Streptococcus suis antigen protein as well as screening method and application thereof

Abstract

The invention discloses a streptococcus suis antigen protein as well as a screening method and application thereof. Through reverse vaccinology and comparative genomics analysis, antigens conforming to conservative property, surface positioning and immunogenicity are screened out, the reactivity between the antigens and rehabilitation serum of different streptococcus suis serotypes is evaluated, and finally three antigens are screened out. The three antigen proteins are respectively used for immunizing mice, and the streptococcus suis is used for carrying out a challenge test, so that the three antigen proteins can provide a certain protection effect on infection of a streptococcus suis type 2 strain and a streptococcus suis type 9 strain. The antigen protein disclosed by the invention has a good application prospect in the aspects of novel subunit vaccine research of streptococcus suis and streptococcus suis infection diagnosis.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to three streptococcus suis antigen proteins with cross-protection effects and applications thereof. Background Art

[0002] Streptococcus suis is an important pathogen of zoonotic diseases. When infected in pigs, it can cause a variety of diseases such as meningitis, endocarditis, sepsis, etc. The infection rate and mortality rate are both high. It is one of the pathogenic bacteria that endangers the pig industry and public health.

[0003] The prevention and control of swine streptococcal disease mainly relies on antimicrobial drugs and vaccines, but as the situation of drug resistance of swine streptococci becomes increasingly severe, vaccines have become the most economical and effective means of preventing and controlling the disease. Although commercial vaccines for swine streptococcal disease are currently available, the development of efficient and safe vaccines is of great significance due to the large number of serotypes of swine streptococci, their rapid mutation rate, and the wide variety of diseases they cause. Subunit vaccines have become a promising type of vaccine due to their high safety and ability to provide cross-immune protection. However, due to the high diversity of swine streptococcal strains, the development of subunit vaccines with good cross-immune protection still faces huge challenges.

[0004] Reverse vaccinology is based on the genome sequence of pathogenic microorganisms. It uses amino acid or nucleotide sequence analysis tools to screen the genome of pathogens, select genes that can express qualified candidate antigens, and then express and purify the screened antigen proteins. The protective effect of the purified antigen proteins is evaluated, and antigens with better protective effects can be used for the next step of vaccine design. At present, there are thousands of whole genome sequences of Streptococcus suis in public databases, which provides a solid foundation for the screening of candidate vaccine antigen proteins. Summary of the invention

[0005] The purpose of the present invention is to screen a novel Streptococcus suis vaccine antigen protein with cross-protection effect, and then evaluate the protection effect of the screened candidate antigen.

[0006] In order to achieve the above object, the technical solution of the present invention is as follows:

[0007] Based on the whole genome sequence of 944 strains of Streptococcus suis from sick pigs, the pan-genome of Streptococcus suis was constructed using software such as Prokka and Panaroo, and the genes present in 99% of the Streptococcus suis strains were classified as the core genome. Bioinformatics tools such as PSORTb, TMHMM, BLAST, and Vaxijen were further used to analyze the subcellular localization of these genes, analyze their homology with host proteins, and predict and analyze their immunogenicity, in order to screen for highly immunogenic proteins that are located on the surface of Streptococcus suis and are not homologous to the host.

[0008] The prokaryotic expression recombinant plasmid was constructed using the genome of Streptococcus suis SC19 strain as a template and pET-28a plasmid as a vector. IPTG was added at a final concentration of 0.5 mM, and the expression was tested at 16°C for 14 h. Soluble proteins were selected and Western Blot tests were performed with recovered sera collected from piglets infected with Streptococcus suis type 2 and type 9 strains to detect their reactivity. It was found that antigen protein 1, antigen protein 2, and antigen protein 3 could react with type 2 and type 9 positive sera, indicating that they have good reactivity.

[0009] Three proteins, antigen protein 1 (SEQ ID NO.1), antigen protein 2 (SEQ ID NO.2), and antigen protein 3 (SEQ ID NO.3), were purified by Ni-NTA affinity chromatography. SPF-grade 5-week-old female KM mice were divided into five groups, the first group was a negative control group (PBS injection group), the second group was immunized with antigen protein 1, the third group was immunized with antigen protein 2, the fourth group was immunized with antigen protein 3, and the fifth group was immunized with commercialized Streptococcus suis subunit vaccine. After immunization, each group of mice was challenged with Streptococcus suis type 2 and type 9 strains, respectively. The results showed that after the use of a lethal dose of type 2 strain to challenge, the survival rate of the non-immunized negative control group mice was 55%, while the survival rates of the antigen protein 1 immunization group, antigen protein 2 immunization group, antigen protein 3 immunization group and commercialized vaccine group were 100%, 88%, 87% and 100%, respectively. After infection with a lethal dose of strain 9, the survival rate of the unimmunized negative control group mice was 33%, while the survival rates of the mice in the antigen protein 1 immunization group, antigen protein 2 immunization group, antigen protein 3 immunization group and commercial vaccine group were 55%, 88%, 62% and 75%, respectively. The results of the colonization experiment showed that the tissue bacterial load of mice in the commercial vaccine immunization group and the antigen protein 1 immunization group, antigen protein 2 immunization group, and antigen protein 3 immunization group was lower than that in the negative control group, proving that the candidate antigens screened in this study can provide a certain immune protection effect.

[0010] Compared with the prior art, the beneficial effects of the present invention are:

[0011] 1. The method for screening candidate antigens of the present invention comprises the following steps: first, based on the whole genome sequences of Streptococcus suis strains derived from a large number of sick pigs, a pan-genome of Streptococcus suis is constructed and a core genome is selected; further, a reverse vaccinology analysis is performed on the core gene, including subcellular localization analysis, and proteins localized in the cell wall and outside the cell of Streptococcus suis are selected as secretory proteins; then, a transmembrane structure topology analysis is used to improve the accuracy and reliability of the screening; and then, a homology analysis with host proteins and a prediction and analysis of their immunogenicity are performed to select non-homologous proteins with a per identity of <35%.

[0012] 2. According to the screening method proposed in the present invention, a highly immunogenic protein that is localized on the surface of Streptococcus suis and is non-homologous to the host can be obtained, and the candidate antigen protein can have a good cross-immune protection effect, and can provide certain immune protection against multiple Streptococcus suis serotypes, so that the bacterial load of Streptococcus suis type 2 and type 9 strains in various tissues of mice after virus infection is significantly reduced. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Flow chart for screening candidate antigens for subunit vaccines of Streptococcus suis;

[0014] Figure 2 Test expression results for candidate antigens

[0015] Figure 3 The Western Blot results of the antigen protein reacting with positive sera of Streptococcus suis type 2 and type 9, wherein A is the result of the reaction with positive sera of Streptococcus suis type 2; B is the result of the reaction with positive sera of Streptococcus suis type 9;

[0016] Figure 4 This is a diagram of antigen protein purification results, where A. Antigen protein 1; B. Antigen protein 2; C. Antigen protein 3;

[0017] Figure 5 The following is a diagram of the immune protection effect after the infection with Streptococcus suis type 2 strain, where A. The survival curve after the infection with a lethal dose of Streptococcus suis type 2 strain; B. The bacterial load in mouse tissues after the infection with a sublethal dose of Streptococcus suis type 2 strain. Group 1: Negative control group; Group 2: Commercial vaccine group; Group 3: Antigen protein 1 immunization group; Group 4: Antigen protein 2 immunization group; Group 5: Antigen protein 3 immunization group; "*" indicates that the data between the groups are significantly different after significant difference analysis, P<0.05; "**" indicates that the data between the groups are significantly different after significant difference analysis, P<0.01; "***" indicates that the data between the groups are significantly different after significant difference analysis, P<0.001;

[0018] Figure 6The figure is a diagram of immune protection effect after challenge with Streptococcus suis type 9 strain, where A is the survival curve after challenge with a lethal dose of Streptococcus suis type 9 strain; B is the bacterial load in mouse tissues after challenge with a sublethal dose of Streptococcus suis type 9 strain. Group 1: negative control group; Group 2: commercial vaccine group; Group 3: antigen protein 1 immunization group; Group 4: antigen protein 2 immunization group; Group 5: antigen protein 3 immunization group; "*" represents significant difference between groups after significant difference analysis, P<0.05; "**" represents significant difference between groups after significant difference analysis, P<0.01; "***" represents significant difference between groups after significant difference analysis, P<0.001. DETAILED DESCRIPTION

[0019] The present invention is described below with reference to specific examples. It will be appreciated by those skilled in the art that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention in any way.

[0020] Example 1 Reverse vaccinology screening of candidate antigens

[0021] (1) Based on the whole genome sequences of 944 strains of Streptococcus suis from sick pigs, a pan-genome consisting of 6,500 genes was constructed using software such as Prokka and Panaroo. Genes that appeared in 99%-100% of the strains were defined as conserved genes, and it was found that there were 1,492 core genes in these strains.

[0022] (2) The conserved gene sequences in FASTA format obtained in step (1) were batch translated into protein amino acid sequences and input into PSORTb version 3.0.3 (https: / / www.psort.org / psortb / index.html) to predict the localization of proteins in bacterial cells. The organism type was selected as Bacteria and the Gramstain was selected as Positive, i.e., proteins of Gram-positive bacteria were screened out. Other options were preset by the system. PSORTb will provide a predicted subcellular localization for each protein. According to the prediction results of PSORTb, proteins are divided into different subcellular localization groups. Proteins localized in the cell wall and outside the cell of Streptococcus suis were screened out as secreted proteins.

[0023] (3) Select candidate proteins with Unknown and Cytoplasmic Membrane in the PSORTb analysis results for topological analysis of transmembrane structures. The "Cytoplasmic Membrane" category in the PSORTb prediction results includes: a) Transmembrane proteins: proteins that penetrate the cell membrane. b) Membrane-associated proteins: proteins that are connected to the membrane surface but do not completely penetrate it.

[0024] The amino acid sequence in FASTA format was input into phobius (https: / / phobius.sbc.su.se / ), TMHMM-2.0 (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ) and HMMTOP (http: / / www.enzim.hw / hmmtop / index.html) respectively. Proteins with more than 100 amino acids located outside the membrane were identified as surface proteins. Proteins identified as surface proteins by both phobius and TMHMM-2.0 websites could pass the screening, and the results of HMMTOP were used as a reference. At the same time, the proteins that have been screened in the relevant literature were consulted to exclude candidate proteins that have been identified as intramembrane proteins. Through this step, the proteins identified in the candidate proteins obtained in step (2) that are located on the cell wall and outside the cell of Streptococcus suis can be regarded as possible surface proteins, and the accuracy and reliability of the screening can be improved through a variety of methods and standards.

[0025] (4) Using the BLASTp module on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), the amino acid sequences collected in step (3) were compared with the amino acid sequences of the whole genome of pigs (taxid: 9823) in the database, and proteins with per identity < 35% were defined as non-homologous proteins. In biology, the identity percentage in the BLAST results is used as a criterion for determining whether two amino acid sequences have homology. Here, it is stipulated that if it is greater than 35%, the candidate antigen protein to be screened has a high homology with the pig species. If it is used as a candidate antigen protein to design a vaccine, it will cause a serious autoimmune reaction in pigs. Therefore, this study needs to screen for proteins with a per identity of less than 35%, which are called non-homologous proteins.

[0026] (5) The immunogenicity analysis website Vaxijen (https: / / www.ddg-pharmfac.net / vaxijen / VaxiJen / VaxiJen.html) was used to perform immunogenicity analysis on the protein. The amino acid sequence of the non-homologous protein collected in step (4) was input, Bacteria was selected as TARGET ORGANISM, and THRESHOLD was set to >0.5. THRESHOLD is a numerical limit used to distinguish proteins predicted to be antigenic and non-antigenic. The amino acid sequence of the candidate protein was compared with the amino acid sequence of the whole genome of Streptococcus suis (taxid: 1307) by BLASTp, and annotated. According to the annotation information, relevant papers were consulted to complete the gene information, including the function, immunogenicity score, subcellular localization and size of the gene.

[0027] Table 1

[0028]

[0029]

[0030]

[0031]

[0032] Through the above steps, if Figure 1 According to the screening process shown, a total of 83 candidate antigens were obtained according to the analysis method in Example 1, and the amino acid sequences of the candidate antigens for preparing Streptococcus suis vaccine were selected.

[0033] Trial expression of candidate antigenic proteins and immune reaction with positive sera

[0034] The GenBank accession number of the Streptococcus suis SC19 strain used in this example is NZ_CP020863.1.

[0035] The amino acid sequence of the candidate antigen for preparing the Streptococcus suis vaccine screened out in Example 1 was compared and annotated with the amino acid sequence of the Streptococcus suis SC19 strain genome, and the position of the amino acid sequence with high homology to the candidate antigen protein in the genome was located, thereby determining the gene that controls the encoding of the amino acid sequence, that is, the target gene, which was used as a template for the construction of the recombinant plasmid.

[0036] (1) extracting the target gene from the genome of Streptococcus suis SC19 (Gene Bank No. NZ_CP020863.1), using it as a template to design primers and amplify the target gene;

[0037] Using pET-28a plasmid as a template, the vector fragment was amplified using the upstream primer pET28a-F: CTTTAAGAAGGAGATATACCATG as shown in SEQ ID NO.4 and the downstream primer pET28a-R: GTGGTGGTGGTGGTGGTGGTGCTCGAG as shown in SEQ ID NO.5.

[0038] (2) Use homologous recombinase to connect the target gene fragment and the vector, then transform the ligation product into Escherichia coli DH5α competent cells and culture them at 37°C overnight; use the universal primers pET Upstream Primer: ATGCGTCCGGCGTAGA as shown in SEQ ID NO.6 and T7 Terminator Primer: GCTAGTTATTGCTCAGCGG as shown in SEQ ID NO.7 to perform colony PCR amplification to screen and identify positive clones, use a plasmid mini-extraction kit to extract the recombinant plasmid, and finally perform DNA sequencing to identify the recombinant plasmid.

[0039] (3) Select E. coli ClearColi BL21 (DE3) cells transformed with the recombinant plasmid and place them in 5 mL LB medium. Culture them with shaking at 37°C overnight. The next day, transfer them to 20 mL LB medium at a ratio of 1:100 and continue to culture at 37°C until OD 600nm The value was adjusted to 0.6-0.8, and IPTG was added at a final concentration of 0.5mM. The mixture was induced at 16°C overnight. The supernatant sample and the whole bacterial sample after disruption were prepared, and the protein loading buffer was added and boiled. 10μL was taken for SDS-PAGE gel electrophoresis. After the electrophoresis, the SDS-PAGE gel was placed in Coomassie Brilliant Blue dye solution for more than 4 hours, and the decolorization solution was used to decolorize until the target band could be clearly seen.

[0040] (4) Transfer the protein bands to the PVDF membrane using an electroporation condition of 25 V 400 mA for 25 min. After the transfer is completed, add 10 mL of blocking solution and block overnight at 4 °C for about 14 h. Rinse with pre-cooled TBST three times, 5 min each time.

[0041] (5) The PVDF membrane was incubated with 10 mL of 1:1000 anti-S. suis type 2 antiserum and 1:500 anti-S. suis type 9 antiserum at room temperature for 2 h, and then rinsed with pre-cooled TBST for 3 times, 5 min each time. A 1:5000 dilution of goat anti-swine secondary antibody was added and incubated at room temperature for 1 h, and then rinsed with pre-cooled TBST for 3 times, 5 min each time. A 1:1 developer was added, and the membrane was developed in the dark for 3 min, and then developed in a chemiluminescence instrument to identify the immunoreactivity of the protein by Western Blot.

[0042] After obtaining 83 candidate antigens, a portion of the antigens were selected for trial expression using steps (1), (2), and (5). The soluble proteins of the trial expression were then subjected to a reactogenicity test (Western blot), and ultimately three antigen proteins that met the criteria were obtained: antigen protein 1: TroA is 34.2 kDa (such as SEQ ID NO.1), antigen protein 2: YckB is 31.8 kDa (such as SEQ ID NO.2), and antigen protein 3: Gap is 35.8 kDa (such as SEQ ID NO.3).

[0043] Example 2 Purification of candidate antigenic proteins

[0044] (1) The E. coli ClearColi BL21 (DE3) cells transformed with the recombinant plasmid in Example 2 were placed in 50 mL LB medium and cultured at 37°C overnight with shaking. The next day, the cells were transferred to 2 L LB medium at a ratio of 1:100 and cultured at 37°C until OD 600nm The value was adjusted to 0.6-0.8, and IPTG was added to a final concentration of 0.5 mM, and induced overnight at 16°C. After centrifugation, the supernatant was discarded and the cells were collected.

[0045] (2) Resuspend the cells in PBS and break the bacteria using a pressure disruptor. Centrifuge to remove unbroken cells and cell debris and collect the supernatant.

[0046] (3) The bacterial lysis supernatant was mixed with Ni affinity resin, and then the antigen protein was purified using a protein purification instrument in a buffer with gradient imidazole concentration.

[0047] (4) The antigen protein was dialyzed against PBS, concentrated using an ultrafiltration tube, and stored in a -80°C refrigerator.

[0048] The three antigen proteins screened in Example 1 were purified by Ni-NTA affinity chromatography, and single bands with strong signals were obtained respectively, and the bands were consistent with the expected molecular weight of the antigen proteins, such as Figure 3 shown.

[0049] Example 3 Evaluation of the protective effect of vaccine candidate antigens

[0050] (1) SPF-grade 5-week-old female KM mice provided by the Experimental Animal Center of Huazhong Agricultural University were divided into five groups. The first group was a negative control group (PBS injection group), the second group was immunized with a commercialized Streptococcus suis subunit vaccine, the third group was immunized with antigen protein 1, the fourth group was immunized with antigen protein 2, and the fifth group was immunized with antigen protein 3. The dose of the three antigens for inoculation was 0.25 mg / mL. The second immunization was performed 14 days after the first immunization. On the 7th day after the second immunization, each group of mice was challenged with Streptococcus suis type 2 and type 9 strains, respectively.

[0051] The clinical symptoms and survival of mice were observed. The results showed that after the lethal dose of the type 2 strain, the survival rate of the unimmunized negative control group mice was 55%, while the survival rates of the antigen protein 1 immunization group, antigen protein 2 immunization group, antigen protein 3 immunization group and commercial vaccine group were 100%, 88%, 87% and 100%, respectively. After the lethal dose of the type 9 strain, the survival rate of the unimmunized negative control group mice was 33%, while the survival rates of the antigen protein 1 immunization group, antigen protein 2 immunization group, antigen protein 3 immunization group and commercial vaccine group were 55%, 62%, 88% and 75%, respectively.

[0052] (2) Each group was challenged with sublethal doses of Streptococcus suis type 2 and type 9. The mice were killed 6h and 12h after infection, and the heart, liver, spleen, and kidney were collected and ground for colony count. The experimental results showed that the tissue bacterial load of mice in the commercial vaccine immunization group and the antigen protein 1 immunization group, antigen protein 2 immunization group, and antigen protein 3 immunization group was lower than that in the negative control group, indicating that the candidate antigens screened in this study can provide a certain immune protection effect.

Claims

1. A Streptococcus suis antigen protein, characterized in that: The antigen protein includes antigen protein 1, antigen protein 2, and antigen protein 3. Antigen protein 1 contains the amino acid sequence shown in SEQ ID NO.1, antigen protein 2 contains the amino acid sequence shown in SEQ ID NO.2, and antigen protein 3 contains the amino acid sequence shown in SEQ ID NO.

3.

2. A subunit vaccine of Streptococcus suis, characterized in that: The subunit vaccine comprises one or more of antigen protein 1, antigen protein 2, and antigen protein 3 described in claim 1.

3. Use of the antigen according to claim 1 or the vaccine according to claim 2 in diagnosis of Streptococcus suis, characterized in that: The immunization dose of the antigen or vaccine is 0.25 mg / mL.

4. A method for screening Streptococcus suis antigen protein, characterized in that: The following steps are involved: (1) Based on the complete genome sequence of Streptococcus suis strains from sick pigs, genes that appear in 99%-100% of the strains are defined as conserved genes, and the common genes of strains containing conserved genes are defined as core genes; (2) further performing reverse vaccinology analysis on the core gene obtained in step (1), including subcellular localization analysis, and selecting proteins localized in the cell wall and outside the cell of Streptococcus suis as secretory proteins; (3) Select candidate proteins with PSORTb analysis results of Unknown and Cytoplasmic Membrane and then use transmembrane structure topology analysis to screen the secretory proteins in step (2), excluding candidate proteins that have been identified as intramembrane proteins; (4) performing homology comparison between the proteins screened out in step (3) and the host proteins of Streptococcus suis, and selecting non-homologous proteins with per identity < 35%; (5) performing immunogenicity analysis on the amino acid sequences of the non-homologous proteins collected in step (4), and selecting candidate proteins with a THRESHOLD value of ≤0.5 as the amino acid sequences of candidate antigens for preparing a Streptococcus suis vaccine; (6) The amino acid sequence of the candidate antigen for preparing the Streptococcus suis vaccine was screened, compared and annotated with the amino acid sequence of the Streptococcus suis SC19 strain genome, and the position of the amino acid sequence with high homology to the candidate antigen protein in the genome was located, thereby obtaining the target gene encoding the amino acid sequence of the candidate antigen; (7) preparing a recombinant plasmid using the target gene in step (6) and transfecting Escherichia coli, selecting Escherichia coli cells transformed with the recombinant plasmid for culture, expressing the candidate antigen, and performing a reactogenicity test using anti-Streptococcus suis type 2 antiserum and anti-Streptococcus suis type 9 antiserum, respectively, to screen out specific antigenic proteins.

Images