A molecular marker for identifying boar sperm motility and its application

By detecting the genotype of specific SNP sites in the boar genome and using PCR amplification and sequencing technology to identify boar sperm motility, the problem of substandard boar semen quality has been solved, and the accuracy of semen quality identification and the efficiency of boar selection have been improved.

CN119220706BActive Publication Date: 2025-10-28CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411625629.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-14
Publication Date
2025-10-28
Estimated Expiration
2044-11-14

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively assess boar sperm motility, leading to high boar culling rates, which in turn affect sow conception rates and litter sizes, and result in serious issues with substandard semen quality.

Method used

By detecting the genotype of specific SNP sites in the boar genome, PCR amplification and sequencing technologies are used to determine boar sperm motility. Primer pairs are designed for genotype determination, and sperm motility is measured using a computer-aided sperm analysis system.

Benefits of technology

It improved the accuracy and selectivity of boar semen quality identification, reduced the boar culling rate, and increased the conception rate and litter size of sows.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention discloses a molecular marker for identifying boar sperm motility and its application. The molecular markers are molecular marker A shown in SEQ ID NO: 1 and / or molecular marker B shown in SEQ ID NO: 4. Experiments have shown that SNP1 is the 183rd nucleotide from the 5' end of SEQ ID NO: 1 in the boar genome, SNP2 is the 491st nucleotide from the 5' end of SEQ ID NO: 1 in the boar genome, and SNP3 is the 285th nucleotide from the 5' end of SEQ ID NO: 4 in the boar genome. By detecting the genotype of the boar based on the SNP1, SNP2, and / or SNP3 sites, the sperm motility trait of the boar can be identified. This invention has significant application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to molecular genetics, specifically relating to a molecular marker for identifying boar sperm motility and its application. Background Technology

[0002] Boars are one of the most important factors in the pig industry, and the quality of boar semen directly affects the economic benefits of pig farms. The selection of boar semen traits has a significant economic impact on the pig production system. The more semen produced by each boar and the higher the semen quality, the more the cost of the boar is distributed among more sows, resulting in lower operating costs for superior boars. With the gradual expansion of boar stations, the phenomenon of substandard boar semen quality (such as low ejaculation volume, low density, high deformity rate, and dead sperm) is becoming increasingly common, seriously affecting sow conception rates, litter sizes, and the efficiency of boar utilization. Therefore, improving boar semen quality has become a key issue that needs to be addressed in pig production. Surveys of boar stations in Canada, Denmark, the Netherlands, Norway, and the United States show that boars culled due to semen quality account for 10%-30% of the total number of culled boars. Research on the causes of boar culling in some Chinese boar stations shows that the proportion of boars culled due to substandard semen quality is approximately 28%.

[0003] Single nucleotide polymorphisms (SNPs) refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level. Some SNPs have been reported to be significantly associated with sperm motility and sperm abnormality rates in boars. By identifying SNP sites related to boar sperm motility and performing functional analysis, potential causal mutations affecting boar sperm motility can be screened, allowing for early selection of boar semen quality traits using marker-assisted selection. Furthermore, since semen quality traits are low-heritability traits, marker-assisted selection using SNPs can further improve the accuracy of selection. Therefore, identifying key SNP sites affecting boar sperm motility is of great significance and economic value for the breeding of boar semen quality traits. Summary of the Invention

[0004] The purpose of this invention is to identify or assist in the identification of boar sperm motility, which can be the motility of fresh semen.

[0005] This invention first protects a method for identifying or assisting in the identification of boar sperm motility.

[0006] The method for identifying or assisting in the identification of boar sperm motility protected by this invention may specifically be method A1, which may include the following steps: detecting whether the genotype of the boar to be tested based on the SNP1 locus is AA homozygous, AC heterozygous, or CC homozygous, and then making the following judgment: the sperm motility of boars with AA homozygous or AC heterozygous genotypes based on the SNP1 locus is greater than that of boars with CC homozygous genotypes based on the SNP1 locus; the SNP1 locus is specifically the nucleotide at position 183 from the 5' end of SEQ ID NO: 1 in the boar genome.

[0007] The method for identifying or assisting in the identification of boar sperm motility protected by this invention may specifically be method A2, which may include the following steps: detecting whether the genotype of the boar to be tested based on the SNP2 locus is CC homozygous, CT heterozygous, or TT homozygous, and then making the following judgment: the sperm motility of boars with genotypes of CC homozygous or CT heterozygous based on the SNP2 locus is greater than that of boars with genotypes of TT homozygous based on the SNP2 locus; the SNP2 locus is specifically the nucleotide at position 491 from the 5' end of SEQ ID NO: 1 in the boar genome.

[0008] The method for identifying or assisting in the identification of boar sperm motility protected by this invention may specifically be method A3, which may include the following steps: detecting whether the genotype of the boar to be tested based on the SNP3 locus is GG homozygous, GA heterozygous, or AA homozygous, and then making the following judgment: the sperm motility of boars with a genotype of GG homozygous or GA heterozygous based on the SNP3 locus is greater than that of boars with a genotype of AA homozygous based on the SNP3 locus; the SNP3 locus is specifically the nucleotide at position 285 from the 5' end of SEQ ID NO: 4 in the boar genome.

[0009] The method for identifying or assisting in the identification of boar sperm motility protected by this invention may specifically be method B1, which may include the following steps:

[0010] B1-1) Using the genomic DNA of the boar to be tested as a template, PCR amplification was performed using a primer pair consisting of upstream primer 1F and downstream primer 1R to obtain PCR amplification product 1. The PCR amplification product 1 was sequenced, and then the following judgments were made: if the 183rd position of PCR amplification product 1 is only A, then the genotype of the boar to be tested based on the SNP1 site is AA homozygous; if the 183rd position of PCR amplification product 1 is both A and C, then the genotype of the boar to be tested based on the SNP1 site is AC heterozygous; if the 183rd position of PCR amplification product 1 is only C, then the genotype of the boar to be tested based on the SNP1 site is CC homozygous.

[0011] B1-2) Based on the results of B1-1), the following judgment is made: the sperm motility of boars with genotypes of AA homozygous or AC heterozygous based on the SNP1 locus is greater than that of boars with genotypes of CC homozygous based on the SNP1 locus.

[0012] In the above method, the SNP1 site is specifically the nucleotide at position 183 from the 5' end of SEQ ID NO: 1 in the boar genome.

[0013] In the above method, the upstream primer 1F is specifically the single-stranded DNA molecule shown in SEQ ID NO:2.

[0014] In the above method, the downstream primer 1R is specifically the single-stranded DNA molecule shown in SEQ ID NO:3.

[0015] The method for identifying or assisting in the identification of boar sperm motility protected by this invention may specifically be method B2, which may include the following steps:

[0016] B2-1) Using the genomic DNA of the boar to be tested as a template, PCR amplification was performed using a primer pair consisting of upstream primer 1F and downstream primer 1R to obtain PCR amplification product 1. The PCR amplification product 1 was sequenced, and then the following judgments were made: if the 491st position of PCR amplification product 1 is only C, then the genotype of the boar to be tested based on the SNP2 site is CC homozygous; if the 491st position of PCR amplification product 1 is both C and T, then the genotype of the boar to be tested based on the SNP2 site is CT heterozygous; if the 491st position of PCR amplification product 1 is only T, then the genotype of the boar to be tested based on the SNP2 site is TT homozygous.

[0017] B2-2) Based on the results of B2-1), the following judgment is made: the sperm motility of boars with a genotype of CC homozygous or CT heterozygous based on the SNP2 locus is greater than that of boars with a genotype of TT homozygous based on the SNP2 locus.

[0018] In the above method, the SNP2 site is specifically the nucleotide at position 491 from the 5' end of SEQ ID NO: 1 in the boar genome.

[0019] In the above method, the upstream primer 1F is specifically the single-stranded DNA molecule shown in SEQ ID NO:2.

[0020] In the above method, the downstream primer 1R is specifically the single-stranded DNA molecule shown in SEQ ID NO:3.

[0021] The method for identifying or assisting in the identification of boar sperm motility protected by this invention may specifically be method B3, which may include the following steps:

[0022] B3-1) Using the genomic DNA of the boar to be tested as a template, PCR amplification was performed using a primer pair consisting of upstream primer 2F and downstream primer 2R to obtain PCR amplification product 2. The PCR amplification product 2 was sequenced, and then the following judgments were made: if the 285th position of the PCR amplification product 2 is only G, then the genotype of the boar to be tested based on the SNP3 site is GG homozygous; if the 285th position of the PCR amplification product 2 is both G and A, then the genotype of the boar to be tested based on the SNP3 site is GA heterozygous; if the 285th position of the PCR amplification product 2 is only A, then the genotype of the boar to be tested based on the SNP3 site is AA homozygous.

[0023] B3-2) Based on the results of B3-1), the following judgment is made: the sperm motility of boars with a genotype of GG homozygous or GA heterozygous based on the SNP3 locus is greater than that of boars with a genotype of AA homozygous based on the SNP3 locus.

[0024] In the above method, the SNP3 site is specifically the nucleotide at position 285 from the 5' end of SEQ ID NO:4 in the boar genome.

[0025] In the above method, the upstream primer 2F is specifically the single-stranded DNA molecule shown in SEQ ID NO:5.

[0026] In the above method, the downstream primer 2R is specifically the single-stranded DNA molecule shown in SEQ ID NO:6.

[0027] In any of the methods described above, sperm motility can be the ratio of the number of progressively motile sperm to the total number of sperm. The number of progressively motile sperm and the total number of sperm can be determined by placing a microscope stage connected to a computer-aided sperm analysis (CASA) system.

[0028] The present invention also protects a kit for identifying boar sperm motility, which may include substances for detecting the genotype of the boar based on the SNP1 locus, substances for detecting the genotype of the boar based on the SNP2 locus, and / or substances for detecting the genotype of the boar based on the SNP3 locus.

[0029] The SNP1 site is the nucleotide at position 183 from the 5' end of SEQ ID NO: 1 in the boar genome;

[0030] The SNP2 site is the 491st nucleotide from the 5' end of SEQ ID NO: 1 in the boar genome;

[0031] The SNP2 site is the nucleotide at position 285 from the 5' end of SEQ ID NO:4 in the boar genome.

[0032] The kit may specifically consist of substances for detecting the genotype of the boar under test based on the SNP1 locus, substances for detecting the genotype of the boar under test based on the SNP2 locus, and / or substances for detecting the genotype of the boar under test based on the SNP3 locus.

[0033] In any of the above-described kits, the "substance for detecting the genotype of the boar based on the SNP1 site" or the "substance for detecting the genotype of the boar based on the SNP2 site" can be a primer pair consisting of upstream primer 1F and downstream primer 1R.

[0034] The upstream primer 1F is the single-stranded DNA molecule shown in SEQ ID NO:2;

[0035] The downstream primer 1R is a single-stranded DNA molecule as shown in SEQ ID NO:3.

[0036] In any of the above-described kits, the "substance for detecting the genotype of the boar based on the SNP3 site" can be a primer pair consisting of upstream primer 2F and downstream primer 2R;

[0037] The upstream primer 2F is a single-stranded DNA molecule as shown in SEQ ID NO:5;

[0038] The downstream primer 2R is a single-stranded DNA molecule as shown in SEQ ID NO:6.

[0039] The substances described above for detecting the genotype of boars based on the SNP1 locus, the substances described above for detecting the genotype of boars based on the SNP2 locus, or the substances described above for detecting the genotype of boars based on the SNP3 locus can also be used to determine the nucleotide types of the SNP1, SNP2, and / or SNP3 loci in the boar genome through at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP microarrays. The SNP microarrays include microarrays based on nucleic acid hybridization reactions, microarrays based on single-base extension reactions, microarrays based on allele-specific primer extension reactions, microarrays based on one-step reactions, microarrays based on primer ligation reactions, microarrays based on restriction endonuclease reactions, microarrays based on protein-DNA binding reactions, and / or microarrays based on fluorescent molecule-DNA binding reactions.

[0040] In any of the kits described above, sperm motility can be the ratio of the number of progressively motile sperm to the total number of sperm. The number of progressively motile sperm and the total number of sperm can be determined by placing a microscope stage connected to a computer-aided sperm analysis (CASA) system.

[0041] This invention also protects molecular markers, which may be molecular marker A shown in SEQ ID NO: 1 and / or molecular marker B shown in SEQ ID NO: 4.

[0042] The application of any of the above-described reagent kits or molecular markers in identifying boar sperm motility also falls within the scope of protection of this invention.

[0043] The application of any of the above-described reagent kits or molecular markers in screening boars with different sperm motility is also within the scope of protection of this invention.

[0044] In any of the above-described applications, sperm motility can be the ratio of the number of progressively motile sperm to the total number of sperm. The number of progressively motile sperm and the total number of sperm can be determined using a microscope stage placed on a computer-aided sperm analysis (CASA) system.

[0045] The application of any of the above-described kits or molecular markers in identifying boar genotypes is also within the scope of protection of this invention.

[0046] The application of any of the aforementioned reagent kits or molecular markers in boar breeding also falls within the scope of this invention. The goal of boar breeding can be to cultivate boar breeds with excellent sperm quality, where sperm quality refers to sperm motility. Boars with sperm motility >80% are considered to have excellent sperm quality.

[0047] The boar mentioned above can specifically be a Large White boar.

[0048] The ">" mentioned above can specifically refer to the statistical meaning of ">".

[0049] The sperm motility described above can be fresh sperm motility and / or frozen sperm motility.

[0050] Experiments have shown that the method provided in this invention, by detecting the genotypes of boars based on SNP1, SNP2, and / or SNP3 loci, can identify or assist in identifying boar sperm motility traits: Sperm motility in Large White boars with a genotype of AA homozygous or AC heterozygous based on SNP1 locus > Sperm motility in Large White boars with a genotype of CC homozygous based on SNP1 locus; Sperm motility in Large White boars with a genotype of CC homozygous or CT heterozygous based on SNP2 locus > Sperm motility in Large White boars with a genotype of TT homozygous based on SNP2 locus > Sperm motility in Large White boars with a genotype of GG homozygous or GA heterozygous based on SNP3 locus > Sperm motility in Large White boars with a genotype of AA homozygous based on SNP3 locus; SNP1 locus is the nucleotide at position 183 from the 5' end of SEQ ID NO: 1 in the boar genome; SNP2 ... NO: 1 is the 491st nucleotide from the 5' end; SNP3 is the 285th nucleotide from the 5' end of SEQ ID NO: 4 in the boar genome. The method provided by this invention is suitable for large-scale population detection and has important application value in boar molecular marker-assisted breeding. Attached Figure Description

[0051] Figure 1 This is a partial sequencing result of a Large White boar based on the SNP1 locus in step one of Example 3. A represents AA homozygous, B represents AC heterozygous, and C represents CC homozygous.

[0052] Figure 2 This is a partial sequencing result of a Large White boar based on the SNP2 locus in step one of Example 3. A represents the CC homozygous genotype, B the CT heterozygous genotype, and C the TT homozygous genotype.

[0053] Figure 3 This is a partial sequencing result of a Large White boar based on the SNP3 locus in step one of Example 3. A represents the GG homozygous genotype, B represents the GA heterozygous genotype, and C represents the AA homozygous genotype. Detailed Implementation

[0054] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0055] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0056] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.

[0057] Example 1: Discovery of three SNP sites in the Large White pig genome and acquisition of primer pairs for identifying the three SNP sites.

[0058] I. Discovery of 3 SNP loci in the Large White pig genome

[0059] The inventors of this application conducted extensive sequence analysis, alignment, and preliminary experiments on the genome of the Large White pig, and discovered three SNP sites in the Large White pig genome. The three SNP loci were named SNP1 (also known as A183C locus, the 183rd nucleotide from the 5' end of SEQ ID NO: 1 in the Large White pig genome, located at position 98280702 on chromosome 6 of pig, with genotypes of AA homozygous, CC homozygous, or AC heterozygous), SNP2 (also known as C491T SNP locus, the 491st nucleotide from the 5' end of SEQ ID NO: 1 in the Large White pig genome, located at position 98281010 on chromosome 6 of pig, with genotypes of CC homozygous, TT homozygous, or CT heterozygous), and SNP3 (also known as G285A locus, the 285th nucleotide from the 5' end of SEQ ID NO: 4 in the Large White pig genome, located at position 98281455 on chromosome 6 of pig, with genotypes of GG homozygous, AA homozygous, or GA heterozygous).

[0060] SEQ ID NO:1:

[0061] CACCCCCTCCTCAGTAACAAGCTCCTACTCTCTTAGGACGTTTCACACACAGAGTATTATTTTACTAAGGGAGCATGTCCTGGTGTCATTTCTAGGGAAACACATGTCCTAGAGGATGTTTAATCTAAAAATTGTAGGGCAAACTTCTAATAATATCAATTAATAATAGGTTACAGGAAAGCMAGCCAGAAGGAGTACCAGCACTGTAAGATTCTAGGATGCCCCCCTACCCCCACCCCACTCCTGCAAACTGCAAAATCAGAGAAAGTGTTTTAGAAGATGCCAAGCGTGGGGAGGTGGGTACCAAGGTTGACCAGAGGTCTAGCCTTGGAAACCTGCCTTTTCAGATTCCCTGTCTGCTAAGTTAATTCAAGATGTCTGGATCCAGTGGAAGGAAAAGTAAAGGAAGAAAAGCTTTTCCCATTGAAAATTCAAAACCTGTTTCCATTTTAATGTTCATAAAAACCTGGGATCAAGAAGCAGTTGGTTCYCCATGAGAACTCCTACTTGGGGATGATGGTTCTTAGAGGATATTGGGATGGGTGCCCTTTGTGGGGACTGGGAGATAGTTATCACCCAGCATGGTGACAGGGCCAGTTGGTACCTTCAAGGCTCAGCAAACCTTAATTGAAAACCTACAATGTAAAAATCAGGAATGAGGTCAGAAGCTGATTAAAGACCTGGAACTCTCCATAACTCTGAGAGCCGTGCTTCAGAGTCCTGTGGTG (M is A or C, Y is C or T)

[0062] SEQ ID NO:4:

[0063] GCTTGTTACTGAGGAGGGGGTGTGAATCAGATGGTTCTCGGAATAATATTTATGTCCCCACCTGCCACTGCTCACACAGGAGCCACTCCAAGGACATCCAAAACAGGACTAAATCCCAGAATGACATGAAATATTTTAGTCAGATTTGGTTGGTTTGCATATATGGCCAAAACTTAAAGGAATGTTCCCCAAGTAAAGGTCAGAGATGTAGACAATAGTCCCTAATACATGGGTCCCTCTTTCACAACAGCCCAGGT CTGCAGCCCATCATCCAACCGCCCTRCACCGATCGGTCAATTAACTTTCCGTGAAGGTTGCTTAGGTACTAAGGCAATGCGCTGAAGAGGTTCTTGAAATTTGGTTAGAAACATAGGAAATCAGAGTGG AAGAATGTTTTAGAATCTCACATATATATAAGTCAGTAAGACTTTTGCACAAATGTAAGAACATTTTACGGTTTTTAACAAAAAAACTCTACTTAATACCTAATAGCCGTTCCCTCCAAATGC (R is A or G)

[0064] Since genomic DNA is a double-stranded DNA molecule composed of two single-stranded DNA molecules that are antisense complements, the DNA molecule that encodes proteins is generally called the sense DNA molecule; the DNA molecule that is antisense complement to the sense DNA molecule is called the antisense DNA molecule. The genotype at all loci is the genotype of the sense DNA molecule.

[0065] II. Obtaining primer pairs for identifying three SNP sites

[0066] Based on the SNP1 and SNP2 sites and their preceding and following nucleotide sequences, primer pair 1 was designed and synthesized for identifying the SNP1 and SNP2 sites. Primer pair 1 consists of an upstream primer 1F and a downstream primer 1R, and is used to amplify target sequences including the SNP1 and SNP2 sites.

[0067] Primer pair 2, designed and synthesized based on the SNP3 site and its preceding and following nucleotide sequences, was used to identify the SNP3 site. Primer pair 2 consists of an upstream primer 2F and a downstream primer 2R, and is used to amplify the target sequence including the SNP3 site.

[0068] The nucleotide sequences of upstream primer 1F, downstream primer 1R, upstream primer 2F, and downstream primer 2R are shown in Table 1.

[0069]

[0070] Example 2: Establishment of a genotyping method for Large White boars based on 3 SNP loci

[0071] I. Establishment of a Genotyping Method for Large White Boars Based on SNP1 Locus

[0072] 1. Extract genomic DNA from the semen of the male Large White pigs to be tested.

[0073] 2. Using the genomic DNA of the semen of the male Large White pig to be tested as a template, PCR amplification was performed using primer pair 1 consisting of upstream primer 1F and downstream primer 1R to obtain PCR amplification product 1.

[0074] The reaction system consisted of 25 µl of genomic DNA from boar semen of Large White pigs (50 ng / µL), 1 µL of upstream primer 1F aqueous solution (10 pmol / µL), 1 µL of downstream primer 1R aqueous solution (10 pmol / µL), 2.0 µL of dNTP mix (10 mmol / L), 0.125 µL of Taq DNA polymerase (5 U / µL), 2.5 µL of 10×PCR reaction buffer, and water. The Taq DNA polymerase was a product of Takara Bio Inc., catalog number RR001Q. The 10×PCR reaction buffer and dNTP mix were components of the Taq DNA polymerase.

[0075] The reaction conditions were: 94℃ for 30s; 98℃ for 10s, 55℃ for 30s, 72℃ for 60s, 35 cycles; 72℃ for 2min.

[0076] 3. After completing step 2, sequence the PCR amplification product 1. Based on the sequencing results, determine the genotype of the male Large White pigs tested, based on the SNP1 locus. The specific determination principles are as follows:

[0077] If the PCR amplification product 1 of the male Large White pig being tested has only A at position 183, then the genotype of the male Large White pig being tested based on SNP1 is AA homozygous.

[0078] If the PCR amplification product 1 of the male Large White pig being tested has only C at position 183, then the genotype of the male Large White pig being tested based on the SNP1 site is CC homozygous.

[0079] If the PCR amplification product 1 of the male Large White pig being tested contains A and C at position 183, then the genotype of the male Large White pig being tested based on the SNP1 site is AC heterozygous.

[0080] II. Establishment of a Genotyping Method for Large White Boars Based on SNP2 Loci

[0081] 1. Extract genomic DNA from the semen of the male Large White pigs to be tested.

[0082] 2. Using the genomic DNA of the semen of the male Large White pig to be tested as a template, PCR amplification was performed using primer pair 1 consisting of upstream primer 1F and downstream primer 1R to obtain PCR amplification product 1.

[0083] The reaction system consisted of 25 µl of genomic DNA from boar semen of the Large White pig to be tested (concentration 50 ng / µL), 1 µL of upstream primer 1F aqueous solution (concentration 10 pmol / µL), 1 µL of downstream primer 1R aqueous solution (concentration 10 pmol / µL), 2.0 µL of dNTP mix (concentration 10 mmol / L), 0.125 µL of Taq DNA polymerase (concentration 5 U / µL), 2.5 µL of 10×PCR reaction buffer, and water.

[0084] The reaction conditions were: 94℃ for 30s; 98℃ for 10s, 55℃ for 30s, 72℃ for 60s, 35 cycles; 72℃ for 2min.

[0085] 3. After completing step 2, sequence the PCR amplification product 1. Based on the sequencing results, determine the genotype of the male Large White pigs tested, based on the SNP2 site. The specific determination principles are as follows:

[0086] If the PCR amplification product 1 of the male Large White pig being tested has only C at position 491, then the genotype of the male Large White pig being tested based on the SNP2 site is CC homozygous.

[0087] If the PCR amplification product 1 of the male Large White pig being tested has only T at position 491, then the genotype of the male Large White pig being tested based on the SNP2 site is TT homozygous.

[0088] If the PCR amplification product 1 of the male Large White pig being tested contains C and T at position 491, then the genotype of the male Large White pig being tested based on the SNP2 site is CT heterozygous.

[0089] III. Establishment of a Genotyping Method for Large White Boars Based on SNP3 Loci

[0090] 1. Extract genomic DNA from the semen of the male Large White pigs to be tested.

[0091] 2. Using the genomic DNA of boar semen from the Large White pig to be tested as a template, PCR amplification was performed using primer pair 2 consisting of upstream primer 2F and downstream primer 2R to obtain PCR amplification product 2.

[0092] The reaction system consisted of 25 µl of genomic DNA from boar semen of Large White pigs (50 ng / µL), 1 µL of upstream primer 2F aqueous solution (10 pmol / µL), 1 µL of downstream primer 2R aqueous solution (10 pmol / µL), 2.0 µL of dNTP mix (10 mmol / L), 0.125 µL of Taq DNA polymerase (5 U / µL), 2.5 µL of 10×PCR reaction buffer, and water.

[0093] The reaction conditions were: 94℃ for 30s; 98℃ for 10s, 55℃ for 30s, 72℃ for 60s, 35 cycles; 72℃ for 2min.

[0094] 3. After completing step 2, sequence the PCR amplification product 2. Based on the sequencing results, determine the genotype of the male Large White pigs tested based on the SNP3 locus. The specific determination principles are as follows:

[0095] If the PCR amplification product 2 of the male Large White pig being tested contains only G at position 285, then the genotype of the male Large White pig being tested based on SNP3 is GG homozygous.

[0096] If the PCR amplification product 2 of the male Large White pig being tested has only A at position 285, then the genotype of the male Large White pig being tested based on SNP3 is AA homozygous.

[0097] If the PCR amplification product 2 of the male Large White pig being tested contains G and A at position 285, then the genotype of the male Large White pig being tested based on the SNP3 site is GA heterozygous.

[0098] Example 3: Association analysis of genotype and sperm motility in Large White boars based on three SNP loci.

[0099] The semen samples (all fresh semen) from the 105 Large White boars in this embodiment were all provided by Henan Jingwang Boar Station and came from different Large White pigs. All the Large White boars that provided the semen samples were raised to sexual maturity under normal nutritional levels and feeding conditions.

[0100] I. Genotyping of 105 Large White male pigs based on 3 SNP loci

[0101] Following the method in Example 2, the semen samples of the large white boars to be tested were replaced with semen samples from 105 large white boars, with all other steps remaining unchanged, to obtain the genotypes of the 105 large white boars based on the SNP1 locus.

[0102] Following the method in Example 2, the semen samples of the large white boars to be tested were replaced with semen samples from 105 large white boars, with all other steps remaining unchanged, to obtain the genotypes of the 105 large white boars based on the SNP2 locus.

[0103] Following the method in Example 2, the semen samples of the large white boars to be tested were replaced with semen samples from 105 large white boars, with all other steps remaining unchanged, to obtain the genotypes of the 105 large white boars based on the SNP3 locus.

[0104] Partial sequencing results can be found Figures 1-3 .

[0105] Table 2 shows the genotypic counts and frequencies of 105 Large White male pigs based on three SNP loci. Based on SNP1, the allele frequency of A was 0.829, and the allele frequency of C was 0.171. Based on SNP2, the allele frequency of C was 0.838, and the allele frequency of T was 0.162. Based on SNP3, the allele frequency of G was 0.852, and the allele frequency of A was 0.148.

[0106]

[0107] II. Testing the sperm motility of 105 Large White boars

[0108] The experiment was repeated three times, and the average result was taken. Each semen sample was tested according to the following steps each time:

[0109] 1. Take a semen sample and dilute it with physiological saline to obtain a semen diluent;

[0110] 2. Place 20 μL of semen dilution solution onto a glass slide, then place it on the microscope stage connected to a computer-aided sperm analysis (CASA) system to determine the number of progressively motile sperm and the total number of sperm to obtain sperm motility;

[0111] Sperm motility = (Number of progressively motile sperm / Total sperm count) × 100%

[0112] Semen samples with sperm motility >80% were grouped into the high semen quality group, i.e., group H.

[0113] Semen samples with sperm motility <80% were grouped into the low semen quality group, i.e., group L.

[0114] The results showed that group H consisted of semen samples from 69 Large White boars, and the average sperm motility of group H was above 94%; group L consisted of semen samples from 36 Large White boars, and the average sperm motility of group L was below 65%.

[0115] It should be noted that, since the proportion of Large White boars with low sperm motility (i.e., low semen quality) in the population is relatively low, the Large White boars in the low semen quality group, consisting of semen samples from 36 Large White boars, were gradually collected from a population of more than 300 Large White boars.

[0116] III. Association Analysis of Genotype and Sperm Motility in Large White Boars Based on Three SNP Loci

[0117] Association analysis was performed on the genotypes of 105 Large White boars obtained in step one, based on three SNP loci, using SPSS 27 software, specifically a chi-square test. The test results are shown in Tables 3-5.

[0118]

[0119] Note: P The value represents the significance level of the chi-square test, with ** indicating that the difference in sperm motility between different genotypes is extremely significant. P <0.01).

[0120]

[0121] Note: P The value represents the significance level of the chi-square test, with ** indicating that the difference in sperm motility between different genotypes is extremely significant. P <0.01).

[0122]

[0123] Note: P The value represents the significance level of the chi-square test, and * indicates that there is a significant difference in sperm motility among different genotypes. P <0.05).

[0124] The results showed that SNP1, SNP2, and SNP3 were all significantly associated with sperm motility in Large White boars; specifically as follows:

[0125] Sperm motility in large white boars with genotypes of AA homozygous or AC heterozygous based on SNP1 locus is greater than that in large white boars with genotypes of CC homozygous based on SNP1 locus. For the sperm motility trait in large white boars, based on SNP1 locus, the dominant allele is A, and the superior genotype is AA homozygous or AC heterozygous.

[0126] Sperm motility in Large White boars with genotypes of CC homozygous or CT heterozygous based on SNP2 loci is greater than that in Large White boars with genotypes of TT homozygous based on SNP2 loci. For the sperm motility trait in Large White boars, based on SNP2 loci, the dominant allele is C, and the superior genotype is CC homozygous or CT heterozygous.

[0127] Sperm motility in Large White boars with genotypes of GG homozygous or GA heterozygous based on SNP3 loci is greater than that in Large White boars with genotypes of AA homozygous based on SNP3 loci. For the sperm motility trait in Large White boars, based on SNP3 loci, the dominant allele is G, and the superior genotype is GG homozygous or GA heterozygous.

[0128] The above ">" all refer to statistically significant values ​​(i.e., significantly higher than at the 0.05 level).

[0129] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Methods for determining boar sperm motility include method A1), method A2), or method A3). Method A1) includes the following steps: detecting whether the genotype of the boar to be tested based on the SNP1 locus is homozygous AA, heterozygous AC, or homozygous CC, and then making the following judgment: the sperm motility of boars with a genotype of homozygous AA or heterozygous AC based on the SNP1 locus is greater than that of boars with a genotype of homozygous CC based on the SNP1 locus; the SNP1 locus is the nucleotide at position 183 from the 5' end of SEQ ID NO: 1 in the boar genome; Method A2) includes the following steps: detecting whether the genotype of the boar to be tested based on the SNP2 locus is CC homozygous, CT heterozygous, or TT homozygous, and then making the following judgment: the sperm motility of boars with a genotype of CC homozygous or CT heterozygous based on the SNP2 locus is greater than that of boars with a genotype of TT homozygous based on the SNP2 locus; the SNP2 locus is the nucleotide at position 491 from the 5' end of SEQ ID NO: 1 in the boar genome; Method A3) includes the following steps: detecting whether the genotype of the boar to be tested based on the SNP3 locus is GG homozygous, GA heterozygous, or AA homozygous, and then making the following judgment: the sperm motility of boars with a genotype of GG homozygous or GA heterozygous based on the SNP3 locus is greater than that of boars with a genotype of AA homozygous based on the SNP3 locus; the SNP3 locus is the nucleotide at position 285 from the 5' end of SEQ ID NO: 4 in the boar genome; The boar in question is a Large White boar.

2. Methods for determining boar sperm motility include method B1), method B2), or method B3). Method B1) includes the following steps: B1-1) Using the genomic DNA of the boar to be tested as a template, PCR amplification was performed using a primer pair consisting of upstream primer 1F and downstream primer 1R to obtain PCR amplification product 1. The PCR amplification product 1 was sequenced, and then the following judgments were made: if the 183rd position of PCR amplification product 1 is only A, then the genotype of the boar to be tested based on the SNP1 site is AA homozygous; if the 183rd position of PCR amplification product 1 is both A and C, then the genotype of the boar to be tested based on the SNP1 site is AC heterozygous; if the 183rd position of PCR amplification product 1 is only C, then the genotype of the boar to be tested based on the SNP1 site is CC homozygous. B1-2) Based on the results of B1-1), the following judgment is made: the sperm motility of boars with genotypes of AA homozygous or AC heterozygous based on the SNP1 locus is greater than that of boars with genotypes of CC homozygous based on the SNP1 locus. Method B2) includes the following steps: B2-1) Using the genomic DNA of the boar to be tested as a template, PCR amplification was performed using a primer pair consisting of upstream primer 1F and downstream primer 1R to obtain PCR amplification product 1. The PCR amplification product 1 was sequenced, and then the following judgments were made: if the 491st position of PCR amplification product 1 is only C, then the genotype of the boar to be tested based on the SNP2 site is CC homozygous; if the 491st position of PCR amplification product 1 is both C and T, then the genotype of the boar to be tested based on the SNP2 site is CT heterozygous; if the 491st position of PCR amplification product 1 is only T, then the genotype of the boar to be tested based on the SNP2 site is TT homozygous. B2-2) Based on the results of B2-1), the following judgment is made: the sperm motility of boars with a genotype of CC homozygous or CT heterozygous based on the SNP2 locus is greater than that of boars with a genotype of TT homozygous based on the SNP2 locus. Method B3) includes the following steps: B3-1) Using the genomic DNA of the boar to be tested as a template, PCR amplification was performed using a primer pair consisting of upstream primer 2F and downstream primer 2R to obtain PCR amplification product 2. The PCR amplification product 2 was sequenced, and then the following judgments were made: if the 285th position of the PCR amplification product 2 is only G, then the genotype of the boar to be tested based on the SNP3 site is GG homozygous; if the 285th position of the PCR amplification product 2 is both G and A, then the genotype of the boar to be tested based on the SNP3 site is GA heterozygous; if the 285th position of the PCR amplification product 2 is only A, then the genotype of the boar to be tested based on the SNP3 site is AA homozygous. B3-2) Based on the results of B3-1), the following judgment is made: the sperm motility of boars with a genotype of GG homozygous or GA heterozygous based on the SNP3 locus is greater than that of boars with a genotype of AA homozygous based on the SNP3 locus. The SNP1 site is the nucleotide at position 183 from the 5' end of SEQ ID NO: 1 in the boar genome; The SNP2 site is the 491st nucleotide from the 5' end of SEQ ID NO: 1 in the boar genome; The SNP3 site is the nucleotide at position 285 from the 5' end of SEQ ID NO:4 in the boar genome; The upstream primer 1F is the single-stranded DNA molecule shown in SEQ ID NO:2; The downstream primer 1R is the single-stranded DNA molecule shown in SEQ ID NO:3; The upstream primer 2F is a single-stranded DNA molecule as shown in SEQ ID NO:5; The downstream primer 2R is the single-stranded DNA molecule shown in SEQ ID NO:6; The boar in question is a Large White boar.

3. The application of substances for detecting the genotype of male Large White pigs based on SNP1, SNP2, and / or SNP3 in the identification of sperm motility in Large White pigs. The SNP1 site is the nucleotide at position 183 from the 5' end of SEQ ID NO: 1 in the genome of a large white boar; The SNP2 site is the 491st nucleotide from the 5' end of SEQ ID NO: 1 in the genome of a large white boar; The SNP3 site is the nucleotide at position 285 from the 5' end of SEQ ID NO:4 in the genome of a Large White boar.

4. Application of substances for detecting the genotype of male Large White pigs based on SNP1 locus, substances for detecting the genotype of male Large White pigs based on SNP2 locus, and / or substances for detecting the genotype of male Large White pigs based on SNP3 locus in screening male Large White pigs with different sperm motility. The SNP1 site is the nucleotide at position 183 from the 5' end of SEQ ID NO: 1 in the genome of a large white boar; The SNP2 site is the 491st nucleotide from the 5' end of SEQ ID NO: 1 in the genome of a large white boar; The SNP3 site is the nucleotide at position 285 from the 5' end of SEQ ID NO:4 in the genome of a Large White boar.

5. The application of substances for detecting the genotype of the Large White boar based on the SNP1 locus, substances for detecting the genotype of the Large White boar based on the SNP2 locus, and / or substances for detecting the genotype of the Large White boar based on the SNP3 locus in the breeding of Large White boar sperm motility. The SNP1 site is the nucleotide at position 183 from the 5' end of SEQ ID NO: 1 in the genome of a large white boar; The SNP2 site is the 491st nucleotide from the 5' end of SEQ ID NO: 1 in the genome of a large white boar; The SNP3 site is the nucleotide at position 285 from the 5' end of SEQ ID NO:4 in the genome of a Large White boar.

6. The application according to any one of claims 3 to 5, characterized in that: The substance used to detect the genotype of the male Large White pig based on the SNP1 site or the substance used to detect the genotype of the male Large White pig based on the SNP2 site is a primer pair consisting of upstream primer 1F and downstream primer 1R. The substance used to detect the genotype of the male Large White pig based on the SNP3 site is a primer pair consisting of upstream primer 2F and downstream primer 2R; The upstream primer 1F is the single-stranded DNA molecule shown in SEQ ID NO:2; The downstream primer 1R is the single-stranded DNA molecule shown in SEQ ID NO:3; The upstream primer 2F is a single-stranded DNA molecule as shown in SEQ ID NO:5; The downstream primer 2R is a single-stranded DNA molecule as shown in SEQ ID NO:

6.

7. Application of molecular marker A shown in SEQ ID NO: 1 and / or molecular marker B shown in SEQ ID NO: 4 in the identification of sperm motility in large white boars.

8. Application of molecular marker A shown in SEQ ID NO: 1 and / or molecular marker B shown in SEQ ID NO: 4 in screening Large White boars with different sperm motility.

9. Application of molecular marker A shown in SEQ ID NO: 1 and / or molecular marker B shown in SEQ ID NO: 4 in breeding Large White boar sperm motility.

Citation Information

Patent Citations

  • Molecular genetic marker related to boar sperm motility and its application and acquisition method thereof

    CN110195116A

  • Molecular marker related to semen quality traits of large white pigs and duroc pigs and application of molecular marker

    CN116515968A