Method and application of editing TIM3 gene to obtain functionally enhanced CAR-NK cells

Abstract

The present invention provides a method and application of editing the TIM3 gene to obtain functionally enhanced CAR-NK cells. Specifically, the present invention provides a method for gene editing of stem cells to differentiate and obtain functionally enhanced NK cells, a gene editing method for stem cells, and NK cells, stem cells, and pharmaceutical compositions and preparations thereof obtained by the method. The editing method of the present invention can effectively promote the differentiation of stem cells into NK cells without affecting the amplification capacity of NK cells, and can obtain functionally enhanced NK cells, which have better survival ability and killing effect in the process of tumor cell killing.

Description

Technical Field

[0001] The present invention relates to the field of gene editing, and more specifically to a method and application of editing the TIM3 gene to obtain functionally enhanced CAR-NK cells. Background Art

[0002] Gene editing technology, especially the CRISPR / Cas9 system, provides a powerful tool for precisely modifying the genetic material of an organism. CRISPR / Cas9 technology allows researchers to design specific single-stranded guide RNA (sgRNA) to guide the Cas9 nuclease to a specific site in the genome to achieve precise DNA cutting. The efficiency, flexibility and precision of this system make it the tool of choice for gene editing. However, CRISPR / Cas9 technology also has challenges, including off-target effects (i.e., Cas9 cuts DNA at non-target sites) and optimization of editing efficiency and specificity.

[0003] In the process of gene editing, "safe harbors" are often selected for editing. "Safe harbors" refer to those regions with lower mutation rates and higher genetic stability at specific locations in the genome. Therefore, selecting these sites for operation in gene editing can reduce non-target effects and improve the safety and effectiveness of gene editing. For example, the Rosa26 site is the first "Safe Harbor" site discovered. It provides a safe location in the mouse genome for the insertion and expression of exogenous genes without affecting the normal development and reproduction of mice. In addition to the Rosa26 site, there are other sites, such as H11, TIGRE, Col1a1, etc., which have also been proven to be safe insertion sites that can be used for stable gene expression. The AAVS1 site on human chromosome 19 is also considered a safe site for integrating target genes, screening markers or other genetic factors into the human genome through CRISPR-Cas9-mediated homologous recombination (HR) reactions to ensure long-term and stable expression of the transferred genes.

[0004] However, when it is necessary to perform gene editing on stem cells, such as induced pluripotent stem cells (iPS cells, iPSC), on the one hand, compared with immortal cell lines, the efficiency of directed homologous recombination repair (HDR) in stem cells is low, and HDR is the main method for exogenous donor DNA to repair CRISPR-induced double-strand breaks; on the other hand, gene editing may affect the expression of pluripotency markers and differentiation potential of stem cells, and may affect the maturation stage and functional expression of NK cells during stem cell differentiation, thereby affecting their ability to kill tumor cells; therefore, gene editing is only performed at safe sites, and the demand for stem cells and their differentiation into NK cells still needs to further improve its editing efficiency, or reduce the adverse effects of gene editing on the process of stem cell differentiation into NK cells and even on NK cell function.

[0005] Therefore, there is an urgent need in this field to develop a new gene editing method for stem cells, in order to reduce the adverse effects of gene editing on the process of stem cell differentiation into NK cells and even on NK cell function, or even to enhance the function of NK cells. Summary of the invention

[0006] The purpose of the present invention is to provide a new gene editing method for stem cells to enhance the function of NK cells and obtain NK cells with enhanced function.

[0007] In a first aspect of the present invention, a method for gene editing of stem cells to differentiate into NK cells with enhanced functions is provided, the method comprising the steps of:

[0008] (Z1) knocking in an exogenous target gene at the TIM3 gene locus in the stem cell genome using gene editing technology, and / or knocking out the TIM3 gene or a TIM3 gene fragment in the stem cell genome using gene editing technology; and

[0009] (Z2) Induce gene-edited stem cells to differentiate into NK cells, thereby obtaining NK cells with enhanced functions.

[0010] In another preferred embodiment, the method is an in vitro method.

[0011] In another preferred embodiment, the method is for non-disease treatment purposes or non-disease diagnosis purposes.

[0012] In another preferred embodiment, the stem cells are selected from the group consisting of induced pluripotent stem cells (iPSC), embryonic stem cells (ESC), hematopoietic stem cells (HSC), mesenchymal stem cells, or a combination thereof; preferably, the stem cells are selected from the group consisting of induced pluripotent stem cells (iPSC), embryonic stem cells (ESC), hematopoietic stem cells (HSC), or a combination thereof; more preferably, the stem cells are induced pluripotent stem cells (iPSC).

[0013] In another preferred embodiment, the step (Z1) comprises: using gene editing technology to knock in an exogenous target gene at the TIM3 gene site of the stem cell genome, and knocking out the TIM3 gene at the same time.

[0014] In another preferred embodiment, the gene editing technology is CRISPR / Cas9, TALEN.

[0015] In another preferred embodiment, the gene editing technology uses sgRNA, and the transcription template sequence of the sgRNA is shown in SEQ ID NO: 1.

[0016] In another preferred embodiment, the iPSCs are derived from cells selected from the group consisting of differentiated cells of human origin such as human fibroblasts, human peripheral blood mononuclear cells, human hematopoietic stem cells, or a combination thereof.

[0017] In another preferred embodiment, the exogenous target gene includes: a therapeutic gene, a reporter gene, a suicide gene, an immunomodulatory gene, or a combination thereof.

[0018] In another preferred embodiment, the exogenous target gene includes a chimeric antigen receptor (CAR) gene.

[0019] In another preferred embodiment, the CAR targets tumor surface antigens.

[0020] In another preferred embodiment, the tumor surface antigens include but are not limited to: CD19, CD20, PD-1, PD-L1, Claudin 18.2, BCMA, CD22, CD24, CD25, CD30, CD33, CD38, CD44, CD52, CD56, CD70, CD96, CD97, CD99, CD123, EGFR, HER2, HER3, CD117, C-Met, EGFR, EGFRvIII, ERBB3, ERBB4, VEGFR1, VEGFR2, ROR1, PTHR2, B7-H1 (PD-L1), B7-H2, B7-H3, B7-H4, B7-H5, B7-H6, B7-H7, Trop-2, GPC-3, EPCAM, DLL-3, Nectin-4, Claudin6, Muc-1, PSMA, GD3, FAP, CEA, EphA2, CTLA-4, LAG-3, TIGIT, MSLN, or a combination thereof.

[0021] In another preferred embodiment, the tumor surface antigen is CD19.

[0022] In another preferred embodiment, the exogenous target gene includes a chimeric antigen receptor (CAR) gene targeting CD19.

[0023] In another preferred embodiment, the CAR has a structure as shown in the following formula I:

[0024] L-EB-H-TM-C-CD3ζ (I)

[0025] In the formula,

[0026] Each "-" is independently a connecting peptide or a peptide bond;

[0027] L is none or an optional signal peptide sequence;

[0028] EB is the extracellular binding domain that targets tumor surface antigens;

[0029] H is an optional hinge region;

[0030] TM is the transmembrane domain;

[0031] C is a co-stimulatory signal molecule;

[0032] CD3ζ is a cytoplasmic signaling sequence derived from CD3ζ.

[0033] In another preferred embodiment, L is a signal peptide of an immune cell surface molecule commonly used in the art, preferably a signal peptide of a protein selected from the following group: CD8, CD28, GM-CSF, CD4, CD137, NKG2D, or a combination thereof.

[0034] In another preferred embodiment, the EB is an anti-CD19 antibody or an antigen-binding fragment thereof.

[0035] In another preferred embodiment, the EB is the scFv of the FMC63 antibody.

[0036] In another preferred example, the EB includes the heavy chain and light chain of the FMC63 antibody.

[0037] In another preferred embodiment, the H is a hinge region of a protein selected from the group consisting of CD8 (including CD8α), CD28, CD137, NKG2D, 2B4, DAP10, DAP12, or a combination thereof.

[0038] In another preferred embodiment, the H is the hinge region of the CD28 protein.

[0039] In another preferred embodiment, the TM is a transmembrane region of an immune cell surface molecule commonly used in the art, preferably a transmembrane region of a protein selected from the following group: CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, NKG2D, 2B4, DAP10, DAP12, or a combination thereof.

[0040] In another preferred embodiment, the TM is the transmembrane region of the CD28 protein.

[0041] In another preferred embodiment, C is a co-stimulatory signal molecule of a protein selected from the following group: OX40, CD2, CD7, CD27, CD28, CD30, CD40, CD70, CD134, 4-1BB (CD137), PD1, Dap10, CDS, ICAM-1, LFA-1 (CD11a / CD18), ICOS (CD278), NKG2D, GITR, TLR2, 2B4, DAP10, DAP12, or a combination thereof.

[0042] In another preferred embodiment, the C is a co-stimulatory signal molecule of CD28 protein.

[0043] In another preferred embodiment, the exogenous target gene further includes: a promoter, polyA, a selectable marker, or a combination thereof.

[0044] In another preferred embodiment, the selectable marker includes: a reporter gene, a resistance gene, or a combination thereof.

[0045] In another preferred example, the cDNA sequence of the TIM3 gene is shown in SEQ ID NO: 4.

[0046] In another preferred example, the TIM3 gene site is selected from the following group: TIM3 exon 1 site, TIM3 exon 2 site, TIM3 exon 3 site, TIM3 exon 4 site, TIM3 exon 5 site, TIM3 exon 6 site, TIM3 exon 7 site, or a combination thereof.

[0047] In another preferred embodiment, the TIM3 gene site is the TIM3 exon 1 site.

[0048] In another preferred example, the sequence of the TIM3 exon 1 is shown in SEQ ID NO: 5.

[0049] In another preferred example, the sequence of the CAR is shown in SEQ ID NO: 6.

[0050] In another preferred embodiment, the step (Z2) comprises:

[0051] (i) feeding CAR-iPSCs into a bioreactor for 3D culture to form spherical iPSC aggregates; and

[0052] (ii) By adding a specific cytokine combination, iPSCs are induced to undergo directed differentiation through the following cell fate conversion: from iPSCs to hematopoietic stem cells (HSCs), to lymphoid progenitor cells, and finally to iPSC-CAR-NK cells characterized by CD3-CD56+.

[0053] In another preferred embodiment, the step of converting iPSC to hematopoietic stem cells (HSC) comprises adding cytokines selected from the group consisting of SCF, VEGF, BMP4, or a combination thereof.

[0054] In another preferred embodiment, the step of converting lymphocyte progenitor cells into iPSC-CAR-NK cells comprises adding cytokines selected from the following group: IL3, IL7, IL15, SCF, FLT3L, or a combination thereof.

[0055] In another preferred embodiment, the method further comprises: a step of verifying or identifying the gene-edited iPSCs.

[0056] In another preferred example, the verification or identification includes but is not limited to: PCR verification, sequencing, functional identification, or a combination thereof.

[0057] In another preferred embodiment, the verification or identification includes: using upstream and downstream primers spanning homology arms for verification or identification.

[0058] In another preferred example, the upstream and downstream primers include the HA-L sequence shown in SEQ ID NO: 2 and the HA-R sequence shown in SEQ ID NO: 3.

[0059] In another preferred embodiment, the method further comprises: a step of amplifying iPSCs.

[0060] In another preferred embodiment, the method further comprises: a step of amplifying NK cells.

[0061] In another preferred embodiment, the NK cells include CD3-CD56+ NK cells.

[0062] In another preferred embodiment, the NK cells are CD3-CD56+ NK cells.

[0063] In another preferred embodiment, the NK cells are CAR-NK cells.

[0064] In another preferred embodiment, the function-enhanced NK cells have one or more characteristics selected from the following group (compared with unmodified NK cells, or compared with NK cells differentiated from unmodified iPSCs):

[0065] (a) Enhanced target cell killing ability;

[0066] (b) reduced NK cell apoptosis ratio;

[0067] (c) enhanced ability to survive the process of killing target cells;

[0068] (d) Improved depletion characteristics.

[0069] In another preferred embodiment, the killing ability includes specific killing ability.

[0070] In another preferred embodiment, the NK cell apoptosis is spontaneous apoptosis of NK cells.

[0071] In another preferred embodiment, the (d) improved depletion characteristics include:

[0072] (i) decreased expression of the inhibitory receptor NKG2A; and / or

[0073] (ii) Increased expression of the activating receptor Nkp46.

[0074] In another preferred embodiment, the target cell is a cancer cell or a tumor cell.

[0075] In another preferred embodiment, the cancer or tumor includes: a blood tumor, a solid tumor, or a combination thereof.

[0076] In another preferred embodiment, the cancer or tumor includes but is not limited to: leukemia, lymphoma, colorectal cancer, breast cancer, lung cancer, gastric cancer, liver cancer, multiple myeloma, kidney cancer, pancreatic cancer, melanoma, thyroid cancer, brain tumor, skin cancer, prostate cancer, ovarian cancer, cervical cancer, head and neck cancer, bladder cancer, neuroblastoma, rhabdomyosarcoma, or a combination thereof.

[0077] In another preferred embodiment, the cancer or tumor includes: chronic myeloid leukemia.

[0078] In the second aspect of the present invention, a NK cell prepared by the method according to the first aspect of the present invention is provided.

[0079] In another preferred embodiment, the NK cells include NK cells obtained by expansion.

[0080] In another preferred embodiment, the NK cells include CD3-CD56+ NK cells.

[0081] In another preferred embodiment, the NK cells are CD3-CD56+ NK cells.

[0082] In another preferred embodiment, the NK cells are CAR-NK cells.

[0083] In another preferred embodiment, the NK cells have one or more characteristics selected from the following group (compared with unmodified NK cells, or compared with NK cells differentiated from unmodified iPSCs):

[0084] (a) Enhanced target cell killing ability;

[0085] (b) reduced NK cell apoptosis ratio;

[0086] (c) enhanced ability to survive the process of killing target cells;

[0087] (d) Improved depletion characteristics.

[0088] In another preferred embodiment, the killing ability includes specific killing ability.

[0089] In another preferred embodiment, the NK cell apoptosis is spontaneous apoptosis of NK cells.

[0090] In another preferred embodiment, the (d) improved depletion characteristics include:

[0091] (i) decreased expression of the inhibitory receptor NKG2A; and / or

[0092] (ii) Increased expression of the activating receptor Nkp46.

[0093] In a third aspect of the present invention, a gene editing method for stem cells is provided, the method comprising the steps of: knocking in an exogenous target gene at the TIM3 gene site of the stem cell genome using gene editing technology, and / or knocking out the TIM3 gene or a TIM3 gene fragment in the stem cell genome using gene editing technology.

[0094] In another preferred embodiment, the method is an in vitro method.

[0095] In another preferred embodiment, the method is for non-disease treatment purposes or non-disease diagnosis purposes.

[0096] In another preferred embodiment, the stem cells are selected from the group consisting of induced pluripotent stem cells (iPSC), embryonic stem cells (ESC), hematopoietic stem cells (HSC), mesenchymal stem cells, or a combination thereof; preferably, the stem cells are selected from the group consisting of induced pluripotent stem cells (iPSC), embryonic stem cells (ESC), hematopoietic stem cells (HSC), or a combination thereof; more preferably, the stem cells are induced pluripotent stem cells (iPSC).

[0097] In another preferred embodiment, the method comprises: using gene editing technology to knock in an exogenous target gene at the TIM3 gene site of the stem cell genome, and knocking out the TIM3 gene at the same time.

[0098] In another preferred embodiment, the gene editing technology is CRISPR / Cas9, TALEN.

[0099] In another preferred embodiment, the gene editing technology uses sgRNA, and the transcription template sequence of the sgRNA is shown in SEQ ID NO: 1.

[0100] In another preferred embodiment, the iPSCs are derived from cells selected from the group consisting of differentiated cells of human origin such as human fibroblasts, human peripheral blood mononuclear cells, human hematopoietic stem cells, or a combination thereof.

[0101] In another preferred embodiment, the exogenous target gene includes: a therapeutic gene, a reporter gene, a suicide gene, an immunomodulatory gene, or a combination thereof.

[0102] In another preferred embodiment, the exogenous target gene includes a chimeric antigen receptor (CAR) gene.

[0103] In another preferred embodiment, the CAR targets tumor surface antigens.

[0104] In another preferred embodiment, the tumor surface antigens include but are not limited to: CD19, CD20, PD-1, PD-L1, Claudin 18.2, BCMA, CD22, CD24, CD25, CD30, CD33, CD38, CD44, CD52, CD56, CD70, CD96, CD97, CD99, CD123, EGFR, HER2, HER3, CD117, C-Met, EGFR, EGFRvIII, ERBB3, ERBB4, VEGFR1, VEGFR2, ROR1, PTHR2, B7-H1 (PD-L1), B7-H2, B7-H3, B7-H4, B7-H5, B7-H6, B7-H7, Trop-2, GPC-3, EPCAM, DLL-3, Nectin-4, Claudin6, Muc-1, PSMA, GD3, FAP, CEA, EphA2, CTLA-4, LAG-3, TIGIT, MSLN, or a combination thereof.

[0105] In another preferred embodiment, the tumor surface antigen is CD19.

[0106] In another preferred embodiment, the exogenous target gene includes a chimeric antigen receptor (CAR) gene targeting CD19.

[0107] In another preferred embodiment, the CAR has a structure as shown in the following formula I:

[0108] L-EB-H-TM-C-CD3ζ (I)

[0109] In the formula,

[0110] Each "-" is independently a connecting peptide or a peptide bond;

[0111] L is none or an optional signal peptide sequence;

[0112] EB is the extracellular binding domain that targets tumor surface antigens;

[0113] H is an optional hinge region;

[0114] TM is the transmembrane domain;

[0115] C is a co-stimulatory signal molecule;

[0116] CD3ζ is a cytoplasmic signaling sequence derived from CD3ζ.

[0117] In another preferred embodiment, L is a signal peptide of an immune cell surface molecule commonly used in the art, preferably a signal peptide of a protein selected from the following group: CD8, CD28, GM-CSF, CD4, CD137, NKG2D, or a combination thereof.

[0118] In another preferred embodiment, the EB is an anti-CD19 antibody or an antigen-binding fragment thereof.

[0119] In another preferred embodiment, the EB is the scFv of the FMC63 antibody.

[0120] In another preferred example, the EB includes the heavy chain and light chain of the FMC63 antibody.

[0121] In another preferred embodiment, the H is a hinge region of a protein selected from the group consisting of CD8 (including CD8α), CD28, CD137, NKG2D, 2B4, DAP10, DAP12, or a combination thereof.

[0122] In another preferred embodiment, the H is the hinge region of the CD28 protein.

[0123] In another preferred embodiment, the TM is a transmembrane region of an immune cell surface molecule commonly used in the art, preferably a transmembrane region of a protein selected from the following group: CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, NKG2D, 2B4, DAP10, DAP12, or a combination thereof.

[0124] In another preferred embodiment, C is a co-stimulatory signal molecule of a protein selected from the following group: OX40, CD2, CD7, CD27, CD28, CD30, CD40, CD70, CD134, 4-1BB (CD137), PD1, Dap10, CDS, ICAM-1, LFA-1 (CD11a / CD18), ICOS (CD278), NKG2D, GITR, TLR2, 2B4, DAP10, DAP12, or a combination thereof.

[0125] In another preferred embodiment, the C is a co-stimulatory signal molecule of CD28 protein.

[0126] In another preferred embodiment, the exogenous target gene further includes: a promoter, polyA, a selectable marker, or a combination thereof.

[0127] In another preferred embodiment, the selectable marker includes: a reporter gene, a resistance gene, or a combination thereof.

[0128] In another preferred example, the cDNA sequence of the TIM3 gene is shown in SEQ ID NO: 4.

[0129] In another preferred example, the TIM3 gene site is selected from the following group: TIM3 exon 1 site, TIM3 exon 2 site, TIM3 exon 3 site, TIM3 exon 4 site, TIM3 exon 5 site, TIM3 exon 6 site, TIM3 exon 7 site, or a combination thereof.

[0130] In another preferred embodiment, the TIM3 gene site is the TIM3 exon 1 site.

[0131] In another preferred example, the sequence of the TIM3 exon 1 is shown in SEQ ID NO: 5.

[0132] In another preferred example, the sequence of the CAR is shown in SEQ ID NO: 6.

[0133] In another preferred embodiment, the method further comprises: a step of verifying or identifying the gene-edited iPSCs.

[0134] In another preferred example, the verification or identification includes but is not limited to: PCR verification, sequencing, functional identification, or a combination thereof.

[0135] In another preferred embodiment, the verification or identification includes: using upstream and downstream primers spanning homology arms for verification or identification.

[0136] In another preferred example, the upstream and downstream primers include the HA-L sequence shown in SEQ ID NO: 2 and the HA-R sequence shown in SEQ ID NO: 3.

[0137] In another preferred embodiment, the method further comprises: a step of amplifying iPSCs.

[0138] In a fourth aspect of the present invention, a stem cell prepared by the method according to the third aspect of the present invention is provided.

[0139] In another preferred embodiment, the stem cells are selected from the group consisting of induced pluripotent stem cells (iPSC), embryonic stem cells (ESC), hematopoietic stem cells (HSC), mesenchymal stem cells, or a combination thereof; preferably, the stem cells are selected from the group consisting of induced pluripotent stem cells (iPSC), embryonic stem cells (ESC), hematopoietic stem cells (HSC), or a combination thereof; more preferably, the stem cells are induced pluripotent stem cells (iPSC).

[0140] In another preferred embodiment, the iPSCs include iPSCs obtained by expansion.

[0141] In another preferred embodiment, the stem cells are of non-animal and non-plant strains.

[0142] In the fifth aspect of the present invention, a pharmaceutical composition is provided, comprising: the NK cells as described in the second aspect of the present invention, and a pharmaceutically acceptable carrier.

[0143] In another preferred embodiment, the pharmaceutical composition is a preparation.

[0144] In another preferred embodiment, the pharmaceutical composition also includes other drugs for treating or preventing tumors.

[0145] In another preferred embodiment, the other drugs for treating tumors include: antibodies or antibody fragments that specifically recognize tumor antigens, drugs that specifically recognize viral target proteins, or a combination thereof.

[0146] In the sixth aspect of the present invention, a preparation is provided, comprising: the stem cells as described in the fourth aspect of the present invention, and a pharmaceutically acceptable excipient.

[0147] In another preferred embodiment, the stem cells are selected from the group consisting of induced pluripotent stem cells (iPSC), embryonic stem cells (ESC), hematopoietic stem cells (HSC), mesenchymal stem cells, or a combination thereof; preferably, the stem cells are selected from the group consisting of induced pluripotent stem cells (iPSC), embryonic stem cells (ESC), hematopoietic stem cells (HSC), or a combination thereof; more preferably, the stem cells are induced pluripotent stem cells (iPSC).

[0148] In the seventh aspect of the present invention, there is provided a use of the NK cells as described in the second aspect of the present invention, the stem cells as described in the fourth aspect of the present invention, the pharmaceutical composition as described in the fifth aspect of the present invention, or the preparation as described in the sixth aspect of the present invention for preparing a drug for immunotherapy.

[0149] In another preferred embodiment, the drug is administered to patients with cancer or tumors.

[0150] In another preferred embodiment, the cancer or tumor includes: a blood tumor, a solid tumor, or a combination thereof.

[0151] In another preferred embodiment, the cancer or tumor includes but is not limited to: leukemia, lymphoma, colorectal cancer, breast cancer, lung cancer, gastric cancer, liver cancer, multiple myeloma, kidney cancer, pancreatic cancer, melanoma, thyroid cancer, brain tumor, skin cancer, prostate cancer, ovarian cancer, cervical cancer, head and neck cancer, bladder cancer, neuroblastoma, rhabdomyosarcoma, or a combination thereof.

[0152] In another preferred embodiment, the cancer or tumor includes: chronic myeloid leukemia.

[0153] In the eighth aspect of the present invention, there is provided a use of the stem cells as described in the fourth aspect of the present invention, or the preparation as described in the sixth aspect of the present invention, for preparing NK cells.

[0154] In another preferred embodiment, the NK cells are the NK cells described in the second aspect of the present invention.

[0155] In the ninth aspect of the present invention, a treatment method is provided, comprising the steps of administering the NK cells as described in the second aspect of the present invention, or the pharmaceutical composition as described in the fifth aspect of the present invention to a subject in need thereof.

[0156] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0157] Figure 1 Exemplary sgRNA, KI / KO sites, and PAM sequences (AGG) in the target sequence are shown, and the arrows indicate the editing sites.

[0158] Figure 2 The results show that the CRISPR / Cas9 method can be used to precisely insert and edit the sgRNA target site and knock out TIM3.

[0159] Figure 3 The design of the genotyping PCR is shown.

[0160] Figure 4 The experimental results of genotyping PCR are shown, where the WT band is 1.8 kb and the KI band is 4.8 kb.

[0161] Figure 5 Sanger sequencing validation results are shown.

[0162] Figure 6 The results of stemness marker detection of homozygous representative single clones are shown.

[0163] Figure 7 The process of gene editing of iPSCs and screening of correctly edited single clones is shown, as well as the subsequent process of directing and inducing differentiation of iPSCs under closed 3D culture conditions in a bioreactor to obtain iPSC-CAR-NK.

[0164] Figure 8The differentiation and expansion data of iNK cells obtained by directed induction differentiation of differently edited iPSC cells are shown, characterized by CD3-CD56+ marker, where WT ctrl is wild type control, representing the cell line obtained by differentiation and expansion without gene editing of iPSC; AAVS1_19CAR represents the cell line obtained by differentiation and expansion after editing anti-CD19 CAR at the AAVS1 safe site; TIM3_19CAR represents the cell line obtained by differentiation and expansion after editing anti-CD19 CAR at the TIM3 site. The X-axis represents the days of differentiation and expansion, D28 refers to the 28th day of differentiation; E5-12 refers to the days of expansion after differentiation D28.

[0165] Fig. 9 The expression of anti-CD19 CAR in differentiated iNKs is shown.

[0166] Fig.10 The expression of TIM3 in differentiated iNKs is shown.

[0167] Fig.11 The figure shows the Tumor index of different NK cells after killing target cells.

[0168] Fig.12 The iNK index indications after different NK cells killed target cells were shown.

[0169] Fig.13 The figure shows the Tumor index indications of different NK cells after specific killing mediated by CAR molecules.

[0170] Fig.14 The iNK index indications of different NK cells after specific killing mediated by CAR molecules are shown.

[0171] Fig.15 The results of the spontaneous apoptosis ratio of iNK cells are shown.

[0172] Fig.16 The expression results of exhaustion marker-NKG2A and activation marker-Nkp46 in different cell lines are shown. DETAILED DESCRIPTION

[0173] After extensive and in-depth research and a large number of screenings, the inventors creatively discovered for the first time that compared with the prior art of gene editing at a safe site (such as the AAVS1 site), the present invention knocks in an exogenous target gene (such as a CAR gene) and / or knocks out a TIM3 gene or its fragment at the TIM3 site of stem cells, which can effectively promote the differentiation of stem cells into NK cells or T cells without affecting the amplification capacity of NK cells or T cells, and can obtain functionally enhanced NK cells or T cells, which have better survival ability and killing effect in the process of tumor cell killing. On this basis, the present invention was completed.

[0174] In order that the present disclosure may be more readily understood, certain terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms shall have the meaning given below.

[0175] The term "about" can refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined.

[0176] The term "administering" refers to the physical introduction of the product of the invention into a subject using any of a variety of methods and delivery systems known to those skilled in the art, including intravenous, intratumoral, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, such as by injection or infusion.

[0177] T cell immunoglobulin and mucin domain-containing protein 3 (TIM3) was first discovered in 2002 and is an immunomodulatory protein in the TIM family. TIM family members are encoded by three genes in humans (HAVCR1, HAVCR2, and TIMD4, encoding TIM1, TIM3, and TIM4, respectively). Among the TIM family, TIM3 has received the most attention because it is associated with the regulation of immune responses in autoimmunity and cancer. Initial studies believed that it was mainly a molecule expressed by CD4+ and CD8+ T cells that produce interferon gamma (IFNγ), but later studies have shown that many other types of T cells (Treg cells), myeloid cells, natural killer cells (NK cells), macrophages, and mast cells can express TIM3.

[0178] TIM3 is highly expressed in mature CD56(dim)CD16(+) NK cells and heterogeneously expressed in CD56(bright)CD16(-) NK cells. Studies have found that TIM3 expression is induced on CD56(bright)CD16(-) NK cells after stimulation with cytokines such as IL-15, IL-12, and IL-18, indicating that TIM3 may be a marker of NK cell maturation. High expression of TIM3 is also a marker of effector NK cells, indicating that these cells are producing IFNγ and undergoing degranulation.

[0179] Overexpression of TIM3 on macrophages appears to attenuate the massive inflammatory response to dextran sulfate sodium, thereby preventing adverse tissue disease. Consistent with this, TIM3 expression is upregulated in peripheral blood mononuclear cells from patients with acute sepsis, but is repressed in patients with severe sepsis. TIM3 is also highly expressed on human peripheral blood mononuclear cells during pregnancy, where it appears to attenuate the response to TLR4 stimulation.

[0180] On mast cells, TIM3 is thought to have an activation function. TIM3 antibodies enhance the secretion of IL-3, IL-4, IL-6, and IL-13 in mast cells after IgE sensitization and antigen-dependent activation in vitro. In addition, in vitro experiments showed that genetic deletion or siRNA knockdown of TIM3 significantly reduced the production of IL-6 after mast cell activation, and genetic deletion of TIM3 abolished antigen-mediated glycolysis, an effect mediated by the FcεRII receptor.

[0181] Therefore, TIM3 plays different functions in different cells, and further studies are needed to decipher the role and impact of TIM3 signaling in various cells.

[0182] In the present invention, it is creatively discovered that knocking in an exogenous target gene (such as a CAR gene) and / or knocking out the TIM3 gene or a fragment thereof at the TIM3 site of stem cells can effectively promote the differentiation of stem cells into NK cells or T cells without affecting the expansion capacity of NK or T cells, and can obtain functionally enhanced NK cells or T cells, which have better survival ability and killing effect in the process of tumor cell killing.

[0183] Stem cells, whether embryonic stem cells or hematopoietic stem cells, have strong proliferation capabilities, are more easily infected or transfected than primary cells, and have the ability to differentiate into other somatic cells. They are excellent tools and research directions for gene editing and subsequent cell functional research. Before the invention of iPSCs, researchers had already conducted gene editing and cell differentiation studies on embryonic stem cells (ESCs) and / or hematopoietic stem cells (HSCs). For example, Luevano M, Madrigal A, Saudemont A. Generation of natural killer cells from hematopoietic stem cells in vitro for immunotherapy. Cell Mol Immunol. 2012 Jul;9(4):310-20. doi: 10.1038 / cmi.2012.17. discussed the process of generating NK cells from hematopoietic stem cells in vitro for immunotherapy; La Motte-Mohs RN, Herer E, Zúñiga-Pflücker JC. Induction of T-cell development from human cord blood hematopoietic stem cells by Delta-like 1 in vitro. Blood. 2005 Feb 15;105(4):1431-9. doi: 10.1182 / blood-2004-04-1293. The ability and process of inducing human umbilical cord blood hematopoietic stem cells (HSCs) to differentiate into T cells in vitro were discussed; Woll PS, Grzywacz B, Tian X, Marcus RK, Knorr DA, Verneris MR, Kaufman DS. Human embryonic stem cells differentiate into a homogeneous population of natural killer cells with potent in vivo antitumor activity. Blood. 2009 Jun11;113(24):6094-101. doi: 10.1182 / blood-2008-06-165225. The routine differentiation of CD56+CD45+ NK cells from human embryonic stem cells (hESCs) was discussed; Giudice A, Trounson A.Genetic modification of human embryonic stem cells for derivation of target cells.Cell Stem Cell. 2008 May 8;2(5):422-33. doi: 10.1016 / j.stem.2008.04.003.Discusses genetic modification techniques (such as ZFN technology) for human embryonic stem cells (hESCs) and how these techniques can be used to generate specific cell types. It also discusses how inactivating endogenous genes or inserting reporter genes in hESCs by knockout or knockin technology enables researchers to study human development and diseases based on human cell systems different from mice. In addition, it discusses how patient-specific human induced pluripotent stem cells (iPSCs) derived from somatic cell reprogramming can not only be used to model diseases caused by inherited or acquired gene mutations, but also show potential for stem cell-based gene therapy in regenerative medicine.

[0184] The technical path of obtaining HSC by differentiation from ESC, and then differentiating and amplifying NK cells or T cells from HSC is relatively mature. Such corresponding NK cells or T cells have been shown to have the phenotype and function of mature NK cells or mature T cells in human peripheral blood in a variety of in vivo and in vitro experiments. Therefore, the aforementioned method of editing the TIM3 gene to obtain functionally enhanced NK cells or T cells is also applicable to the technical solution of gene editing of ESC or HSC, and then differentiating to obtain NK cells or T cells.

[0185] It should be understood that, for the method according to the first aspect of the present invention, when NK cells are replaced by T cells, the method is also applicable, that is, the present invention also provides a method for gene editing of stem cells to differentiate and obtain functionally enhanced T cells, the method comprising the steps of:

[0186] (Z1) knocking in an exogenous target gene at the TIM3 gene locus in the stem cell genome using gene editing technology, and / or knocking out the TIM3 gene or a TIM3 gene fragment in the stem cell genome using gene editing technology; and

[0187] (Z2) Induce gene-edited stem cells to differentiate into T cells, thereby obtaining T cells with enhanced functions.

[0188] Similarly, the present invention also provides T cells prepared by the above method. A pharmaceutical composition is also provided, comprising: the aforementioned T cells, and a pharmaceutically acceptable carrier. A use of the aforementioned T cells or the aforementioned pharmaceutical composition is also provided for preparing a drug for immunotherapy. A use of the stem cells as described in the fourth aspect of the present invention, or the preparation as described in the sixth aspect of the present invention, is also provided for preparing T cells. A treatment method is also provided, comprising the steps of administering the aforementioned T cells, or the aforementioned pharmaceutical composition, to a subject in need thereof.

[0189] Main advantages of the present invention

[0190] Currently, in the field of directed differentiation of stem cells (such as iPSC cells) into functional immune cells, the available gene sites that have been actually verified and tested are very limited, which limits the space for improving cell function through gene editing. Most of the existing gene editing strategies are carried out at safe sites such as AAVS1 (human) and Rosa26 (mouse), and cannot obtain benefits other than the inserted and expressed gene elements. The present invention performs gene editing on stem cells (such as iPSC cells) and inserts CAR molecules into the TIM3 gene locus of NK / T cells, so that the iPSC-CAR-NK / T obtained from its differentiation and amplification obtains specific targeted killing ability, and at the same time knocks out the expression of endogenous TIM3, achieving the effect of "killing two birds with one stone". A series of experiments have verified that such a KI / KO strategy does increase the killing and survival ability of TIM3 CAR iNK cells, optimizes the expression spectrum of inhibitory receptors / activating receptors, without affecting the inherent characteristics of NK / T cells; it still has good innate immune killing ability (innate killing), improves the efficiency of iPSC differentiation into NK / T cells, and does not affect the expansion ability of NK / T cells. It provides a proven solid foundation for gene editing iPSC and differentiation to obtain functionally enhanced NK / T and other immune cell products.

[0191] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed under conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0192] Sequence information

[0193] DNA sequence of the transcription template of sgRNA (SEQ ID NO: 1)

[0194] CAGCAGCAGGACACAGTCAA

[0195] HA-L sequence (SEQ ID NO: 2)

[0196] AaaggaactgttgccaaaaggaacatgttttttctaaattgaagagttggaagtttgaaggtcaaagtcagaatattagaacagagagccatgcatgtattatctaatacaattttctcattttataaattatataaatgaggaaactgagactcagcaaggttataggatacaacctaatctgtgttagaagaaggatgagagtgaggcttatgctgggagttgcgatggtctgtaaatgtgaggataaggaacatgccattcactgttgtgttccacttcctagtccagtgcctggtgcaaagtaggggcttcataaactttggtcacaggcctgatgaagggactgatttgagtgaatgaatccatggatgatgcatctgtactttgtgttccccgctagtcagatggactcggacatgctccatttcaggtgtatctcatctgagacattattagagggttctctttatgtgccatgactgagtagcgttttcttccactgaagtattgcttcctctttgttgatatcacaggacagacatcagaacacttacaggatgtgtgtagtgtggcatgacagagaactttggtttcctttaatgtgactgtagacctggcagtgttactataagaatcactggcaatcagacacccgggtgtgctgagctagcactcagtgggggcggctactgctcatgtgattgtggagtagacagttggaagaagtacccagtccATTTGGAGAGTTAAAACTGTGCCTAACAGAGGTGTCCTCTGACTTTTCTTCTGCAAGCTCC

[0197] HA-R sequence (SEQ ID NO: 3)

[0198] ACTGTGTCCTGCTGCTGCTGCTGCTACTACTTACAAgtaagtctcggcatggatatttacaatgacataatggtgctgtacagaggacaagggagagatacaaggatggccattgtaatgttgtttgtaatagcaaaagcttggaagcaacctaaatgtccgtcgatgagggagtgggtaaataaatgtgatataatcatgatacaaacagtgagtctgacaaaacatactggtatagaatgtctcaaaattataatgttattaaagaaaaaaagttgcagaataatgcatatattaggcttctatttgtgtgtgtgcattgtcggggagcaggaatatgtggacatttcttaatgtataagctctaggaaaaggaaccagggaatggtaaagagttgggagagtaaggcatatttttcttttcttttctttcctttttttctttttcttttctttctttttctttttttcaattgagatggagtctcactctattgcccaggctggagtgcagtggtggcaccattttggctcactgcaatctccgcctcccaggttcaagtgattctcctgccttaggcaccggagtagctgggatcacaggcgtgcaccaccacacccagctaatgtttttaatttttagtagagacagggttttaccatgttggtcaggctggtctcaaactcatggcctcaagtaatctgcccatctcagcctcccaaagtgctgggattacaggcgtgacccaccgtgtgcccggccactttttcatacacctttgatagtgtttgaatgtttt

[0199] TIM3 cDNA sequence (SEQ ID NO: 4)

[0200] Atgttttcacatcttccctttgactgtgtcctgctgctgctgctgctactacttacaaggtcctcagaagtggaatacagagcggaggtcggtcagaatgcctatctgccctgcttctacaccccagccgccccagggaacctcgtgcccgtctgctggggcaaaggagcctgtcctgtgtttgaatgtggcaacgtggtgctcaggactgatgaaagggatgtgaattattggacatccagatactggctaaatggggatttccgcaaaggagatgtgtccctgaccatagagaatgtgactctagcagacagtgggatctactgctgccggatccaaatcccaggcataatgaatgatgaaaaatttaacctgaagttggtcatcaaaccagccaaggtcacccctgcaccgactcggcagagagacttcactgcagcctttccaaggatgcttaccaccaggggacatggcccagcagagacacagacactggggagcctccctgatataaatctaacacaaatatccacattggccaatgagttacgggactctagattggccaatgacttacgggactctggagcaaccatcagaataggcatctacatcggagcagggatctgtgctgggctggctctggctcttatcttcggcgctttaattttcaaatggtattctcatagcaaagagaagatacagaatttaagcctcatctctttggccaacctccctccctcaggattggcaaatgcagtagcagagggaattcgctcagaagaaaacatctataccattgaagagaacgtatatgaagtggaggagcccaatgagtattattgctatgtcagcagcaggcagcaaccctcacaacctttgggttgtcgctttgcaatgccatag

[0201] TIM3 CDS exon1 sequence (SEQ ID NO: 5)

[0202] ATGTTTTCACATCTTCCCTTTGACTGTGTCCTGCTGCTGCTGCTGCTACTACTTACAA

[0203] Anti-C19 CAR sequence (SEQ ID NO: 6)

[0204]

[0205] TIM3_CDS_Exon 1 fragment (SEQ ID NO: 7)

[0206] CATGTTTTCACATCTTCCCTTTGACTGTGTCCTGCTGCTGCTGCTGCTACTACTTACAAg

[0207] TIM3_CDS_Exon 1 fragment (SEQ ID NO: 8)

[0208] cTTGTAAGTAGTAGCAGCAGCAGCAGCAGGACACAGTCAAAGGGAAGATGTGAAAACATG

[0209] TIM3 locus fragment (SEQ ID NO: 9)

[0210] Gacttttcttctgcaagctccatgttttcacatcttccctttgactgtgtcctgctgctgctgctgctactacttacaagtaagtctcggc

[0211] Sanger sequencing fragment (SEQ ID NO: 10)

[0212] GacttttcttctgcaagctccAgtaattcatacaaaaggactcgcccctgccttggggaatcccaggga

[0213] Sanger sequencing fragment (SEQ ID NO: 11)

[0214] ggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggactgtgtcctgctgctgctgctgctactacttacaagtaagtctcg

[0215] Example 1: Design and synthesis of sgRNA targeting the TIM3 site

[0216] sgRNA design: Design through multiple sgRNA design websites and select the best candidates.

[0217] sgRNA synthesis: It is a complete chemical synthesis of the full-length sgRNA, adding thio and 2'-O-methyl modifications to the first three bases at the 3' and 5' ends of the sgRNA sequence. The advantages of chemically synthesized full-length sgRNA are: no traditional annealing operation is required to allow crRNA and tracrRNA to bind; it binds more firmly to the Cas9 protein and the RNP is more stable; the editing efficiency is higher, which improves the experimental efficiency and success rate, and is particularly suitable for the editing of primary cells and stem cells.

[0218] After a large number of screening and verification, the sgRNA (artificially synthesized) designed by the inventors for the TIM3 site (such as TIM3 CDS exon1) can effectively target the TIM3 site. The transcription template DNA sequence of the exemplary sgRNA is: CAGCAGCAGGACACAGTCAA (SEQ ID NO: 1).

[0219] like Figure 1 As shown, exemplary sgRNAs, KI / KO sites, and PAM sequences (AGG) in the target sequences are shown.

[0220] Example 2: Gene Editing iPSCs and Verification

[0221] like Figure 2 As shown, the inventors used the CRISPR / Cas9 method to precisely insert and edit the sgRNA target site in the iPSC cell genome and knock out the TIM3 gene editing strategy.

[0222] The specific process is as follows: Gene editing and transformation of iPSCs are performed using a gene editing template vector + Cas9 / sgRNA complex (RNP) encoding CAR molecules; then the edited iPSCs are inoculated as single cells, and after the single cells grow into single clones, the single clones are digested from the 96-well plate to 24 or 12-well plates, and a small amount of cells are directly lysed for genome identification. The monoclonal clones with the expected element insertion can be identified using the designed upstream and downstream primers across the homology arms. After the correct monoclonal clones are amplified, the genomic DNA is extracted for PCR of the elements at the insertion site and the PCR products are sequenced by Sanger to verify the integrity of the inserted element sequence. At the same time, the monoclonal clones with correct genome identification and Sanger sequencing are subjected to flow cytometry detection of pluripotency marker proteins. Through these methods, the correctly edited CAR-iPSCs (i.e., TIM3 KO / CARKI) are screened.

[0223] In this example, genotyping PCR, Sanger sequencing, and stemness marker detection were used to verify the edited iPSCs.

[0224] like Figure 3 As shown, the design of the genotyping PCR is shown. Figure 4 As shown, the experimental results of genotyping PCR are shown, where the WT band is 1.8 kb and the KI band is 4.8 kb. The monoclonal clones with only the KI band are homozygous, the monoclonal clones with only the WT band are without KI, and the monoclonal clones with both bands are heterozygous. The results show that the insertion efficiency of gene editing at the TIM3 site is high, and more heterozygous and homozygous monoclonal clones can be produced.

[0225] like Figure 5 Figure 1 shows the results of Sanger sequencing verification, which indicated that the genome sequence of the single clone at the editing site was identical to the theoretical editing sequence and that the editing was correct.

[0226] like Figure 6 Figure 2 shows the results of stemness marker detection of homozygous representative single clones. The results show that KO or KI of the TIM3 gene locus does not affect the stemness of iPSCs.

[0227] Example 3: Induced differentiation of iPSCs after gene editing and characterization of the obtained iNK cells

[0228] like Figure 7 As shown, the process of gene editing of iPSCs and screening of correctly edited single clones is simply summarized; as well as the subsequent process of directing and inducing differentiation of iPSCs under closed 3D culture conditions in a bioreactor to obtain iPSC-CAR-NK.

[0229] Specifically, CAR-iPSCs are fed into a bioreactor for 3D culture to form spherical iPSC clumps. By adding a specific cytokine composition, iPSCs are induced to undergo directed differentiation through the following cell fate conversion: from iPSC to HSC (hematopoietic stem cell), then to lymphoid progenitor cells, and finally to obtain iPSC-CAR-NK cells characterized by CD3-CD56+.

[0230] In short, cytokines SCF, VEGF, and BMP4 are added to the basal culture medium to induce the differentiation of iPSC cells into hematopoietic stem cells and complete the differentiation of lymphoid progenitor cells. Then, a combination of cytokines IL3, IL7, IL15, SCF, and FLT3L is used to differentiate NK cells. The basal culture medium formula refers to the ingredients in Dan S. Kaufman's differentiation process (Hematopoietic and Nature Killer Cell Development from Human Pluripotent Stem Cells, 2013). The differentiation process lasts for 28 days, and then iNK is amplified using an expansion medium, which is the OptiVitroNK Cell Amplification Basic Kit NE01. According to the experimental requirements, iNK that has been amplified for an appropriate number of days is taken for functional experiments.

[0231] 1. In this example, the cell line obtained by differentiation and amplification without modification (i.e., no gene editing of iPSC) (referred to as WT ctrl), the cell line obtained by differentiation and amplification after gene editing at the safe site AAVS1 of iPSC (referred to as AAVS1_19CAR), and the cell line obtained by differentiation and amplification after gene editing (TIM3 site) in Example 2 (referred to as TIM3_19CAR) were characterized by CD3-CD56+ marker. Among them, AAVS1_19CAR and TIM3_19CAR used the same CAR molecule gene to be inserted into different sites of the iPSC genome using CRISPR / Cas9.

[0232] like Figure 8 As shown, the CD3-CD56+ marker characterization results of different cell lines are shown. The results showed that the CD3-CD56+% of TIM3_19CAR at the differentiation endpoint D28 was significantly higher than that of WT ctrl and AAVS1_19CAR. Since CD3-CD56+ is an iNK marker, the above results show that the insertion of the TIM3 site can more effectively promote the differentiation level of iPSC to iNK cells than the insertion of the safe site AAVS1 and WT, and the final expansion level of NK cells is not affected by knocking out the endogenous TIM3.

[0233] 2. In this example, the expression of exogenously inserted anti-CD19 CAR in differentiated iNK cells was also verified.

[0234] like Fig. 9As shown, the expression of anti-CD19 CAR in differentiated iNK cells is shown. The results show that compared with the traditional safety site AAVS1, the expression level of CAR molecules inserted into the TIM3 site is comparable, and the expression of CAR molecules is not affected by knocking out endogenous TIM3.

[0235] 3. In this example, the expression of TIM3 in iNK cells after differentiation was also verified (verification of KO effect).

[0236] like Fig.10 As shown, the expression of TIM3 in differentiated iNKs was shown. The results showed that KO of the TIM3 site significantly inhibited the expression of TIM3 in differentiated iNKs.

[0237] The above results show that KI anti-CD19 CAR on the TIM3 gene will not affect the directional differentiation of iPSC into NK cells. Compared with KI at the safe site AAVS1, editing of the TIM3 site unexpectedly has the effect of promoting differentiation. The NK cells obtained after editing at the TIM3 site can express a typical NK cell-specific molecular marker spectrum, and the iNK yield obtained by differentiation and expansion is comparable to that of the control group, indicating that such editing will not affect the subsequent expansion of NK cells while promoting the differentiation of iPSC into NK cells.

[0238] Example 4: Functional verification of iNK cells

[0239] 1. In this example, iNK cells (iNK cells in WT ctrl, AAVS1_19CAR, and TIM3_19CAR in Example 3) and target cells (cancer cells) were co-cultured at an effector-target ratio of 3:1, and 2E4 target cells were added to the co-culture system every 24 hours. The surviving iNK and target cells were detected by flow cytometry every 24 hours to evaluate the survival ability of iNK in killing and its ability to kill target cells.

[0240] Table 1 Tumor index indication data

[0241]

[0242] like Fig.11 As shown in Table 1, the Tumor index of different NK cells killing target cells is shown (where D0 is normalized to 1). The Tumor index indicates the number of target cells remaining after killing. The fewer the remaining, the stronger the killing ability. The results show that under the same conditions, the iNK innate killing ability is stronger after TIM3 site editing.

[0243] Table 2 iNK index indication data

[0244]

[0245] like Fig.12 As shown in Table 2, the iNK index indicators after different NK cells kill target cells are shown. The iNK index is the number of iNKs remaining after a killing experiment. The higher the index, the more iNKs survived. The results showed that when K562 (K562 is a cell line that characterizes the broad-spectrum killing of NK cells, and its killing effect does not depend on tumor surface antigens) was added for innate killing test, the ability of iNK to survive after TIM3 site editing was stronger under the same conditions.

[0246] 2. In this example, a comparison of specific killing mediated by CAR molecules with CD19 antigen-positive Nalm6 as target cells was also performed.

[0247] Table 3 Tumor index data of specific killing

[0248]

[0249] like Fig.13 As shown in Table 3, the Tumorindex indications of different NK cells based on CAR molecule-mediated specific killing are shown. Tumor index indicates the number of target cells remaining after killing. The fewer the remaining, the stronger the killing ability. The results showed that compared with inserting into the AAVS1 site, editing and inserting the anti-CD19-CAR molecule into the TIM3 site in multiple rounds of killing experiments can also enhance CAR molecule-mediated specific killing.

[0250] Table 4 iNK index indicator data of specific killing

[0251]

[0252] like Fig.14 As shown in Table 4, the iNKindex indicators of different NK cells based on CAR-mediated specific killing (where D0 is normalized to 1) are shown. The iNK index is the number of iNKs remaining after a killing experiment. The higher the index, the more iNKs survived. The results showed that compared with inserting into the AAVS1 site, editing the anti-CD19-CAR molecule into the TIM3 site in multiple rounds of killing experiments can also enhance the survival of iNKs.

[0253] 3. In this example, an iNK survival experiment was also conducted (the culture system was RPMI 1640+10% FBS+IL2), and the proportion of spontaneous apoptosis of iNK cells was detected during the experiment. Correspondingly, the expression of NK cell exhaustion marker-NKG2A and activation marker-Nkp46 in different edited iNKs was detected at the amplification end point.

[0254] like Fig.15 As shown, in a simple culture system with only IL2, the survival of iNK cells edited with TIM3 against CD19 CAR was stronger than that of iNK cells edited with AAVS1 against CD19 CAR at the safe site, and the proportion of spontaneous apoptosis edited with TIM3 was significantly lower.

[0255] like Fig.16 As shown, the expression of depletion marker-NKG2A in iNK cells obtained by editing at the TIM3 site was significantly lower than that in WT ctrl and iNK cells obtained by editing at the AAVS1 site, while the expression of activation marker-Nkp46 was significantly higher than that in WT ctrl and iNK cells obtained by editing at the AAVS1 site.

[0256] This result also confirms that conventional gene editing strategies (such as editing at the safe site AAVS1) will have an adverse effect on the function of the obtained NK cells. For example, editing of the AAVS1 site makes the spontaneous apoptosis rate of NK cells higher, more prone to NK cell exhaustion (its exhaustion marker expression is higher, even significantly higher than WT ctrl), and less likely to cause NK cell activation (its activation marker expression is very low, even significantly lower than WT ctrl). The editing of the TIM3 site in the present invention avoids the above adverse effects and even produces better technical effects: TIM KO or after editing and inserting the CAR molecule at the TIM3 gene site, it can reduce the inhibitory receptor NKG2A of iNK cells, increase the expression of the activating receptor Nkp46, and reduce the proportion of spontaneous apoptosis of iNK cells. This data can answer to a certain extent the question of... Fig.15 This is why TIM3CARiNK has better survival ability in the survival experiment.

[0257] In summary, the results of the embodiments of the present invention show that compared with the unedited WT control or the AAVS1.19CAR control edited at AAVS1, the TIM3.19CAR edited at TIM3 has many significant advantages.

[0258] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A method for gene editing of induced pluripotent stem cells (iPSCs) to differentiate and obtain functionally enhanced NK cells, characterized in that: The method comprises the steps of: (Z1) using the gene editing technology CRISPR / Cas9 to knock in an exogenous target gene at the TIM3 exon 1 site of the iPSC genome and knock out the TIM3 gene; and (Z2) Inducing gene-edited iPSCs to differentiate into NK cells under closed 3D culture conditions in a bioreactor, thereby obtaining NK cells with enhanced functions; The sequence of TIM3 exon 1 is shown in SEQ ID NO: 5; The exogenous target gene is a chimeric antigen receptor (CAR) gene targeting CD19, and the CAR has a structure as shown in the following formula I: L-EB-H-TM-C-CD3ζ (I) In the formula, Each "-" is independently a connecting peptide or a peptide bond; L is none or a signal peptide sequence; EB is the extracellular binding domain that targets CD19; H is the hinge region; TM is the transmembrane domain; C is a co-stimulatory signal molecule; CD3ζ is a cytoplasmic signaling sequence derived from CD3ζ.

2. The method according to claim 1, characterized in that The step (Z2) comprises: (i) feeding CAR-iPSCs into a bioreactor for 3D culture to form spherical iPSC aggregates; and (ii) by adding a specific cytokine combination, inducing iPSCs to undergo directed differentiation through the following cell fate conversion: from iPSCs to hematopoietic stem cells (HSCs), to lymphoid progenitor cells, and finally obtaining iPSC-CAR-NK cells characterized by CD3-CD56+; The step of converting iPSC to hematopoietic stem cells (HSC) comprises adding cytokines selected from the group consisting of SCF, VEGF, BMP4, or a combination thereof; the step of converting lymphocytes to iPSC-CAR-NK cells comprises adding cytokines selected from the group consisting of IL3, IL7, IL15, SCF, FLT3L, or a combination thereof.

3. The method according to claim 1, characterized in that The gene editing technology uses sgRNA, and the transcription template sequence of the sgRNA is shown in SEQ ID NO:

1.

4. The method according to claim 1, wherein: The sequence of the CAR is shown in SEQ ID NO:

6.

5. The method according to claim 1, wherein The method also includes: a step of verifying or identifying the iPSC after gene editing; wherein the verification or identification includes: using upstream and downstream primers across the homology arms for verification or identification, and the upstream and downstream primers include the HA-L sequence shown in SEQ ID NO: 2 and the HA-R sequence shown in SEQ ID NO:

3.

6. A NK cell prepared by the method according to any one of claims 1 to 5.

7. The NK cell according to claim 6, wherein The NK cells have one or more characteristics selected from the following group: (a) Enhanced target cell killing ability; (b) reduced NK cell apoptosis ratio; (c) enhanced ability to survive the process of killing target cells; (d) improved depletion properties; Wherein said (d) improved depletion characteristics include: (i) decreased expression of the inhibitory receptor NKG2A; and / or (ii) Increased expression of the activating receptor Nkp46.

8. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises: the NK cells as described in claim 6 or 7, and a pharmaceutically acceptable carrier.

9. A use of the NK cell according to claim 6 or 7 or the pharmaceutical composition according to claim 8, characterized in that: Used for preparing a drug for immunotherapy, wherein the drug is administered to a patient with cancer or a tumor, wherein the cancer or the tumor includes: a blood tumor, a solid tumor, or a combination thereof.

Images