, and small cell lung cancer marker molecular beacons.

[0015] Preferably, the 5' end of the marker molecular beacon is labeled with a fluorescent group, and the 3' end is labeled with a fluorescent quenching group; the ring part of the marker molecular beacon has 15 to 30 nts of bases, which are used for complementary pairing with the CDS region of the malignant cell-specific RNA; the stem part of the marker molecular beacon has 5 to 8 nts of bases, which are used to form a hairpin structure, so that the fluorescent group and the quenching group are close to each other before encountering the target, so that the fluorescence is quenched. The fluorescence emitted by the fluorescent group in the molecular beacon can be quenched by the quenching group. When the molecular beacon binds to the target cell object, the stem ring of the molecular beacon is opened, and the fluorescent group is away from the quenching group, so that the fluorescent signal can be detected.

[0016] The CDS region (coding sequence) of RNA refers to the part of the RNA molecule that can be translated into protein. This region contains the sequence from the start codon (usually AUG) to the stop codon (such as UAA, UAG or UGA). The CDS region determines the amino acid sequence of the protein and is a key part of gene expression.

[0017] The molecular beacon nanoprobe of the present invention includes a variety of specific molecular beacons labeled with fluorescent groups of different colors, and each molecular beacon includes the recognition of one specific target in CMCs (circulating malignant cells). When they do not meet the targeted target, the fluorescent group and the quenching group are close to each other, and the probe does not emit fluorescence. When the aptamer and targeting polypeptide on the surface of the nanoparticle bind to the protein overexpressed on the surface of CMCs and enter the CMCs through active targeted endocytosis, the nanoparticle disintegrates in the CMCs and then releases the molecular beacon into the cytoplasm. When the molecular beacons hybridize with the specific nucleic acid chains containing the target sequence in the cytoplasm, they undergo conformational changes, and the fluorescent group moves away from the quenching group, causing them to emit bright fluorescence. Since different types of molecular beacons are bonded with different fluorescent groups, different targets can be detected simultaneously in the same cell. Different types of tumors can be judged by cells that emit fluorescence of different colors, and the progression of tumors can be monitored by the intensity of fluorescence and the number of luminescent cells. The cells in the blood of cancer patients are mainly blood cells and circulating malignant cells. Since red blood cells and platelets do not have the ability to endocytose, nanoparticles will not enter red blood cells and platelets. There are no proteins on the surface of white blood cells that can specifically bind to nanoparticles, and nanoparticles will not enter white blood cells. Therefore, nanoparticles can achieve efficient and accurate detection of CMCs in the blood and distinguish different types of CMCs through different fluorescence emissions to distinguish different types of tumors.

[0018] Preferably, the nucleic acids detectable by the molecular beacon nanoprobe include universal tumor marker Ki67 mRNA (5'-CAAGGCACCAAAGAGUGAGAAAGG-3'), c-Myc mRNA (5'-CGAGACCUUCAUCAAAAACAUCAUCAUCCA-3'), lung cancer marker EGFR mRNA (5'-CAACGAAUGGGCCUAAGAUCCCGUCC-3'), CEAmRNA, ProGRP mRNA, Cyfra21-1 mRNA, NSE mRNA, SCC mRNA, mutant lung cancer marker EGFR E746_A750del mRNA (UCGCUAUCAAGACAUCUCCGAAAGCC), lung adenocarcinoma marker TTF-1 mRNA (5'-UCGGGAAAAACUCUACAAGGGCAUA-3'), NapsinAmRNA (UCCAGACUACUCGAAAUGGCGUCC), CK7 mRNA, any three of the lung squamous cell carcinoma markers CK5 / 6 mRNA (GUUCGAGCAGUACAUCAACAACCUCAGG), p63 mRNA (GAAGAGACAGGAAGGCGGAUGAAGAUAGCA), p40 mRNA, lung small cell carcinoma markers CgA mRNA, SyN mRNA (CAACCUGUGGUUCGUGUUUAAGGAGACAG), CD56 mRNA (GAGUGGAGAGCAGUUGGUGAAGAAGUAUGG).

[0019] Among them, the universal tumor marker molecular beacon is at least one of the molecular beacons used to detect Ki67 and c-Myc genes, the lung cancer marker molecular beacon is at least one of the molecular beacons used to detect EGFR, CEA, ProGRP, Cyfra21-1, NSE, and SCC genes, the lung adenocarcinoma marker molecular beacon is used to detect a specific mutant lung cancer gene EGFR E746_A750del, the lung adenocarcinoma marker molecular beacon is used to detect TTF-1, NapsinA, and CK7 genes. The lung squamous cell carcinoma marker molecular beacon is used to detect at least one of the molecular beacons for detecting CK5 / 6, p63, and p40 genes, and the small cell lung cancer marker molecular beacon is used to detect at least one of the molecular beacons for detecting CgA, SyN, and CD56 genes.

[0020] Preferably, the method for preparing the nanoprobe comprises the following steps:

[0021] (1) adding a certain amount of positively charged protein and functional peptide and / or functional aptamer to deionized water to prepare solution A, adding a certain amount of molecular beacon solution of lung cancer-related markers to deionized water to prepare solution B, and adding solution A dropwise into solution B and mixing evenly;

[0022] (2) Adding a polymer material to the mixed solution obtained in step (1), and continuing to mix evenly, thereby obtaining the nanoprobe.

[0023] Synthesis principle: Nanoprobes are synthesized by self-assembly. Positively charged protamine sulfate, histone or lysozyme and functional polypeptides and negatively charged molecular beacons (MB) form protamine@functional polypeptide / molecular beacon, histone@functional polypeptide / molecular beacon or lysozyme@functional polypeptide / molecular beacon nanoparticles through electrostatic interaction, and then negatively charged polymer materials are added to the protamine@functional polypeptide / molecular beacon, histone@functional polypeptide / molecular beacon or lysozyme@functional polypeptide / molecular beacon nanoparticles with positive surface charge, and then the biopolymer material protamine@functional polypeptide / molecular beacon, histone@functional polypeptide / molecular beacon or lysozyme@functional polypeptide / molecular beacon nanoprobes are prepared.

[0024] Preferably, when the selected polymer material is hyaluronic acid, carboxymethyl chitosan, sodium alginate, or sodium heparin, the polymer material is firstly aptamized by step I or II or peptided by step III or IV;

[0025] Ⅰ. Dissolving a polymer material containing a carboxyl group in a PBS (pH=6) solution, adding a catalyst EDC / NHS to activate the solution at room temperature, and then adding an amino-modified aptamer or polypeptide to react at room temperature; placing the product obtained after the reaction in a dialysis bag for dialysis, and freeze-drying the product to obtain the functionalized polymer material;

[0026] II. Dissolve the carboxylated aptamer or polypeptide in PBS buffer solution, activate it with catalyst EDC / NHS at room temperature, then add the polymer material and react at room temperature; place the product obtained after the reaction in a dialysis bag for dialysis, and obtain the functionalized polymer material after freeze-drying.

[0027] In the steps I and II, after the catalyst EDC / NHS is added, the molar ratio of -COOH, EDC, and NHS in the solution is 1:1.2:1.2, and the molar ratio of the polymer material to the aptamer or polypeptide is 10:1.

[0028] When the polymer material is hyaluronic acid, sodium alginate, or sodium heparin, method I is used to prepare the functionalized polymer material. When the polymer material is carboxymethyl chitosan, method II is used to prepare the functionalized polymer material.

[0029] Preferably, the nanoprobe can be used to prepare detection products for lung nodules, lung adenocarcinoma, lung squamous cell carcinoma, and small cell lung cancer.

[0030] Preferably, the nanoprobe can detect multiple nucleic acid markers simultaneously, reflecting the levels of different markers in malignant cells at the single cell level, thereby reflecting the tumor heterogeneity state of a specific patient.

[0031] The present invention has the following advantages and beneficial effects:

[0032] The tumor-targeting nanoprobe loaded with multiple molecular beacons of the nanoprobe of the present invention realizes accurate detection of nucleic acid markers in living malignant cells.

[0033] The nanoprobe of the present invention can target all circulating malignant cells in the whole blood and simultaneously detect multiple nucleic acid markers in living cells, reflecting the levels of different markers in malignant cells at the single-cell level, thereby reflecting the tumor heterogeneity state of a specific patient and achieving accurate early diagnosis of lung cancer.

[0034] All materials of the molecular beacon nanoprobe of the present invention are biocompatible materials, and direct incubation in the blood will not cause toxic side effects on blood cells and circulating malignant cells, and will not interfere with the detection of target genes in malignant cells. The particle size and potential of the nanoparticles of the molecular beacon nanoprobe of the present invention can meet the requirements of entering cells, and the nanoparticles have good stability and biocompatibility.

[0035] The preparation principle of the molecular beacon nanoprobe of the present invention belongs to electrostatic interaction, and all processes are carried out in the aqueous phase. The preparation process is simple and efficient. Different targeting aptamers and functional polypeptide molecules can be bonded to the polymer chains on the surface of the synthetic nanoparticles, so that it can efficiently target to the malignant cell site in a complex blood environment. The nanomaterial can wrap the molecular beacon inside to protect the beacon from enzyme degradation and immunogenic reaction in the blood. At the same time, after the nanoparticles enter the circulating malignant cells, they disintegrate in CMCs, and efficiently release the molecular beacon into the cytoplasm, realizing the efficient combination of the beacon and the targeting nucleic acid sequence, emitting bright fluorescence, thereby achieving the purpose of identifying the target cells.

[0036] The preparation method of the invention has a non-toxic, simple and rapid synthesis process, is carried out in the water phase throughout the process, and can be mass-produced.

[0037] The molecular beacon-loaded nanoprobes of the present invention are directly added to the blood samples of cancer patients. The nanoprobes deliver the molecular beacons to the malignant cells in the whole blood in a targeted manner. In the living cell state, a variety of molecular beacons are hybridized with different nucleic acid molecules inside the malignant cells. There is no need to separate and enrich circulating malignant cells before detection, thus avoiding the damage to the cells caused by enriching the cells first and then detecting them. The molecular beacon nanoprobes of the present invention can be used to simultaneously detect lung cancer-related nucleic acid markers in a variety of circulating malignant cells. The hybridization of molecular beacons and nucleic acid markers emits fluorescence of different colors, which can be used for early detection of lung cancer and identification of the precise category of lung cancer. In particular, for early lung tumors, this test can accurately diagnose the benign and malignant nature of the tumor and the precise category of lung cancer, effectively helping to customize personalized treatment plans.

[0038] The molecular beacon nanoprobe of the present invention can promote cell-specific targeting, uptake and endosomal escape by adding functional polypeptides, so the functional polypeptides are introduced into the core and / or surface of the nanoprobe to more effectively improve the delivery efficiency of the molecular beacon. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is a schematic diagram of the structure of a molecular beacon (MB);

[0040] Figure 2 This is a working principle diagram of the nanoprobe of the present invention;

[0041] Figure 3 To explore the sensitivity of molecular beacon detection;

[0042] Figure 4 The present invention provides a method for synthesizing aptamer-based polymers and a structure of functional polypeptides in the molecular beacon nanoprobe;

[0043] Figure 5 For the characterization of the nanoprobe of the present invention;

[0044] Figure 6 This is a diagram showing the expression levels of different tumor markers in representative CMCs in 2 ml of whole blood of a real patient detected by the nanoprobe in Example 4 of the present invention;

[0045] Figure 7 This is a diagram showing the expression levels of different tumor markers in all CMCs in 2 ml of whole blood of a real patient detected by the nanoprobe in Example 4 of the present invention;

[0046] Figure 8 For pathological diagnosis. DETAILED DESCRIPTION

[0047] For a better understanding of the present invention, the following examples are provided to further illustrate the present invention, but the present invention is not limited to the following examples.

[0048] Example 1: Design and optimization of probes.

[0049] Based on literature research and using the molecular beacon design tool (Beacon designer), molecular beacons for detecting target genes Ki67 mRNA, c-Myc mRNA and TTF1 mRNA were constructed. The molecular beacon structure is as follows: Figure 1 Among them, the molecular beacon (MB) used to detect Ki67 mRNA Ki67 ) sequence is 5'-Alexa fluor 488-CGACCCTTTCTCACTCTTTGGTGCCTTGGTCG-Dabcyl-3'; Molecular beacon for detecting c-Myc mRNA (abbreviated as: MB c-Myc ) sequence is 5'-Cy5-CACTGTGGATGATGATGTTTTTGATGAAGGTCTCGCAGTG-Dabcyl-3'; the molecular beacon used to detect TTF1mRNA (abbreviated as: MB TTF1 ) sequence is

[0050] 5'-Cy3-ACCGTATGCCCTTGTAGAGTTTTTCCCGACGGT-Dabcyl-3', the designed MBs were synthesized from Sangon Biotech (Shanghai) Co., Ltd. These molecular beacons were obtained after optimization according to the actual detection effect.

[0051] In order to explore the sensitivity of molecular beacon detection, MB Ki67 (0.07 nmol dissolved in 7 μL ultrapure water) and MB Ki67 -1 (0.07 nmol dissolved in 7 μL ultrapure water) was incubated with the commercial carrier Lip2000 (1 ug dissolved in 93 μL ultrapure water) for 15 minutes to obtain the nanoprobe MB Ki67 @Lip and MB Ki67 -1@Lip. Cells were seeded in 6-well plates (2×10 5 After 24 h of incubation, the culture medium was replaced with 1 ml of 3MB Ki67 @Lip and MB Ki67 -1@Lip fresh medium. After incubation at 37°C for 10 h, the cells were washed with PBS, digested with trypsin, collected by centrifugation, fixed with 4% paraformaldehyde, filtered and analyzed by flow cytometry (Dakewe Biotech EXFLOW 206). Figure 3 MBKi67 The fluorescence intensity of -1@Lip is significantly lower than that of MB Ki67 @Lip, this shows that MB Ki67 Molecular beacon sequences have higher detection sensitivity.

[0052] Example 2: Preparation of nanoprobes.

[0053] 1. Synthesis of SYL3C-bonded HA (SHA)

[0054] The specific process is that hyaluronic acid (304 μg) is dissolved in PBS buffer solution (pH = 6.0, 1 mL), activated with a catalyst (EDC / NHS) (-COOH:EDC:HOBt = 1:1.2:1.2 molar ratio) at room temperature for 1 hour, and then the aptamer SYL3C (586 μg) is added and reacted at room temperature for 24 hours. The product obtained after the polymer material reaction is placed in a dialysis bag (MWCO 20000), dialyzed in ultrapure water for 72 hours to remove unreacted aptamers and other impurities, and then freeze-dried to obtain SHA. Figure 4 The present invention provides a method for synthesizing aptamer-based polymers and a structure of functional polypeptides in the molecular beacon nanoprobe.

[0055] 2. Load MB Ki67 , M.B. c-Myc and MB TTF1 Synthesis of nanoprobes

[0056] MB Ki67 (0.07 nmol dissolved in 7 μL ultrapure water), MB c-Myc (0.07 nmol dissolved in 7 μL ultrapure water) and MB TTF1 (0.07 nmol dissolved in 7 μL ultrapure water) to form a mixed solution A, histone (30 μg) and NLS* (3 μg) were mixed in ultrapure water (36 μL) to form a mixed solution B, and the mixed solution A was added dropwise to the mixed solution B. After gently mixing for 15 minutes, positively charged MB was obtained. ki67 / MB c-Myc / MB TTF1 @Histone / NLS* mixed solution. Then 43 μL of negatively charged mixed solution containing SHA (6 μg) and KALA-GE11 (1 μg) was added dropwise to the MB ki67 / MB c-Myc / MB TTF1 @Histone / NLS* mixed solution, after gently mixing for 15 minutes, the triple targeted nanoprobe (MB ki67 / MB c-Myc / MB TTF1@Histone / NLS* / SHA / KALA-GE11 is abbreviated as "3MB@VHSKG").

[0057] Example 3: Characterization of nanoprobes.

[0058] 1.3 Determination of particle size, potential and encapsulation efficiency of MB@VHSKG nanoparticles.

[0059] Specific implementation method: The 3MB@VHSKG nanoparticle solution prepared in Example 2 was diluted with deionized water to a total volume of 1 mL. The size and potential of the 3MB@VHSKG nanoparticles in deionized water were measured by Zetasizer (Nano ZS, Malvern Instruments). Experimental results Figure 5 As shown in a, 5b, it can be seen from the figure that the hydrodynamic size of the nanoparticles is less than 300nm and the potential is greater than 0, which is suitable for cell uptake.

[0060] In order to determine the encapsulation efficiency of molecular beacons, the solution of 3MB@VHSKG nanoparticles was centrifuged at a specific speed (10000rpm) for 1 hour at 4°C, and then the amount of unprecipitated free molecular beacons remaining in the supernatant was measured. The molecular beacon encapsulation efficiency was calculated as the ratio of the precipitated beacon amount to the total feed amount. The experimental results showed that the encapsulation efficiency of molecular beacons was above 90%.

[0061] Morphology of 2.3MB@VHSKG nanoparticles under transmission electron microscopy (TEM).

[0062] Specific implementation method: The ultra-thin carbon support film is infiltrated with the sample solution. After the 3MB@VHSKG nanoparticles are deposited, a small amount of phosphotungstic acid solution (0.001 mol / L) is added to infiltrate the negative stain, evaporate and dry at room temperature. Finally, the sample is observed by transmission electron microscopy (JEM-2100). The experimental results are shown in Figure 2. Figure 5 As shown in c, it can be seen from the figure that 3MB@VHSKG nanoparticles exhibit uniformly dispersed spherical shapes.

[0063] Example 4: 3MB@VHSKG was used to detect nucleic acids in CMCs of blood samples from tumor patients.

[0064] Specific implementation method: Take 2 ml of blood from patients with early pulmonary nodules in an EDTA anticoagulant tube, then add 3MB@VHSKG nanoparticle solution to the blood, incubate for 10 hours, filter the blood on a filter membrane with a diameter of 7 microns, collect the filter membrane in a confocal dish, stain the cell nucleus with DAPI (blue), and then observe with a laser confocal microscope. The experimental results are as follows Figure 6 and Figure 7As shown in the figure, the type and intensity of fluorescence emitted by each circulating tumor cell are different, indicating that tumor cells are heterogeneous. The green light emitted by circulating tumor cells indicates that they are Ki67 positive, and the lung nodule is a malignant tumor. The rose-red fluorescence emitted by most circulating tumor cells indicates that it is one of lung adenocarcinoma and small cell lung cancer, and excludes the possibility of lung squamous cell carcinoma. This result can provide a reference for the diagnosis of benign and malignant early lung nodules and the accurate diagnosis of lung cancer types. Figure 8 For pathological diagnosis.

[0065] The above is only a preferred embodiment of the present invention, which certainly cannot be used to limit the scope of rights of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and changes can be made without departing from the principle of the present invention, and these improvements and changes are also regarded as the protection scope of the present invention.

Claims

1. A method for in situ detection of multiple lung cancer-related markers and tumor heterogeneity in living circulating malignant cells, characterized in that: A lung cancer targeted nanoprobe loaded with multiple molecular beacons is used to accurately detect at least one lung cancer-related nucleic acid marker in living lung cancer cells, reflecting the levels of different markers in lung cancer cells at the single-cell level, thereby reflecting the tumor heterogeneity state of a specific patient.

2. The method for in situ detection of multiple lung cancer-related markers and tumor heterogeneity in living circulating malignant cells according to claim 1, characterized in that: The nanoprobe is a nanoparticle self-assembled from polymer materials, positively charged proteins, functional polypeptides and / or functional aptamers, and molecular beacons of lung cancer-related markers.

3. The method for in situ detection of multiple lung cancer-related markers and tumor heterogeneity in living circulating malignant cells according to claim 2, characterized in that: The polymer material includes at least one of hyaluronic acid, aptamerized hyaluronic acid, polypeptideized hyaluronic acid, carboxymethyl chitosan, aptamerized carboxymethyl chitosan, polypeptideized carboxymethyl chitosan and polylysine.

4. The method for in situ detection of multiple lung cancer-related markers and tumor heterogeneity in living circulating malignant cells according to claim 3, characterized in that: The aptamer is at least one of the following aptamers: aptamers CL4, J18, Tutu-22 targeting wild-type EGFR, aptamer ME07 targeting wild-type and mutant lung cancer, aptamer E21 targeting EGFRIII, aptamers CLN3, CLN4, CLN64 targeting c-MET, aptamers SE25-8, HB5, HY6 targeting HER2, and aptamer SYL3C targeting EpCAM. The polypeptide includes any one of TAT penetrating peptide, NLS nuclear localization peptide, KALA polypeptide, EGFR targeting peptide GE11 and fusion peptides formed by fusion of them.

5. The method for in situ detection of multiple lung cancer-related markers and tumor heterogeneity in living circulating malignant cells according to claim 2, characterized in that: The positively charged protein includes any one of protamine, histone, and lysozyme.

6. The method for in situ detection of multiple lung cancer-related markers and tumor heterogeneity in living circulating malignant cells according to claim 2, characterized in that: The molecular beacons of malignant cell-specific related genes include at least one of lung cancer marker molecular beacons, lung adenocarcinoma marker molecular beacons, mutant lung cancer marker molecular beacons, lung squamous cell carcinoma marker molecular beacons, and small cell lung cancer marker molecular beacons.

7. The method for in situ detection of multiple lung cancer-related markers and tumor heterogeneity in living circulating malignant cells according to claim 6, characterized in that: The 5' end of the marker molecular beacon is labeled with a fluorescent group, and the 3' end is labeled with a fluorescent quenching group; the ring part of the marker molecular beacon has 15 to 30 nts of bases, which are used for complementary pairing with the CDS region of the malignant cell-specific RNA; the stem part of the marker molecular beacon has 5 to 8 nts of bases, which are used to form a hairpin structure, so that the fluorescent group and the quenching group are close to each other before encountering the target, so that the fluorescence is quenched.

8. The method for in situ detection of multiple lung cancer-related markers and tumor heterogeneity in living circulating malignant cells according to claim 2, characterized in that: The nucleic acids detectable by the nanoprobe include at least one of the universal tumor marker Ki67 mRNA, c-Myc mRNA, lung cancer marker EGFR mRNA, CEAmRNA, ProGRP mRNA, Cyfra21-1 mRNA, NSE mRNA, SCCmRNA, mutant lung cancer marker EGFR E746_A750del mRNA, lung adenocarcinoma marker TTF-1mRNA, NapsinA mRNA, CK7 mRNA, lung squamous cell carcinoma marker CK5 / 6mRNA, p63 mRNA, p40 mRNA, lung small cell carcinoma marker CgA mRNA, SyNmRNA, and CD56 mRNA.

9. The method for in situ detection of multiple lung cancer-related markers and tumor heterogeneity in living circulating malignant cells according to claim 2, characterized in that: The method for preparing the nanoprobe comprises the following steps: (1) adding a certain amount of positively charged protein and functional peptide and / or functional aptamer to deionized water to prepare solution A, adding a certain amount of molecular beacon solution of lung cancer-related markers to deionized water to prepare solution B, and adding solution A dropwise into solution B and mixing evenly; (2) Adding a polymer material to the mixed solution obtained in step (1), and continuing to mix evenly, thereby obtaining the nanoprobe.

10. The method for in situ detection of multiple lung cancer-related markers and tumor heterogeneity in living circulating malignant cells according to claim 2, characterized in that: The nanoprobe can be used to prepare detection products for lung nodules, lung adenocarcinoma, lung squamous cell carcinoma, and small cell lung cancer.

Images