An OpenCRISPR-NLS fusion protein for gene editing of Penaeus monodon and its application

Abstract

The present invention discloses an OpenCRISPR-NLS fusion protein for gene editing of Penaeus monodon and a construction method thereof, as well as a nucleotide construct comprising the OpenCRISPR-NLS fusion protein, and also discloses the use of the fusion protein or the nucleotide construct in gene editing of Penaeus monodon and in population improvement of Penaeus monodon in aquaculture. The present invention has the advantages of efficient gene expression, precise targeting capability, superior genome editing efficiency, reduced off-target effects, wide adaptability, promotion of sustainable aquaculture, and significant economic and social value by codon-optimizing the coding sequence of the OpenCRISPR-1 protein and fusing the nuclear localization signal (NLS) with the codon-optimized OpenCRISPR protein.

Description

Technical Field

[0001] The present invention belongs to the technical field of bioengineering and gene editing, and specifically relates to an OpenCRISPR-NLS fusion protein for gene editing of Penaeus monodon and its application in Penaeus monodon ( Penaeus monodon ) Gene editing, especially its application in site-specific editing of the giant tiger shrimp genome and preparation of nucleotide constructs. Background Art

[0002] CRISPR-Cas gene editing technology has made significant progress in biomedicine, agriculture and other fields. It can achieve efficient genome editing by precisely targeting specific DNA sequences (Pacesa et al., 2024). However, traditional CRISPR-Cas systems are mainly derived from microorganisms in nature and are not suitable for application in complex non-natural hosts such as giant tiger shrimp ( Penaeus monodon ), we often face challenges such as low gene editing efficiency, significant off-target effects, and insufficient host adaptability.

[0003] To solve these problems, the research team of Profluent Bio has made important progress in the research of combining AI technology with CRISPR-Cas system. The team led by scientists such as Jeffrey A. Ruffolo, Stephen Nayfach, and Joseph Gallagher has built a huge CRISPR-Cas sequence database through large-scale data mining and machine learning algorithms. The team systematically analyzed more than 260 billion base pairs of genomic and metagenome data, mined and sorted more than 1.2 million CRISPR operators, and developed a resource library called CRISPR-Cas Atlas (Ruffolo, 2024).

[0004] On this basis, the team used large language models (LLMs) to train and generate a variety of new CRISPR effector proteins with efficient gene editing capabilities, including OpenCRISPR-1 protein. These proteins are predicted and optimized by AI technology, and not only have high diversity, but also show comparable or even better gene editing activity and specificity than traditional CRISPR-Cas systems in experimental verification. Especially in terms of precise targeting and functional retention, these AI-designed proteins have shown significant advantages and can achieve efficient genome editing in non-natural hosts.

[0005] Although the OpenCRISPR-1 protein shows great potential, it still needs to be further optimized when applied to complex biological systems such as Penaeus monodon to improve its expression efficiency and functional activity in specific hosts. Summary of the invention

[0006] The present invention aims to provide an OpenCRISPR-NLS fusion protein for gene editing of Penaeus monodon and a construction method thereof, as well as a nucleotide construct comprising the OpenCRISPR-NLS fusion protein.

[0007] The present invention also aims to provide the use of the above-mentioned OpenCRISPR-NLS fusion protein or the nucleotide construct in gene editing of Penaeus monodon.

[0008] The first object of the present invention can be achieved by the following technical solution: an OpenCRISPR-NLS fusion protein for gene editing of Penaeus monodon, the nucleotide sequence encoding the fusion protein is shown in SEQ ID NO: 4, and the fusion protein consists of the following parts:

[0009] A CRISPR effector protein designed and predicted by an artificial intelligence algorithm AI, wherein the nucleotide sequence of the CRISPR effector protein has been codon-optimized for Penaeus monodon and has the ability to recognize specific genomic targets of Penaeus monodon;

[0010] The nuclear localization signal NLS is fused to the CRISPR effector protein after codon optimization in Penaeus monodon to enhance its localization and editing efficiency in the cell nucleus of Penaeus monodon.

[0011] OpenCRISPR proteins were originally developed by the research team of Profluent Bio, who used artificial intelligence technology combined with large-scale data mining to design and generate new CRISPR effector proteins with efficient gene editing capabilities. However, when these proteins are directly applied to complex biological systems such as giant tiger shrimp, they still face problems such as low expression efficiency and insufficient functional stability.

[0012] Therefore, the present invention optimizes the OpenCRISPR protein in a targeted manner to improve its performance in Penaeus monodon.

[0013] Preferably, the CRISPR effector protein before optimization is OpenCRISPR-1, the nucleotide sequence encoding the OpenCRISPR-1 is shown in SEQ ID NO: 1, the amino acid sequence of the OpenCRISPR-1 is shown in SEQ ID NO: 2, and the nucleotide sequence of the CRISPR effector protein after codon optimization for Penaeus monodon is shown in SEQ ID NO: 3.

[0014] The nucleotide sequence of the CRISPR effector protein of the present invention is codon-optimized for Penaeus monodon without changing the corresponding amino acid sequence, so as to improve its expression level and functional activity in Penaeus monodon cells.

[0015] The present invention optimizes the codons of the OpenCRISPR-1 protein specifically for Penaeus monodon. Through this process, the coding sequence of the protein is adjusted to be more in line with the translation preference of Penaeus monodon cells, thereby improving the expression level and stability of the protein in Penaeus monodon cells.

[0016] In addition, in order to further enhance the localization efficiency of OpenCRISPR-1 protein in the cell nucleus of Penaeus monodon, the present invention fuses the protein with a nuclear localization signal (NLS). NLS is a short peptide sequence derived from the T antigen of the virus SV40, which can guide the fusion protein to effectively enter the cell nucleus and improve the accuracy and efficiency of the gene editing process. Through this fusion, the performance of OpenCRISPR-NLS fusion protein in genome editing of Penaeus monodon has been significantly improved.

[0017] Therefore, the present invention optimizes the coding sequence of OpenCRISPR-1 protein by codons to make it more consistent with the gene expression preference of Penaeus monodon, thereby improving the translation efficiency and protein stability in the host cell. At the same time, in order to enhance the localization accuracy and gene editing effect of the protein in the cell nucleus of Penaeus monodon, the present invention fuses the nuclear localization signal (NLS) with the codon-optimized OpenCRISPR-1 protein. This fusion strategy significantly improves the targeted localization ability of the protein in the cell nucleus, thereby enhancing the efficiency and specificity of genome targeted editing.

[0018] The optimized OpenCRISPR-NLS fusion protein not only greatly improved the expression efficiency and gene editing specificity in Penaeus monodon cells, but also significantly reduced off-target effects. The development of this technology provides an innovative and powerful tool for the genetic improvement of aquaculture species such as Penaeus monodon, especially in enhancing disease resistance and optimizing growth performance. In addition, the potential application of this optimized protein in other complex biological systems has also opened up new directions for the development of gene editing technology.

[0019] The present invention also provides a method for constructing the above-mentioned OpenCRISPR-NLS fusion protein, which comprises the following steps:

[0020] (1) Use machine learning algorithms to predict and generate CRISPR effector protein sequences with specific genomic target recognition capabilities;

[0021] (2) The CRISPR effector protein sequence is codon-optimized for Penaeus monodon and fused with the nuclear localization signal NLS to form an OpenCRISPR-NLS fusion protein.

[0022] The present invention also provides a nucleotide construct comprising the above-mentioned OpenCRISPR-NLS fusion protein, wherein the nucleotide construct comprises:

[0023] 1) A nucleotide sequence encoding the OpenCRISPR-NLS fusion protein;

[0024] 2) A promoter for efficient expression in Penaeus monodon cells.

[0025] Preferably, the promoter in 2) is CMV or T7.

[0026] As a preferred technical solution of the present invention, the nucleotide construct is an Open CRISPR-NLS-GS-CMV-100A-BspQI vector.

[0027] The above-mentioned second object of the present invention can be achieved by the following technical scheme: application of the above-mentioned OpenCRISPR-NLS fusion protein or the above-mentioned nucleotide construct in gene editing of Penaeus monodon.

[0028] The application further comprises:

[0029] (1) introducing a nucleotide construct comprising the OpenCRISPR-NLS fusion protein into a Penaeus monodon cell;

[0030] (2) expressing and activating the OpenCRISPR-NLS fusion protein;

[0031] (3) Using the OpenCRISPR-NLS fusion protein to target specific sites in the genome of Penaeus monodon for gene editing.

[0032] Preferably, the gene editing in step (3) includes gene knock-in, knock-out or correction.

[0033] The traits of Penaeus monodon can be further improved by gene knock-in, knock-out or correction, including enhancing disease resistance, increasing growth rate or improving meat quality.

[0034] As a preferred embodiment of the present invention, the gene in step (3) is the Penaeus monodon NFAT5 gene.

[0035] Therefore, the OpenCRISPR-NLS fusion protein of the present invention is useful in the field of gene editing, especially in Penaeus monodon ( Penaeus monodon) has shown many significant advantages in genome site-specific editing.

[0036] The codon-optimized OpenCRISPR-NLS fusion protein showed excellent results in genome editing of Penaeus monodon, and was able to achieve efficient and accurate gene knock-in, knock-out or correction. This provides an important tool for improving the disease resistance, accelerated growth and other economic traits of Penaeus monodon. In addition, this optimization strategy of the present invention not only shows significant advantages in Penaeus monodon, but also provides an important reference for the future application of gene editing in other complex biological systems. Through the present invention, the wide application of gene editing technology in aquaculture, biomedicine and agriculture will be further promoted, with significant economic and social value.

[0037] Therefore, the present invention also provides the use of the above-mentioned OpenCRISPR-NLS fusion protein or the above-mentioned nucleotide construct in population improvement of aquacultured Penaeus monodon.

[0038] The present invention has the following advantages:

[0039] (1) Efficient gene expression:

[0040] By using artificial intelligence (AI) technology to design CRISPR effector proteins and optimizing codons for the specific needs of Penaeus monodon, the expression of OpenCRISPR-NLS fusion proteins in Penaeus monodon cells was significantly enhanced. Codon optimization is to select codons that are more in line with the preferences of the host species, reduce the possibility of inefficient expression and protein misfolding, thereby ensuring efficient production of proteins in host cells. This improvement not only increases the expression of proteins, but also enhances their stability, making the gene editing process smoother and more reliable.

[0041] (2) Accurate targeting capability:

[0042] By fusing the nuclear localization signal (NLS) with the CRISPR effector protein, the present invention greatly improves the localization accuracy of the protein in the cell nucleus of Penaeus monodon. NLS can guide the fusion protein to effectively enter the cell nucleus, which is the core area where the gene editing reaction occurs. By enhancing the localization in the cell nucleus, the efficient effect of the gene editing tool on the target site is ensured, thereby improving the accuracy of gene editing and significantly reducing off-target effects. This improvement is particularly important because in a complex genome, precise gene editing can avoid non-specific mutations, reduce potential side effects, and improve the safety and effectiveness of genome editing.

[0043] (3) Superior genome editing efficiency:

[0044] The OpenCRISPR-NLS fusion protein of the present invention shows excellent efficiency in genome editing of Penaeus monodon. Compared with the traditional CRISPR-Cas9 system, the fusion protein can achieve more efficient gene knock-in, knock-out or correction, ensuring that the expected gene editing effect is obtained in a shorter time. This efficient genome editing capability enables researchers to complete gene function research and trait improvement experiments more quickly, and greatly improves breeding efficiency in practical applications. For example, by efficiently editing genes related to disease resistance and rapid growth, the commercial value and aquaculture yield of Penaeus monodon can be significantly improved.

[0045] (4) Reduce off-target effects:

[0046] Through AI design and NLS fusion, the present invention significantly reduces the off-target effects that are common in gene editing. Off-target effects are a major problem in gene editing, which may lead to unexpected mutations in non-target genes and cause adverse consequences. Through the precise design and optimization of proteins by AI, combined with the precise positioning of NLS, the AI-OpenCRISPR-NLS fusion protein can more accurately identify and cut the target sequence, minimizing non-specific editing. This advantage greatly improves the safety of gene editing, making it more suitable for application in biological systems involving complex interactions of multiple genes.

[0047] (5) Wide adaptability:

[0048] Although the present invention is optimized specifically for Penaeus monodon, its design and optimization strategies are also applicable to gene editing of other species and complex genomes. This means that similar AI design, codon optimization and NLS fusion methods can be extended to other economic aquatic products, crops and mammalian genome modification. This wide adaptability makes the technology not only limited to aquaculture, but also has the potential to have a profound impact in many fields such as agricultural biotechnology, medical research, and gene therapy.

[0049] (6) Promoting sustainable aquaculture:

[0050] The present invention supports a more sustainable aquaculture method by improving the disease resistance and growth performance of Penaeus monodon. Through efficient and accurate gene editing, the dependence on antibiotics and chemicals can be reduced, thereby reducing environmental pollution and production costs. In addition, the improved shrimp varieties show stronger stress resistance and higher survival rate during the breeding process, thereby improving the overall benefits of breeding. This technological application not only helps to meet the global demand for high-quality aquatic products, but also plays a positive role in environmental protection and sustainable resource utilization.

[0051] (7) Economic and social value: The OpenCRISPR-NLS fusion protein and its optimization strategy of the present invention have significant economic and social value. Efficient gene editing tools can shorten the breeding cycle, reduce R&D costs, and increase yield and quality by improving varieties, thereby enhancing market competitiveness. In addition, in a wider range of applications, this technology is expected to promote the development of multiple fields such as agriculture, medicine and biotechnology, and bring extensive economic benefits and health benefits to society. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] The present invention will be further described below in conjunction with embodiments with reference to the accompanying drawings.

[0053] Figure 1 Schematic diagram of the construction and verification of the OpenCRISPR-NLS vector in Example 1: construction of the OpenCRISPR-NLS vector; analysis of the OpenCRISPR sgRNA structure; and OpenCRISPR-NLS mRNA structure;

[0054] Figure 2 This is the peak diagram of the first generation sequencing of NFAT5 target sequencing detection before OpenCRISPR codon optimization in Example 1;

[0055] Figure 3 The knockout validation of OpenCRISPR-NLS in Penaeus monodon hemocytes in Example 1: NFAT5 target site sequencing detection first generation sequencing peak diagram;

[0056] Figure 4 The OpenCRISPR-EGFP and OpenCRISPR-NLS-EGFP in Example 1 were transfected into Penaeus monodon, and the fluorescence of the nauplii of Penaeus monodon was observed. DETAILED DESCRIPTION

[0057] The present invention is further described below in conjunction with specific examples. The following examples and drawings are only used for illustrative purposes and are not to be construed as limiting the present invention. Unless otherwise specified, the reagent raw materials used in the following examples are conventional commercially available or commercially available raw reagent raw materials, and unless otherwise specified, the methods and equipment used in the following examples are conventional methods and equipment used in the art.

[0058] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0059] Example 1

[0060] The present invention is further described below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0061] This embodiment designs a fusion protein and a corresponding nucleotide construct to achieve the effect of Penaeus monodon ( Penaeus monodon The core of this method is to use artificial intelligence (AI) to design and optimize the OpenCRISPR-1 sequence, and combine it with the nuclear localization signal (NLS) to form an OpenCRISPR-NLS fusion protein.

[0062] The specific implementation includes the following steps:

[0063] 1. AI designs and optimizes OpenCRISPR-1 sequences

[0064] 1.1 Dataset preparation and model training

[0065] The first step in the design process was to build and organize a large-scale dataset containing a variety of CRISPR effector protein sequences (https: / / www.profluent.bio / ). These sequences come from a wide range of genomic and metagenomic data, including various CRISPR-Cas systems known in nature. Through screening and annotation, the research team extracted key functional regions, such as nuclease activity regions (such as RuvC and HNH domains), which play a central role in DNA cutting and genome editing. Subsequently, these sequence data were processed using deep learning technology. The basis of the training model is large language models (LLMs), which were originally used for natural language processing, but were adjusted and optimized in this invention for the generation and optimization of protein sequences. By inputting a large amount of sequence information of CRISPR effector proteins, the model learned the complex relationship between protein sequence and its function, and was able to predict the impact of sequence variation on protein function.

[0066] 1.2 Sequence design and generation

[0067] Based on the training model, the AI ​​system began to generate new CRISPR effector protein sequences. The OpenCRISPR-1 sequence was generated during this generation process. The focus of AI design is to ensure that the newly generated sequence can introduce adaptive mutations while retaining core functions to meet the specific genome editing needs of Penaeus monodon. The AI-designed OpenCRISPR-1 sequence structurally retains the key nuclease activity regions in the CRISPR system, but introduces optimized sequence mutations in non-conserved regions. These mutations are accurately predicted by the AI ​​model to enhance the stability of the protein and improve its functional expression ability in non-natural hosts. In addition, editing specificity is also taken into account during the design process to ensure that the generated OpenCRISPR-1 protein can achieve high-precision targeted editing in the genome of Penaeus monodon.

[0068] 1.3 Sequence optimization and verification

[0069] After the initial OpenCRISPR-1 sequence was generated, further optimization steps ensured its effectiveness in Penaeus monodon. First, the AI ​​model simulated the binding and cutting process of the OpenCRISPR-1 protein to the target DNA sequence in the Penaeus monodon genome to evaluate its editing efficiency and off-target risk. Through these simulations, the AI ​​was able to identify potential off-target effects and adjust the sequence to minimize nonspecific cutting. After the optimal sequence was determined, codon optimization was performed. This process is to adjust the coding sequence of the OpenCRISPR-1 protein to make it more consistent with the translation preference of Penaeus monodon cells. Through this optimization, the expression level and stability of the protein can be improved, thereby ensuring efficient function in practical applications.

[0070] 2. Construction of Nucleotide Expression Vector

[0071] 2.1 Nucleotide sequence design and optimization

[0072] The coding sequence of OpenCRISPR-1 was codon-optimized to improve the expression efficiency of the protein in the target cells.

[0073] The nucleotide sequence of OpenCRISPR-1 before optimization is shown in SEQ ID NO: 1 (https: / / github.com / Profluent-AI / OpenCRISPR / tree / main / OpenCRISPR-1).

[0074] Its amino acid sequence is shown in SEQ ID NO:2.

[0075] The codon preference of Penaeus monodon was optimized without changing the corresponding amino acid sequence, and it was named AI-OpenCRISPR. It was synthesized using artificial sequence synthesis. The nucleotide sequence of AI-OpenCRISPR after codon optimization of Penaeus monodon is shown in SEQ ID NO: 3.

[0076] A strong promoter (such as CMV or T7) and a terminator are inserted into the construct to ensure high-level expression in Penaeus monodon cells.

[0077] 2.2 Vector construction

[0078] The AI-OpenCRISPR-NLS coding sequence was designed, the codons of the sequence were optimized to improve its expression efficiency in Penaeus monodon cells, and it was fused with the nuclear localization signal NLS (the NLS sequence is the T antigen of the virus SV40, and the OpenCRISPR-NLS nucleotide sequence was synthesized. The nucleotide sequence encoding the OpenCRISPR-NLS fusion protein is shown in SEQ ID NO: 4, which is as follows:

[0079]

[0080] 2.3 Construction of the fusion vector of AI-OpenCRISPR-NLS and GS-CMV vector

[0081] 2.3.1 Design and cloning

[0082] The synthesized OpenCRISPR-NLS nucleotide sequence was inserted into the GS-CMV vector by molecular cloning technology to synthesize the OpenCRISPR-NLS-GS-CMV-100A-BspQI vector, ensuring that the vector contains a strong promoter (such as CMV) to promote high-level expression.

[0083] 2.3.2 Vector construction verification

[0084] Correct insertion of the OpenCRISPR-NLS sequence into the vector was verified using restriction endonuclease digestion and PCR amplification.

[0085] The integrity and correctness of the inserted sequence were confirmed by sequencing.

[0086] 2.4 Transcription into OpenCRISPR-NLS

[0087] The linearized vector containing the T7 promoter was used as a template for in vitro transcription reactions.

[0088] OpenCRISPR-NLS was synthesized by transcription using T7 RNA polymerase.

[0089] Transcribe OpenCRISPR-NLS mRNA as Figure 1 shown.

[0090] 3. sgRNA Design and Synthesis

[0091] Gene editing of blood cells of Penaeus monodon

[0092] Before implementing the method of the present invention, first prepare 60-day-old Penaeus monodon, draw blood from it using sodium citrate anticoagulant, prepare blood cells of Penaeus monodon, use L15 basic culture medium, culture at 28° C. in the dark for 24 hours, and then use it for transfection.

[0093] The present invention is further described in detail below in conjunction with embodiments.

[0094] The NFAT5 gene is an important gene in the genome of Penaeus monodon.

[0095] The NFAT5 gene (Nuclear Factor of Activated T-cells 5) is considered to be an important transcription factor involved in osmotic pressure regulation in many organisms. It plays a key role in the osmotic pressure balance and adaptive response of cells by regulating the response of cells to hypertonic environments. For marine organisms such as Penaeus monodon, the NFAT5 gene has a particularly important function in adapting to the changing salinity and osmotic pressure in their living environment.

[0096] Since the giant tiger shrimp lives in the ocean and saltwater environments, the cells in its body are often exposed to high osmotic pressure. Therefore, the expression and function of the NFAT5 gene are essential for maintaining the balance of fluid inside and outside the cells. When the giant tiger shrimp is exposed to a low-salinity environment, the NFAT5 gene is activated and drives the expression of downstream genes. The proteins encoded by these genes can help cells regulate the balance of water and ions in the body, thereby protecting cells from damage caused by osmotic pressure.

[0097] The activity of the NFAT5 gene in Penaeus monodon is not limited to salinity regulation, it may also be involved in other physiological processes related to environmental stress. For example, the NFAT5 gene may play a role in the immune response of shrimp, helping them resist pathogens and other stressors in the environment. In addition, the regulatory role of the NFAT5 gene also involves cell survival, proliferation and metabolic regulation, which have a profound impact on the growth, development and health maintenance of Penaeus monodon.

[0098] In general, the role of the NFAT5 gene in Penaeus monodon is mainly reflected in regulating the osmotic stress response, promoting cell adaptation to high-salinity environments, and participating in the immune defense mechanism of the shrimp when possible. The study of this gene provides an important scientific basis for understanding how Penaeus monodon adapts to its natural living environment, especially salinity changes, and also provides a potential target for improving the stress resistance and survival ability of the shrimp through gene editing.

[0099] In order to achieve effective editing of the NFAT5 gene of Penaeus monodon, it is necessary to accurately design the sgRNA of the AI-OpenCRISPR-NLS system. The following are the steps for designing the AI-OpenCRISPR-NLS target of the NFAT5 gene:

[0100] 3.1 Obtaining the NFAT5 gene sequence of Penaeus monodon:

[0101] First, the complete sequence of the NFAT5 gene of Penaeus monodon needs to be obtained, which can be obtained through the public database NCBI.

[0102] NCBI Reference Sequence:LOC119595622.

[0103] (a) Sequence characteristics

[0104] * Length: 3240 base pairs

[0105] *Type: Nucleotide

[0106] *Chain type: double chain

[0107] *Topology: Linear

[0108] (b) Molecule type: Nucleic acid

[0109] Sequence description: LOC119595622.

[0110] 3.2 Target identification and selection:

[0111] Target location: In the NFAT5 gene sequence, regions with the typical PAM sequence NGG were selected as potential CRISPR targets. In general, targets located near functional domains or key coding regions are selected to increase the possibility of phenotypic changes after editing.

[0112] Specificity analysis: Use the online tool Chopchop to perform target specificity analysis. These tools can assess the uniqueness of the selected target in the genome and reduce the risk of off-target editing. Ensure that the selected target has high specificity throughout the genome.

[0113] sgRNA design:

[0114] Sequence design: sgRNA is designed according to the selected target sequence. sgRNA usually includes a 20-nucleotide targeting sequence, immediately adjacent to the PAM sequence.

[0115] Optimization: Optimization of the sgRNA sequence may include increasing the GC content to enhance stability and binding efficiency, or introducing modifications into the sequence to improve resistance to nuclease degradation.

[0116] The designed sequence is: GGCACTTGGTACTCTTCTTG.

[0117] sgRNA synthesis: According to the optimized design, sgRNA is synthesized, and chemical modifications need to be introduced when synthesizing mRNA.

[0118] The specific steps of sgRNA synthesis include:

[0119] Chemical modification:

[0120] During the synthesis of sgRNA, N1-methyl pseudouridine (m1Ψ) is introduced, and chemical modification is performed at the uracil site to replace uridine (U) with N1-methyl pseudouridine. This modification helps reduce the risk of sgRNA being degraded by endogenous nucleases in cells and improves its stability and translation efficiency.

[0121] Introduction of N1-methylpseudouridine:

[0122] During in vitro transcription, m1Ψ is introduced using a transcriptase to ensure uniformity and high efficiency of the modification. This modification can reduce the chance of mRNA being recognized by the cellular immune system and reduce the ability to activate pattern recognition receptors such as RIG-I.

[0123] Synthetic sequence:

[0124] Combined with the optimized design, sgRNA synthesis was performed, and the sequence after chemical modification was:

[0125] mG*mG*mC*ACUUGGUACUCUUCUUGGUUUUAGAGCUGGAAACAGCAAGUUAAAAUAAGGCUUUGUCCGUAUCCAACUUGAAAAAGUGAGCACCGAUUCGG*mU*mG*mC.

[0126] 4. Gene delivery and verification

[0127] 4.1 Preparation of transfection mixture

[0128] AI-OpenCRISPR-NLS mRNA was mixed with sgRNA targeting the NFAT5 gene at a ratio of 1:1 to prepare 36 nmol of sgRNA and 36 nmol of AI-OpenCRISPR-NLS mRNA. Subsequently, 3.75 μL of Lipofectamine™3000 was mixed with 3.75 μL of Opti-MEM™ Reduced Serum Medium and incubated at room temperature for 10 minutes to form a transfection mixture.

[0129] 4.2 Preparation of Penaeus monodon hemocytes

[0130] Blood cells extracted from Penaeus monodon were pre-cultured: the blood cells were placed in L15 medium containing antibiotics and cultured at 28°C for 24 hours to help the cells recover and adapt to the new environment. This pre-culture step is intended to improve the transfection efficiency of the cells during the subsequent gene editing process.

[0131] 4.3 Transfection process

[0132] After pre-culture, the blood cells of Penaeus monodon were removed from the L15 medium and transferred to Opti-MEM™ Reduced Serum Medium. The prepared transfection mixture (including AI-OpenCRISPR-NLS mRNA and sgRNA targeting the NFAT5 gene) was added to 1.5 mL of cell culture medium and co-cultured with the blood cells. Incubate at 28°C for 72 hours, during which the medium was changed every day to ensure that the cells were in a good growth state and avoid possible stress responses.

[0133] 4.4 Extraction and verification of genomic DNA

[0134] 72 hours after transfection, genomic DNA was extracted from the blood cells of treated Penaeus monodon using a commercial DNA extraction kit. Subsequently, PCR amplification was performed using primers specific to the NFAT5 gene editing region to ensure that only the target region was amplified. The amplified PCR product was sent to a high-throughput sequencing platform to verify the gene editing results. By comparing the sequencing results with the target site region, the editing of the NFAT5 gene was confirmed, and the efficiency and accuracy of gene editing were analyzed.

[0135] In this study, the OpenCRISPR system was used to edit the NFAT5 gene, and the effect of gene editing was verified by first-generation sequencing. The experimental results showed that ( Figure 2 ), without codon optimization, the target site of the NFAT5 gene failed to be successfully edited, and the sequencing results showed a single peak, indicating that the editing failed. After codon optimization of CRISPR-related nuclease mRNA, the sequencing results changed significantly, and a clear double peak appeared at the target site of the NFAT5 gene, indicating that the gene editing was successful at this site. This experimental result further proves that codon optimization improves the translation efficiency of mRNA and enhances the protein expression level, thereby significantly improving the efficiency of the OpenCRISPR system in NFAT5 gene editing ( Figure 3 ).

[0136] In order to verify the nuclear entry efficiency of Cas nuclease in cells in the OpenCRISPR system, a Cas-NLS-EGFP fusion protein was constructed, and the changes in fluorescence signals after transfection were observed under a microscope to evaluate its nuclear entry level. The results showed that when Cas-NLS mRNA was transfected into cells, the green fluorescence intensity in the cells was significantly enhanced, indicating that the nuclease successfully entered the cell nucleus and exerted its effect. In contrast, after transfection of Cas-EGFP (without the nuclear localization signal NLS), the observed fluorescence signal was weak, indicating that the nuclear entry efficiency of Cas was low when NLS was not added. This example significantly improves the directional positioning efficiency of Cas nuclease in the cell nucleus by introducing a nuclear localization signal (NLS) at the N-terminus or C-terminus of the Cas nuclease. This optimized design not only enhances the activity of the Cas nuclease in the OpenCRISPR system, but also ensures the efficient nuclear entry of the nuclease during gene editing ( Figure 4 ).

[0137] The above embodiments are only used to illustrate the present invention, and the protection scope of the present invention is not limited to the above embodiments. A person skilled in the art can achieve the purpose of the present invention based on the above disclosure of the present invention, and any improvement and deformation based on the concept of the present invention shall fall within the protection scope of the present invention, and the specific protection scope shall be subject to the claims.

Claims

1. An OpenCRISPR-NLS fusion protein for gene editing of Penaeus monodon, characterized in that: The nucleotide sequence encoding the fusion protein is shown in SEQ ID NO:

4.

2. The OpenCRISPR-NLS fusion protein for gene editing of Penaeus monodon according to claim 1, characterized in that: The fusion protein consists of the following parts: A CRISPR effector protein designed and predicted by an artificial intelligence algorithm AI, wherein the nucleotide sequence of the CRISPR effector protein has been codon-optimized for Penaeus monodon and has the ability to recognize specific genomic targets of Penaeus monodon; The nuclear localization signal NLS is fused to the CRISPR effector protein after codon optimization in Penaeus monodon to enhance its localization and editing efficiency in the cell nucleus of Penaeus monodon.

3. The OpenCRISPR-NLS fusion protein for gene editing of Penaeus monodon according to claim 2, characterized in that: The CRISPR effector protein is OpenCRISPR-1, the nucleotide sequence encoding the OpenCRISPR-1 is shown in SEQ ID NO: 1, the amino acid sequence of the OpenCRISPR-1 is shown in SEQ ID NO: 2, and the nucleotide sequence encoding the OpenCRISPR-1 after codon optimization for Penaeus monodon is shown in SEQ ID NO:

3.

4. A nucleotide construct, characterized in that The nucleotide construct comprises: 1) A nucleotide sequence encoding the OpenCRISPR-NLS fusion protein according to any one of claims 1 to 3; 2) A promoter for efficient expression in Penaeus monodon cells.

5. The nucleotide construct according to claim 4, characterized in that The promoter in 2) is CMV or T7; the nucleotide construct is AI-Open CRISPR-NLS-GS-CMV-100A-BspQI vector.

6. Use of the OpenCRISPR-NLS fusion protein according to any one of claims 1 to 3 or the nucleotide construct according to claim 4 or 5 in gene editing of Penaeus monodon.

7. The use according to claim 6, characterized in that: The following steps are involved: (1) introducing a nucleotide construct comprising the OpenCRISPR-NLS fusion protein according to any one of claims 1 to 3 into a Penaeus monodon cell; (2) expressing and activating the OpenCRISPR-NLS fusion protein; (3) Using the OpenCRISPR-NLS fusion protein to target specific sites in the genome of Penaeus monodon for gene editing.

8. The use according to claim 7, characterized in that: The gene editing described in step (3) includes gene knock-in, knock-out or correction.

9. The use according to claim 7, characterized in that: The gene in step (3) is the NFAT5 gene of Penaeus monodon.

Images