Application of substance taking SAA2 gene as target spot in preparation of kit for diagnosing DKD and medicine for treating DKD

Abstract

The invention discloses application of a substance taking an SAA2 gene as a target spot in preparation of a kit for diagnosing DKD and a medicine for treating DKD, relates to the technical field of detection of gene target spots related to diabetic nephropathy and research and development of targeted medicines, discloses an effect of the SAA2 gene in diagnosis of DKD, and meanwhile, finds that expression of the SAA2 gene in DKD kidney tissues is increased, and the expression of the SAA2 gene in the DKD kidney tissues is reduced. The result is negatively correlated with renal function. The invention also finds that the SAA2 gene is related to podocyte injury and inflammatory response, and can reflect the inflammation level of DKD to a certain extent. The effect of the compound in DKD-mediated inflammatory reaction can be verified through further in-vivo and in-vitro experiments subsequently, and a certain theoretical basis is laid for research and development of targeted drugs.

Description

Technical Field

[0001] The present invention relates to the technical field of detection of gene targets related to diabetic nephropathy and development of targeted drugs, and more specifically to the application of a substance with SAA2 gene as a target in the preparation of a DKD diagnosis kit and a DKD treatment drug. Background Art

[0002] Diabetic kidney disease (DKD) is one of the serious complications of diabetes, and there is currently no effective treatment. The progression of DKD not only leads to a decline in the quality of life of patients, limited employment and productivity, but also shortens the life expectancy of patients, placing a heavy burden on the country and society. Therefore, exploring and applying diagnostic markers for DKD has important clinical significance and social value, and is also one of the key difficulties that the global kidney disease research team needs to overcome.

[0003] Previous studies have shown that podocytes are an important component of the glomerular filtration barrier, participate in maintaining the normal physiological function of the kidney, and are an important target for DKD-related damage. Inflammation caused by continuous high-glucose stimulation is an important feature of podocyte injury and plays a key role in the pathogenesis of diabetic nephropathy. At present, the diagnosis of DKD relies on renal biopsy puncture, and there is a lack of more stable and reliable supplementary detection methods and accurate and efficient treatment methods in clinical practice.

[0004] Therefore, how to find the pathogenesis and target genes related to DKD and apply them is an urgent problem that technicians in this field need to solve. Summary of the invention

[0005] In view of this, the present invention uses the SAA2 gene as a marker for diagnosing DKD, and uses it as a target to reduce the expression of the gene, laying a theoretical foundation for the development of drugs for treating DKD.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] Application of a substance targeting the SAA2 gene in the preparation of a diagnostic kit for DKD and a drug for treating DKD.

[0008] As an inventive concept identical to the above technical solution, the present invention also seeks to protect the use of a substance for detecting the SAA2 gene in the preparation of a diagnostic kit for DKD.

[0009] In the above technical solution, the substance for detecting the SAA2 gene is a primer sequence, specifically:

[0010] SAA2-F: 5′-TGTGGAGAGCCTACTCTGACAT-3′, SEQ ID NO.1;

[0011] SAA2-R: 5′-TCCCCCGAGCATGGAAGTA-3′, SEQ ID NO.2;

[0012] β-Actin-F: 5′-GAAGACTACGAGCTGCCTGA-3′, SEQ ID NO.3;

[0013] β-Actin-R: 5′-CAGACAGCACTGTGTTGGCG-3′, SEQ ID NO.4.

[0014] As an inventive concept identical to the above technical solution, the present invention also seeks to protect a kit for diagnosing DKD, comprising primers shown in SEQ ID NO.1 to SEQ ID NO.4.

[0015] As an inventive concept identical to the above technical solution, the present invention also requests protection for the use of a substance that reduces SAA2 gene expression in the preparation of a drug for treating DKD; the substance that knocks down SAA2 gene expression is an interfering RNA, the sequence of which is: 5′-GCCGAUCAGGCUGCCAAUAAA-3′, SEQ ID NO.15.

[0016] In the above technical scheme, reducing the expression of SAA2 gene can reverse the expression levels of podocyte injury marker protein Desmin, function-related protein ZO-1, inflammation-related protein TNF-a, inflammation-related protein MCP-1, and inflammation-related protein IL-6.

[0017] SAA2 is associated with high glucose-induced podocyte inflammation and injury, and regulates renal intrinsic cell podocyte injury. Compared with the podocytes in the low glucose group or the hyperosmotic group, the SAA2 gene expression level in the podocytes in the high glucose group increased, accompanied by increased expression of inflammatory-related proteins TNF-α, IL-6, and MCP-1, as well as podocyte mesenchymal protein Desmin, while the expression of podocyte injury marker protein ZO-1 decreased. There was no statistical difference in the above indicators between the podocytes in the low glucose group and the hyperosmotic group.

[0018] Preferably, compared with podocytes cultured under high glucose conditions, knocking down the SAA2 gene under high glucose conditions can reduce the inflammatory response caused by high glucose stimulation and reverse the abnormal expression of its related genes Desmin, ZO-1, IL-6, TNF-α and MCP-1; compared with podocytes cultured under low glucose conditions, podocytes overexpressing the SAA2 gene under low glucose conditions have enhanced inflammatory response and damage, increased expression levels of IL-6, TNF-α, MCP-1 and Desmin, and decreased expression level of ZO-1.

[0019] Preferably, compared with the control group mice, the STZ group mice had increased mesangial cell and matrix proliferation, increased mature macrophages, and increased Desmin and decreased expression levels of ZO-1, synaptopodin, and WT-1, indicating increased renal tissue inflammation and podocyte damage in the STZ group mice. KO The renal tissues of mice in the -Pod+STZ group reversed the above changes, suggesting that podocyte-specific knockout of SAA2 partially reversed STZ-induced renal tissue inflammation and damage in mice.

[0020] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses the role of the SAA2 gene in the diagnosis of DKD. At the same time, the present invention finds that the expression of the SAA2 gene is increased in DKD renal tissue and is negatively correlated with renal function. The present invention also finds that the SAA2 gene is associated with podocyte injury and inflammatory response, which can reflect the inflammation level of DKD to a certain extent. The role of the gene in DKD-mediated inflammatory response can be verified by further in vivo and in vitro experiments, which lays a certain theoretical foundation for the research and development of targeted drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0022] Figure 1 The attached figure shows immunofluorescence co-staining of SAA2 and podocyte marker synaptopodin in renal tissues of patients with diabetic nephropathy and normal renal tissues;

[0023] Figure 2 The attached figure shows the correlation between SAA2 expression level and renal function of diabetic mice. A is the real-time PCR detection of SAA2 mRNA level in renal tissue of WT-CTL and WT-STZ group mice. B, C, D are the correlation analysis between SAA2 mRNA level in renal tissue of WT-STZ group mice and urine albumin, urea nitrogen and blood creatinine levels;

[0024] Figure 3Figures AB are Real-time PCR and Western blot detection of SAA2 mRNA and protein levels in human immortalized podocytes under high glucose conditions; CF is Real-time PCR detection of Desmin, ZO-1, TNF-α and MCP-1 mRNA levels in human immortalized podocytes under high glucose culture conditions; G is Western blot detection of Desmin, ZO-1, TNF-α and IL-6 protein levels in human immortalized podocytes under high glucose culture conditions; H and I are immunofluorescence staining images of ZO-1 and Desmin in podocytes;

[0025] Figure 4 Figures A and B show that human immortalized podocytes were transfected with si-NC vector and si-SAA2 vector, respectively, and cultured under normal conditions for 48 hours, and Real-time PCR and Western blot were used to detect the mRNA and protein expression levels of SAA2; Figures C and D show that human immortalized podocytes were transfected with OE-NC vector and OE-SAA2 vector, respectively, and cultured under normal conditions for 24 hours, and Real-time PCR and Western blot were used to detect the mRNA and protein expression levels of SAA2 in cells;

[0026] Figure 5The attached figures show that SAA2 is involved in regulating the expression of proteins related to injury and inflammation of human immortalized podocytes under high glucose conditions; A and B are Real-time PCR detection of the mRNA expression levels of podocyte injury-related proteins Desmin and ZO-1 after human immortalized podocytes were transfected with si-SAA2 vectors; C is Western blot detection of the protein expression levels of podocyte injury-related proteins Desmin and ZO-1 after human immortalized podocytes were transfected with si-SAA2 vectors; D and E are Real-time PCR detection of the mRNA levels of inflammation-related proteins TNF-α and MCP-1 after human immortalized podocytes were transfected with si-SAA2 vectors; F is Western blot detection of the protein expression levels of inflammation-related proteins TNF-α and IL-6 after human immortalized podocytes were transfected with si-SAA2 vectors; G and H are Real-time PCR detection of the mRNA expression levels of podocyte injury-related proteins Desmin and ZO-1 after human immortalized podocytes were transfected with OE-SAA2 vectors; I is Western Blot detection of the protein expression levels of podocyte injury-related proteins Desmin and ZO-1 after human immortalized podocytes were transfected with OE-SAA2 vector; J, K are Real-time PCR detection of the mRNA levels of inflammation-related proteins TNF-α and MCP-1 after human immortalized podocytes were transfected with OE-SAA2 vector; L is Western blot detection of the protein expression levels of inflammation-related proteins TNF-α and IL-6 after human immortalized podocytes were transfected with si-SAA2 vector; M is the immunofluorescence staining image of Desmin and ZO-1 in podocytes;

[0027] Figure 6 The attached figure is a verification diagram of the gene regulation efficiency of SAA2 specific expression reduction in renal tissue podocytes; after tail vein injection of AAV9-SAA2-shRNA virus, primary mouse podocytes (A), endothelial cells (B) and mesangial cells (C) were extracted, and Real-time PCR was used to detect the mRNA expression of SAA2 in the three types of cells;

[0028] Figure 7 The attached figure shows that knocking down SAA2 can improve the renal tissue damage in DKD mice; A, B, and C are the control group, STZ group, and SAA2 NC-Pod +STZ group and SAA2 KO-Pod The levels of urine albumin, urea nitrogen and serum creatinine in mice in the +STZ group; D is the PAS, Masson and F4 / 80 staining results of renal tissues in different treatment groups; E is the renal tissue immunofluorescence staining of Desmin, ZO-1, synaptopodin and WT-1 in renal tissues in different treatment groups. DETAILED DESCRIPTION

[0029] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] Example 1 Detection of SAA2 expression in kidney tissue

[0031] Collecting kidney tissue samples

[0032] A total of 12 renal tissue samples were collected from September 2020 to December 2022, of which 3 samples in the control group were from normal renal tissue adjacent to the cancer removed by surgery in patients with renal tumors, excluding diabetes and other kidney diseases; 9 samples in the diabetic nephropathy group were from renal puncture biopsies in patients with diabetic nephropathy. Before all samples were collected, the patients or their guardians were informed of the purpose of the sample collection, and their consent was obtained and the informed consent form was signed. All human specimen collection studies were approved by the Ethics Committee of Shandong Provincial Hospital.

[0033] The expression level and distribution of SAA2 protein in the renal tissue of DKD patients were observed by immunofluorescence co-staining of SAA2 protein and podocyte marker synaptopodin.

[0034] The specific steps of immunofluorescence staining are as follows:

[0035] (1) Turn on the oven and preheat it to 65°C. Place the paraffin sections on the oven and set the timer for 60-90 minutes.

[0036] (2) Dewaxing and hydration: Check the reagents in each cylinder in the fume hood and ensure that the reagents are within the validity period. Place the slices on the copper rack and pass through the cylinders in the following order: xylene I (15 min), xylene II (15 min), xylene III (15 min), anhydrous ethanol I (8 min), anhydrous ethanol II (8 min), 95% ethanol (5 min), 80% (5 min), 70% ethanol (5 min). Be sure to close the glass door of the fume hood to prevent harmful gases from escaping.

[0037] (3) Soak the sections in distilled water three times, 5 min each time.

[0038] (4) Soak in PBS for 5 minutes.

[0039] (5) Antigen retrieval.

[0040] Prepare antigen repair solution: use a measuring balance to weigh Tris (1.21g), EDTA (0.327g), and Tween20 (500uL) and fully dissolve them in 1000mL distilled water, mix well and set aside. Add appropriate amount of water to the pressure cooker, put in a beaker containing the prepared antigen repair solution, cover the lid, turn on the switch and heat until steam comes up, wait until the steam is exhausted, open the lid, place the repair rack above the beaker, use steam to preheat the slices for a few seconds, put them in the antigen repair solution and heat again, take out the beaker after about 3-5 minutes and place it in a fume hood to cool to room temperature.

[0041] (6) Rinse with PBS three times, 5 min each time.

[0042] (7) Block the tissue with 5% BSA: Place the slices in a wet box, and then place the wet box in a 37°C incubator and incubate for 30 minutes.

[0043] (8) According to the requirements of the antibody manual, add SAA2 antibody (35D07A14, Invitrogen) and synaptopodin antibody (21064-1AP, Proteintech) in 5% BSA at a ratio of 1:200, mix thoroughly, and obtain a dilution containing two primary antibodies. About 150 μL of dilution should be prepared for each section and used immediately.

[0044] (9) Add the prepared antibody dilution solution to the sections and incubate at 4°C overnight.

[0045] (10) The next day, place the wet box containing the slices in a 37°C incubator for 30 min.

[0046] (11) Soak the sections in PBS three times, 5 min each time.

[0047] (12) Prepare fluorescent secondary antibody dilution solution and dilute Alexa Fluor with 5% BSA TM 488 goat anti-mouse (1:200) and Alexa Fluor TM 594 goat anti-rabbit (1:200), incubate at 37°C for 1.5h.

[0048] (13) PBS infiltration three times, 5 min each time.

[0049] (14) DAPI staining of cell nuclei for 8 min.

[0050] (15) Rinse with PBS three times, 8 min each time.

[0051] (16) Carefully wipe the moisture around the tissue on the slice, add a drop of anti-fluorescence quencher, and gently cover the slice with a coverslip, taking care to avoid bubbles as much as possible.

[0052] (17) Images were collected using a fluorescence microscope, and the experiment was repeated three times.

[0053] The results showed that SAA2 and synaptopodin, a podocyte marker, had overlapping staining in the renal tissue of patients. In the renal tissue of DKD patients, SAA2 gene expression increased significantly, accompanied by decreased synaptopodin expression, suggesting that SAA2 expression levels increased significantly when podocytes were damaged ( Figure 1 ).

[0054] Example 2 SAA2 expression level is negatively correlated with diabetic renal function in mice

[0055] Thirty-seven 4-week-old C57BL / 6 mice were selected and divided into 4 groups. AAV9-SAA2-shRNA virus (SAA2 KO-Pod -STZ, n = 6), AAV9-NC (SAA2 NC-Pod -STZ, n = 6) or PBS (WT-CTL, n = 10; WT-STZ, n = 15), and after 4 weeks, streptozotocin dissolved in citrate buffer was intraperitoneally injected for 5 consecutive days and a high-fat diet was given. C57BL / 6 mice were provided by the Experimental Animal Center of Shandong First Medical University. All animal studies were reviewed and approved by the Experimental Animal Ethics Committee of Shandong Provincial Hospital Affiliated to Shandong First Medical University.

[0056] A total of 25 mouse kidney tissue samples were collected, including 10 in the control group (WT-CTL) and 15 in the DKD group (WT-STZ group). Tissue mRNA was extracted and reverse transcribed into cDNA. Real-time PCR was further used to detect the expression of SAA2 ( Figure 2 ).

[0057] The specific steps are as follows:

[0058] Tissue RNA extraction

[0059] (1) According to the grouping, 5 mg of mouse kidney tissue was cut into EP tubes, 300 ul of Lysis Buffer was added, and then homogenized using a homogenizer.

[0060] (2) Centrifuge at 12000g for 2 min, transfer the supernatant to a new 1.5 ml EP tube, add an equal volume of anhydrous ethanol, and mix thoroughly.

[0061] (3) Add the above sample to the centrifuge column and centrifuge at 4000g for 1 min at room temperature.

[0062] (4) Add 500 μl Wash Buffer to the centrifuge column and centrifuge at 12,000 g for 1 min at room temperature.

[0063] (5) Transfer the centrifuge column to a new EP tube, open the lid and let it stand for 2 min, add 25 ul of Elution Buffer to the centrifuge column, let it stand at room temperature for 2 min, centrifuge at 12000g for 1 min at room temperature, discard the centrifuge column, and the centrifuge product is RNA.

[0064] (6) NanoDrop-2000 micro-volume spectrophotometer was used to measure RNA concentration and purity.

[0065] Reverse transcription

[0066] (1) To remove genomic DNA, the reaction system included 5× DNA Eraser Buffer (2 μL), gDNA Eraser (1 μL), RNA of the group, and RNase Free dH20. The total volume was 10 μL. The reaction conditions were 42°C for 2 min and maintained at 4°C.

[0067] (2) Reverse transcription reaction: Prepare a mixed solution according to the proportions in the table below. After thorough mixing, add 10 μL of the mixed solution to the reaction tube until the volume in the reaction tube reaches 20 μL. Vortex to mix and perform the reaction in a T100 gradient PCR instrument under the reaction conditions of 37°C for 15 min, 85°C for 5 s, and 4°C for 30 min.

[0068] Table 1 Reverse transcription reaction system

[0069] Component name Volume added to each reaction tube (μL) EvoM-MLVRTaseEnzymeMix 1 5×RTaseReactionBufferMixⅠ 4 RTPrimerMix 1 RNaseFreedH2O 4 total 10

[0070] After the reaction is completed, the obtained cDNA can be temporarily stored at -20℃, or placed in a -80℃ refrigerator for long-term storage.

[0071] Real-time PCR

[0072] Real-time PCR kit: SYBR Green Pro Taq HS premixed qPCR kit.

[0073] Target gene and internal reference amplification primers:

[0074] Gene name Primer sequence (5'-3');

[0075] SAA2-F: 5′-TGTGGAGAGCCTACTCTGACAT-3′, SEQ ID NO.1;

[0076] SAA2-R: 5′-TCCCCCGAGCATGGAAGTA-3′, SEQ ID NO.2;

[0077] β-Actin-F: 5′-GAAGACTACGAGCTGCCTGA-3′, SEQ ID NO.3;

[0078] β-Actin-R: 5′-CAGACAGCACTGTGTTGGCG-3′, SEQ ID NO.4.

[0079] The real-time PCR reaction system is shown in Table 2:

[0080] Table 2 Real-time PCR reaction system

[0081]

[0082] Set up the Light Cycle 480II program as shown in Table 3:

[0083] Table 3

[0084]

[0085] Calculation of SAA2 expression level: RV = lg2 (-ΔCt) , ΔCt=Ct(SAA2)-Ct(β-actin) To further study the relationship between the relative expression of SAA2 in the renal tissue of WT-STZ mice and the renal function of WT-STZ mice: The correlation between the relative expression level of SAA2 in the renal tissue of WT-STZ mice and clinical indicators was calculated by Spearman's correlation analysis.

[0086] Urine albumin, urea nitrogen, and serum creatinine

[0087] Urinary albumin: One day before tissue preparation, mice were placed individually in metabolic cages and urine samples were collected for 12 hours. Mouse urinary albumin was measured using ELISA according to the manufacturer's instructions.

[0088] Serum urea nitrogen: Serum urea nitrogen was measured by urease method. According to the instruction manual of the kit and according to the grouping, the prepared mouse serum was added to each EP tube, and then the buffered enzyme solution was added. The tubes were incubated in a 37°C water bath for 10 min. The colorimetric reagent and alkaline sodium hypochlorite were added in sequence. After being fully mixed, the tubes were incubated in a 37°C water bath for 10 min. The OD value was then measured at 640 nm. The urea nitrogen content was calculated according to the formula provided in the instruction manual of the kit.

[0089] Serum creatinine: Serum creatinine was measured by the sarcosine oxidase method. The working solution was prepared according to the method and sample quantity in the kit instruction manual. After adding mouse serum to a 96-well plate, enzyme solution A was added in sequence. The plates were incubated in a 37°C water bath for 5 minutes. The absorbance A1 was measured at 546 nm. Then enzyme solution B was added. After incubation for 5 minutes, the absorbance A2 was measured at the above wavelength. Serum creatinine was calculated according to the formula provided in the kit instruction manual.

[0090] The results showed that compared with the control group (WT-CTL) mice, SAA2 was significantly upregulated in the kidney tissue of diabetic WT-STZ mice, and the expression of SAA2 was correlated with urinary albumin (rs=0.754, P=0.001), blood urea nitrogen (rs=0.558, P=0.031), and blood creatinine (rs=0.525, P=0.044).

[0091] Example 3 Role of SAA2 in mediating podocyte injury in diabetic nephropathy

[0092] Functional experiments confirmed that SAA2 regulates podocyte injury, a renal intrinsic cell.

[0093] Target gene and internal reference amplification primers:

[0094] Gene Name Primer Sequence (5'-3'):

[0095] SAA2:

[0096] Forward: 5'-TGTGGAGAGCCTACTCTGACAT-3', SEQ ID NO.1;

[0097] Reverse: 5'-TCCCCCGAGCATGGAAGTA-3', SEQ ID NO.2;

[0098] Desmin:

[0099] Forward: 5′-AGGACCGATTTGCCAGTGAG-3′’, SEQ ID NO.5;

[0100] Reverse: 5′-CTTGAGGTGCCGGATTTCCT-3′, SEQ ID NO.6;

[0101] ZO-1:

[0102] Forward: 5′-CCCCCAACTCAAACCGAAGA-3′, SEQ ID NO.7;

[0103] Reverse: 5′-AGATGCTACTTCTGGAGGCTTA-3′, SEQ ID NO.8;

[0104] MCP-1:

[0105] Forward: 5'-CTCAGCCAGATGCAATCAATG-3', SEQ ID NO.9;

[0106] Reverse: 5'-CTTCTTTGGGACACTTGCTGC-3', SEQ ID NO.10;

[0107] TNF-α:

[0108] Forward 5′-GAGGCCAAGCCCTGGTATG-3′, SEQ ID NO.11;

[0109] Reverse: 5′-CGGGCCGATTGATCTCAGC-3′, SEQ ID NO.12;

[0110] β-actin:

[0111] Forward: 5′-GAAGACTACGAGCTGCCTGA-3′, SEQ ID NO.13;

[0112] Reverse: 5′-CAGACAGCACTGTGTTGGCG-3′, SEQ ID NO.14;

[0113] Real-time PCR and Western Blot were used to detect the expression levels of podocyte injury marker protein Desmin, function-related protein ZO-1, inflammation-related protein TNF-a, inflammation-related protein MCP-1, inflammation-related protein IL-6 and SAA2. Figure 3 ).

[0114] The results showed that Real-time PCR and Western blot showed that the expression of Desmin, IL-6, TNF-a and SAA2 increased in podocytes stimulated by high glucose, while the expression of ZO-1 decreased.

[0115] Primary antibody catalog number and dilution ratio

[0116] The primary antibodies used were: Desmin (1:5000, 16520-1-AP, Abcam), ZO-1 (1:10000, Proteintech), TNF-α (1:1000, 60291-1-Ig, Proteintech), IL-6 (1:2500, 66146-1-Ig, Proteintech), SAA2 (1:500, 35D07A14, Invitrogen), and β-actin (1:10000, 66009-1-Ig, Proteintech).

[0117] To study the role of SAA2 in mediating podocyte injury in diabetic nephropathy, SAA2-specific siRNA and SAA2 overexpression plasmid vectors were constructed. After transfection, podocyte RNA was extracted. Real-time PCR detection showed that good knockdown and overexpression efficiency was obtained ( Figure 4 ).

[0118] siRNA, SAA2 overexpression plasmid vector

[0119] SAA2 siRNA:GCCGAUCAGGCUGCCAAUAAA, SEQ ID NO.15;

[0120] NC siRNA:UUCUCCGAACGUGUCACGU, SEQ ID NO.16;

[0121] After transfection, podocytes were stimulated with high and low glucose levels according to the groups. Real time PCR and Western Blot were used to detect the mRNA and protein expression levels of Desmin, ZO-1, IL-6, TNF-a and SAA2 in podocytes. Immunofluorescence was used to detect the protein expression levels of Desmin and ZO-1 ( Figure 5 ).

[0122] Podocyte RNA extraction

[0123] (1) Rinse: Aspirate the culture medium from the six-well plate, add 1 mL of PBS buffer to each well, and wash twice.

[0124] (2) Add 1 mL of Trizol and lyse on ice for 10 min. Pipet the Trizol to make lysis more complete. Pipette the liquid in the well into a 1.5 mL EP tube and place it on ice.

[0125] (3) Add 200 μL of chloroform, mix by inverting the EP tube 30 times, and place it on ice. After stratification, place the EP tube in a centrifuge, balance it, and centrifuge it at 12,000 rpm at 4°C for 15 min.

[0126] (4) Pipette 300 μL of supernatant into another EP tube, being careful not to aspirate the white precipitate at the bottom. Add an equal volume of isopropanol, vortex, and place on ice for 5 min. Place the EP tube in a centrifuge and centrifuge at 12,000 rpm at 4°C for 15 min.

[0127] (5) Slowly pour out the supernatant, add 1 mL of 75% ethanol, vortex and centrifuge at 7500 rpm at 4°C for 5 min.

[0128] (6) Slowly pour off the supernatant, add 1 mL of anhydrous ethanol, vortex and centrifuge at 7500 rpm at 4°C for 5 min.

[0129] (7) Discard the supernatant, invert the EP tube onto absorbent paper to dry, add 10-20 μL of DEPC water according to the amount of extracted RNA to fully dissolve the RNA, and place the EP tube on ice.

[0130] Western Blot

[0131] (1) Protein extraction

[0132] ① Rinse cells twice with PBS.

[0133] ②Prepare protein extraction mixture: add 1% protease inhibitor (P6730, Solarbio) and 1% protein phosphatase inhibitor (P1260, Solarbio) to protein lysis buffer (RIPA) (P0013C, Beyotime).

[0134] ③ Add 150-200 μL of protein extraction mixture to each well of the six-well plate and place on ice for 30 minutes.

[0135] ④ Scrape the cells with a pipette tip and transfer them to a 1.5 mL EP tube. Centrifuge at 12,000 rpm at 4°C for 20-30 min.

[0136] ⑤ Pipette the supernatant into a new EP tube and record the volume of the supernatant.

[0137] (2) Protein concentration measured by BCA method (P0011, Beyotime)

[0138] Draw a standard curve based on the concentration of the standard, determine the protein concentration value corresponding to each sample, and calculate the sample addition amount.

[0139] (3) Protein denaturation

[0140] Add 1 / 3 of the supernatant volume of 4×SDS-PAGE loading buffer to a 1.5mL EP tube and vortex to mix. Heat the EP tube in a 95-100℃ metal bath for 5-10 minutes to fully denature the protein. Store the denatured protein in a -20℃ refrigerator for later use.

[0141] (4) SDS-PAGE gel preparation (PG112, Yazyme)

[0142] Prepare gel according to the molecular weight of the target protein and the instructions.

[0143] (5) Electrophoresis

[0144] ① Preparation: Prepare 1× SDS-PAGE Running Buffer (Servicebio, China) and pour it into the electrophoresis tank, covering the upper edge of the small glass. Prepare the solidified SDS-PAGE gel in advance and gently pull the comb out from the middle of the glass plate.

[0145] ② Loading: According to the pre-designed grouping, add Marker (Thermo Fisher, USA) and each group of proteins.

[0146] ③ Electrophoresis: Set the electrophoresis instrument (Bio-Rad, USA) to 150V. After about 50 minutes, bromophenol blue can be observed to reach the bottom of the lower gel, and the electrophoresis is terminated.

[0147] (6) Electroporation

[0148] ① Membrane cutting: Cut the PVDF membrane into appropriate size and activate it in methanol for 1-2 minutes.

[0149] ② Estimate the position of the required protein according to the indication of the Marker and cut the gel. Place the black and white transfer rack in the transfer solution with the negative pole facing down. Place the sponge, filter paper, gel, PVDF membrane, filter paper, sponge in order from bottom to top and close the transfer clamp.

[0150] ③ Pour the prepared SDS-PAGE Transfer Buffer solution to completely cover the transfer clip, set the transfer current to 220mA, constant current electrotransfer, and the transfer time is determined by the molecular weight (about 1 min for every 1kDa of molecular weight), and cool in an ice bath.

[0151] (7) After transfer, rinse the strips with TBST buffer for 3 times, 5 min each time. Block with 5% milk at room temperature for 1-2 h. After blocking, wash the strips with TBST for 3 times, 5 min each time. Place the membrane in the diluted primary antibody and incubate on a shaker at 4°C overnight. The specific antibodies and dilution ratios are as follows: Desmin (1:5000, 16520-1-AP, Abcam), ZO-1 (1:10000, Proteintech), TNF-α (1:1000, 60291-1-Ig, Proteintech), IL-6 (1:2500, 66146-1-Ig, Proteintech), SAA2 (1:500, 35D07A14, Invitrogen), β-actin (1:10000, 66009-1-Ig, Proteintech).

[0152] (8) The next day, wash the membrane three times with TBST, 5 min each time. Incubate the strips with secondary antibody dilution at room temperature for 1-2 h. The secondary antibody and dilution ratio are as follows: horseradish enzyme-labeled goat anti-rabbit IgG (1:5000, Abcam), horseradish enzyme-labeled goat anti-mouse IgG (1:5000, Abcam).

[0153] (8) Wash the membrane three times with TBST, 5 min each time.

[0154] (9) Development: Prepare the developer in a 1:1 ratio according to the instructions of the ECL luminescent solution. Evenly add the developer onto the membrane and use the Amersham Imager 600 gel imaging system to capture and record the image of the band chemiluminescence development.

[0155] Cell immunofluorescence staining

[0156] (1) Seed the podocytes in a six-well plate with a cell slide, and wait until the cell density reaches 50-60% under a microscope before preparing for the experiment.

[0157] (2) Rinse with PBS three times, 5 min each time.

[0158] (3) Fix the cells with 4% paraformaldehyde for 20 min.

[0159] (4) Rinse with PBS three times, 5 min each time.

[0160] (5) Permeabilize with 0.1% Triton for 5 min.

[0161] (6) Rinse with PBS three times, 5 min each time.

[0162] (7) Blocking with 5% BSA: Place the slide upside down in goat serum and incubate at 37°C for 1 h.

[0163] (8) According to the requirements of the antibody manual, add Desmin (1:200, 16520-1-AP, Abcam) or ZO-1 (1:200, Proteintech) antibody in 5% BSA at a ratio of 1:200, mix thoroughly, and obtain the primary antibody dilution solution. About 80 μL of dilution solution should be prepared for each slide and used immediately.

[0164] (9) Place the slide upside down in the primary antibody dilution buffer and incubate at 4°C overnight.

[0165] (10) The next day, place the wet box containing the slides in a 37°C incubator for 30 min.

[0166] (11) Rinse with PBS three times, 5 min each time.

[0167] (12) Prepare fluorescent secondary antibody dilution solution and dilute AlexaFluor with 5% BSA TM 594 goat anti-rabbit (1:200), incubate at 37°C for 1.5h.

[0168] (13) PBS infiltration three times, 5 min each time.

[0169] (14) DAPI staining of cell nuclei for 8 min.

[0170] (15) Rinse with PBS three times, 8 min each time.

[0171] (16) Add anti-fluorescence quenching agent and seal the slide, taking care to avoid bubbles as much as possible.

[0172] (16) Images were taken and collected using a fluorescence microscope, and the experiment was repeated three times.

[0173] The results showed that Real-time PCR and Western Blot showed that compared with podocytes cultured under high glucose conditions, knocking down the SAA2 gene under high glucose conditions could reduce the inflammatory response caused by the high glucose environment and reverse the abnormal expression of its related genes IL-6, TNF-α and MCP-1 ( Figure 5 D-5F). Similarly, compared with podocytes cultured under low glucose conditions, podocytes overexpressing the SAA2 gene under low glucose conditions had enhanced inflammatory responses, and the expression levels of inflammatory markers IL-6, TNF-α, and MCP-1 increased ( Figure 5 J-5L), suggesting that SAA2 regulates high glucose-induced podocyte inflammatory response. Immunofluorescence detection of Desmin and ZO-1 protein expression and distribution in podocytes showed that high glucose treatment induced increased Desmin expression and decreased ZO-1 expression in podocytes. Interference with SAA2 expression can correct its abnormal expression, suggesting that SAA2 regulates high glucose-induced podocyte injury ( Figure 5 M); Scale bar = 50 μm.

[0174] Example 4 Effect of SAA2 on podocyte injury in DKD mice

[0175] After tail vein injection of AAV9-SAA2-shRNA virus, primary mouse podocytes, endothelial cells and mesangial cells were extracted, and real-time PCR was used to detect the mRNA expression of SAA2 in the three types of cells. Figure 6 ). The results showed that SAA2 KO -Pod mouse podocytes achieved better SAA2 podocyte-specific knockout efficiency.

[0176] Tail vein injection of AAV9 virus

[0177] To study the role of SAA2 in mediating podocyte injury in diabetic nephropathy, recombinant adeno-associated virus (AAV9-SAA2-shRNA) and recombinant adeno-associated virus negative control (AAV9-NC) were specifically constructed. AAV9-SAA2-shRNA virus (SAA2 KO-Pod -STZ, n = 6), AAV9-NC (SAA2 NC-Pod -STZ, n = 6) or PBS (WT-CTL, n = 10; WT-STZ, n = 15). After 4 weeks, the WT-STZ group, SAA2 NC-pod -STZ group and SAA2 KO-Pod The -STZ group was intraperitoneally injected with streptozotocin (STZ, Sigma-Aldrich, St Louis, MO, USA) dissolved in citrate buffer (50 mg / kg) for 5 consecutive days and given a high-fat diet, while the WT-CTL group was given citrate buffer alone. Mice were considered diabetic when blood glucose levels were higher than 300 mg / dl 16 days after the last STZ injection.

[0178] The constructed vector structure was pAV-NPHS1-GFR-miR30-shRNA.

[0179] The shRNA target sequences are as follows:

[0180] SAA2-shRNA:AAGAGAGCTTTCAGGAATTCTTTAGTGAAGCCACAGATGTAAAGAATTCCTGAAAGCTCTCTC, SEQ ID NO.17;

[0181] Then PCR typing was performed using the following primers:

[0182] Mus-SAA2-71F CTGACATGAAGGAAGCTGGC, SEQ ID NO.18;

[0183] Mus-SAA2-71R GGCAGCATCATAGTTCCCCC, SEQ ID NO.19;

[0184] To examine the effects of SAA2 knockdown on renal inflammation and injury in DKD mice, the control group, STZ group, and SAA2 NC -Pod +STZ group and SAA2 KO-Pod The urine albumin, urea nitrogen and serum creatinine levels of the mice in the +STZ group were compared. The renal tissues of the mice in the above groups were stained with PAS, Masson and F4 / 80, and the renal tissues of Desmin, ZO-1, synaptopodin and WT-1 were immunofluorescently stained.

[0185] Urine albumin, urea nitrogen, and serum creatinine

[0186] Same as Example 2.

[0187] PAS staining

[0188] (1) Turn on the baking machine and bake the paraffin sections at 65°C for 60-90 minutes.

[0189] (2) Dewaxing and hydration: Check the reagents in each cylinder in the fume hood and ensure that the reagents are within the validity period. Place the slices on the copper rack and pass through the cylinders in the following order: xylene I (15 min), xylene II (15 min), xylene III (15 min), anhydrous ethanol I (8 min), anhydrous ethanol II (8 min), 95% ethanol (5 min), 80% (5 min), 70% ethanol (5 min). Be sure to close the glass door of the fume hood to prevent harmful gases from escaping.

[0190] (3) Soak the sections in distilled water three times, 5 min each time.

[0191] (4) Add oxidant to the slices and leave them at room temperature for 8 minutes.

[0192] (5) Rinse the sections with tap water for 5 minutes.

[0193] (6) Soak in distilled water twice, 5 min each time.

[0194] (7) Add an appropriate amount of Schiff reagent to the slices, protect from light, and stain at room temperature for 20 minutes.

[0195] (8) Rinse the sections with tap water for 10 minutes.

[0196] (9) Use hematoxylin staining solution to stain the nucleus for 1-2 minutes.

[0197] (10) Rinse with tap water for 10 minutes.

[0198] (11) Differentiation 1-2s.

[0199] (12) Rinse with running water to restore the blue color.

[0200] (13) Dehydrate with ethanol step by step, make the slides transparent with xylene, and seal the slides with neutral gum.

[0201] (14) Observe under a microscope, take photos and save the images.

[0202] (15) The experiment was repeated three times.

[0203] Masson staining

[0204] (1) Slide baking: Turn on the slide baking machine and place the prepared paraffin sections of kidney tissue on the slide baking machine for 30-60 minutes.

[0205] (2) Dewaxing and hydration: same as above.

[0206] (3) Soak in distilled water for 3 times, 5 min each time.

[0207] (4) Add Bouin solution and incubate at 37°C for 2 h.

[0208] (5) Rinse briefly under running water.

[0209] (6) Stain with lapis lazuli blue solution for 3 min and rinse with tap water.

[0210] (7) Stain with Mayer’s hematoxylin for 1 min and rinse with running water.

[0211] (8) Differentiate and rinse under running water for several minutes.

[0212] (9) Dye with Yuchun red fuchsin for 3 minutes and rinse with distilled water.

[0213] (10) Treat with phosphomolybdic acid solution for 20 min.

[0214] (11) After discarding the above liquid, add aniline blue staining solution directly and stain for 8 minutes.

[0215] (12) Treat with weak acid solution for 1 min.

[0216] (13) Rapid dehydration with 95% ethanol.

[0217] (14) Dehydrate with anhydrous ethanol three times, 10 seconds each time.

[0218] (15) Clear in xylene three times, 2 min each time.

[0219] (16) After drying, the slides were sealed with neutral gum and observed and photographed under a microscope.

[0220] (17) The experiments were repeated at least three times.

[0221] F4 / 80 immunohistochemical staining of kidney tissue

[0222] (1) Slide baking: Turn on the slide baking machine and place the prepared paraffin sections of kidney tissue on the slide baking machine for 30-60 minutes.

[0223] (2) Dewaxing and hydration: same as above.

[0224] (3) Soak in distilled water three times, 5 min each time.

[0225] (4) Soak in PBS for 5 minutes.

[0226] (5) Antigen retrieval: The same antigen retrieval operation as that of immunofluorescence staining in Example 1.

[0227] (6) Use a pipette to draw up endogenous peroxidase blocker and drop it onto the kidney tissue, then place it in a wet box and incubate it for 30 min.

[0228] (7) Soak in PBS three times, 5 min each time.

[0229] (8) Blocking: Use a pipette to draw a drop of goat serum blocking solution onto the kidney tissue, place it in a wet box, and incubate it in a 37°C incubator for 30 min.

[0230] (9) Primary antibody incubation: Discard the blocking solution, prepare the primary antibody F4 / 80 (28463-1-AP, Proteintech) at a dilution of 1:8000, add the primary antibody to the kidney tissue, and incubate at 4°C overnight.

[0231] (10) Rewarming: Place in a 37°C incubator for 30 min.

[0232] (11) Soak in PBS three times, 5 min each time; use a pipette to draw droplets of reaction enhancement solution onto the kidney tissue, place it in a wet box, and incubate it in a 37°C incubator for 20 min.

[0233] (12) Soak in PBS three times, 5 min each time; pipette the enhanced enzyme-labeled goat anti-rabbit IgG polymer and drop it on the kidney tissue, place it in a wet box, and incubate it in a 37°C incubator for 30 min; soak in PBS three times, 5 min each time.

[0234] (13) DAB color development: Use a pipette to draw a drop of DAB color development solution onto the kidney tissue and soak in tap water after 10 seconds to terminate the reaction.

[0235] (14) Use a pipette to draw up the hematoxylin stain solution and drop it on the kidney tissue. After 3 minutes, rinse with tap water for 10 minutes.

[0236] (15) Use 1% hydrochloric acid alcohol to differentiate for a few seconds, rinse with tap water to turn blue for 5 minutes, and observe the staining under a microscope.

[0237] (16) Dehydrate with ethanol step by step, make the slides transparent with xylene, and seal the slides with neutral gum.

[0238] (17) Observe under a microscope, take photos and save the images; the results are as attached. Figure 7 As shown in D.

[0239] Immunofluorescence staining of kidney tissue

[0240] Same as Example 1, wherein the primary antibody dilution ratio and information are as follows:

[0241] Desmin(1:200,16520-1-AP,Abcam),ZO-1(1:200,Proteintech),synaptopodin(1:200,21064-1AP,Proteintech),WT-1(ab89901,Abcam).

[0242] The results showed that compared with the control group mice, PAS staining and Masson staining showed that the renal tissue of the STZ group mice showed proliferation of mesangial cells and matrix, diffuse thickening of the glomerular basement membrane, and glomerular sclerosis and fibrosis; F4 / 80 staining showed that the renal tissue of the STZ group mice increased with mature macrophages, indicating that the renal tissue of the STZ group mice increased inflammation and damage. KO-Pod The +STZ group reversed the above changes to some extent.

[0243] At the same time, immunofluorescence staining of renal tissue showed that compared with the control group mice, the expression level of Desmin in the renal tissue of the STZ group mice was increased, and the expression levels of ZO-1, synaptopodin and WT-1 were decreased; compared with the STZ group mice, SAA2 KO -Pod In the renal tissue of mice in the +STZ group, the increase of Desmin and the decrease of ZO-1, synaptopodin and WT-1 induced by STZ were reversed to some extent.

[0244] These results suggest that podocyte-specific knockout of SAA2 partially reversed STZ-induced renal tissue inflammation and damage in mice.

[0245] In this specification, each embodiment is described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the embodiments can be referred to each other. For the device disclosed in the embodiment, since it corresponds to the method disclosed in the embodiment, the description is relatively simple, and the relevant parts can be referred to the method part.

[0246] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of substances targeting the SAA2 gene in the preparation of diagnostic kits for DKD and drugs for the treatment of DKD.

2. Application of the substance for detecting SAA2 gene in the preparation of a diagnostic kit for DKD.

3. The use according to claim 2, characterized in that: The substance for detecting the SAA2 gene is a primer sequence, specifically: SAA2-F: 5′-TGTGGAGAGCCTACTCTGACAT-3′, SEQ ID NO.1; SAA2-R: 5′-TCCCCCGAGCATGGAAGTA-3′, SEQ ID NO.2; β-Actin-F: 5′-GAAGACTACGAGCTGCCTGA-3′, SEQ ID NO.3; β-Actin-R: 5′-CAGACAGCACTGTGTTGGCG-3′, SEQ ID NO.

4.

4. A kit for diagnosing DKD, characterized in that: It includes primers shown in SEQ ID NO.1 to SEQ ID NO.

4.

5. Application of substances that knock down SAA2 gene expression in the preparation of drugs for the treatment of DKD.

6. The use according to claim 5, characterized in that: The substance for knocking down the expression of the SAA2 gene is an interfering RNA, and the sequence is: 5′-GCCGAUCAGGCUGCCAAUAAA-3′, SEQ ID NO.

15.

7. The use according to claim 5, characterized in that: Knocking down SAA2 gene expression can reverse the expression levels of podocyte injury marker protein Desmin, function-related protein ZO-1, inflammation-related protein TNF-a, inflammation-related protein MCP-1, and inflammation-related protein IL-6.

8. The use according to claim 7, characterized in that: Knocking down the SAA2 gene under high glucose conditions alleviated the inflammatory response caused by high glucose stimulation and reversed the abnormal expression of its related genes Desmin, ZO-1, IL-6, TNF-α and MCP-1; under low glucose conditions, the podocytes overexpressing the SAA2 gene had enhanced inflammatory response and damage, the expression levels of IL-6, TNF-α, MCP-1 and Desmin increased, while the expression level of ZO-1 decreased.

Images