Plant extract composition with prevention and treatment effects on porcine diarrhea

Abstract

The invention provides a plant extract composition with prevention and treatment effects on porcine diarrhea. The composition comprises a mulberry leaf extract, polypeptide with an amino acid sequence of SEQ ID NO: 1 and tandem polypeptide formed by connecting the polypeptide in series. The invention further provides application of the plant extract composition in preparation of feed for preventing and treating porcine diarrhea. The plant extract composition provided by the invention can be used for remarkably relieving diarrhea symptoms of diseased plants and improving the oxidation resistance of diarrhea pigs.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and in particular relates to a plant extract composition having preventive and therapeutic effects on pig diarrhea. Background Art

[0002] Swine diarrhea is a common swine disease, and its basic characteristic is yellow and white diarrhea. It is a common clinical phenomenon caused by various reasons or accompanied by various diseases. The symptoms of swine diarrhea vary depending on the cause, but generally manifest as yellow and white diarrhea, watery diarrhea, vomiting, dehydration, etc. For example, the clinical characteristics of porcine infectious gastroenteritis and epidemic diarrhea are watery diarrhea, vomiting and dehydration; while yellow and white diarrhea in piglets is characterized by the discharge of yellow, white or yellow and white feces. The causes of swine diarrhea are varied, mainly including viral infection, bacterial infection, parasitic infection, nutritional causes and environmental factors.

[0003] Pig diarrhea caused by bacteria is a common disease in the pig farming industry. There are many types of pathogens, mainly including pathogenic Escherichia coli, Salmonella, Clostridium perfringens type C, etc. These bacteria adsorb to the epithelial cells of the small intestine through colonization factors, secrete enterotoxins, cause electrolyte disorders, lead to diarrhea and even dehydration. Symptoms of bacterial pig diarrhea include diarrhea, dehydration, loss of appetite, weight loss, etc. In severe cases, it may lead to the death of pigs, causing great economic losses to the pig farming industry. During the treatment process, due to the widespread use of antibiotics and selection pressure, some bacteria gradually develop drug resistance and form drug-resistant bacteria. The emergence of drug-resistant bacteria reduces or ineffective the effect of conventional antibiotic treatment, resulting in a prolonged course of disease, increased treatment costs and increased mortality. This not only poses a great challenge to treatment, but also exacerbates the spread and prevalence of bacterial diseases.

[0004] Plant extracts refer to substances extracted or processed from plants (all or part of plants) using appropriate solvents or methods. Bioactive substances such as polysaccharides, organic acids, alkaloids and volatile oils in plant extracts can promote the development of immune organs, enhance the phagocytic function of phagocytes, induce the proliferation of lymphocytes and spleen T cells, and improve the bactericidal activity of NK cells, thereby enhancing the body's immunity and reducing the occurrence of diseases. Flavonoids, alkaloids, etc. have inhibitory effects on a variety of bacteria and viruses, can directly inhibit and kill pathogens, and reduce the risk of infection by pathogenic microorganisms. Prebiotic substances in plant extracts, such as oligosaccharides and oligosaccharides, can improve the microbial flora in the digestive tract, inhibit the growth of harmful bacteria, selectively stimulate the proliferation of beneficial intestinal bacteria such as lactic acid bacteria, and form the best intestinal microecological environment. For example, poplar flower extract has the effects of clearing away heat and detoxification, astringing the intestines and stopping diarrhea, removing dampness and stopping dysentery, and strengthening the spleen and stomach. It contains flavonoids, phytohemagglutinins, organic acids, alkaloids and other ingredients, which have inhibitory effects on a variety of bacteria, and can quickly repair the intestinal mucosa and improve intestinal health. Eucommia leaf extract is a natural, environmentally friendly, safe, non-toxic and green feed additive produced using eucommia leaves as raw materials and modern advanced extraction technology. It can improve the anti-stress ability of piglets, improve the growth performance of weaned piglets, reduce the diarrhea rate of weaned piglets, and increase the survival rate of weaned piglets. Although plant extracts have attracted much attention due to their natural sources and diverse antibacterial mechanisms, their effects are often not ideal in the treatment of drug-resistant strains, because drug-resistant strains usually have complex resistance mechanisms and strong survival abilities, while the antibacterial active ingredients and mechanisms of action of plant extracts are relatively limited, making it difficult to completely overcome the resistance of drug-resistant strains. Summary of the invention

[0005] The purpose of the present invention is to provide a plant extract composition having a preventive and therapeutic effect on pig diarrhea, which can effectively prevent and treat pig diarrhea caused by various pathogenic bacteria.

[0006] The present invention first provides a mulberry leaf extract, wherein the plant extract is obtained by grinding the mulberry leaves into pulp, filtering and discarding crude fibers, adding an ethanol solution to the filtrate for extraction, concentrating and freeze-drying the extract, dissolving the precipitate with water, filtering the dissolved solution, and obtaining the filtrate as the plant extract;

[0007] The present invention also provides a polypeptide ImmunePEP-05-a, whose sequence is YQEPILGPV (SEQ ID NO: 1);

[0008] The present invention also provides a feed additive, which comprises the plant extract and the polypeptide ImmunePEP-05-a or a tandem polypeptide composed of the polypeptide ImmunePEP-05-a in series;

[0009] The amino acid sequence of the tandem polypeptide is YQEPVLGPVGSGEGRGSLLTCGDVEENPGPYQEPVLGPVGSGEGRGSLLTCG DVEENPGPYQEPVLG PVGSGEGRGSLLTCGDVEENPGP (SEQ ID NO: 2).

[0010] The nucleotide sequence of its coding gene is as follows:

[0011] TACCAGGAGCCCGTGCTCGGCCCCGTGGGCAGTGGTGAAGGACGCG

[0012] GTTCGTTGTGACCTGCGGTGACGTCGAGGAGAACCCGGGTCCGTACCAG

[0013] GAGCCCGTGCTCGGCCCCGTGGGCAGTGGTGAAGGACGCGGTTCGTTGTT

[0014] GACCTGCGGTGACGTCGAGGAGAACCCGGGTCCGTACCAGGAGCCCGTG

[0015] CTCGGCCCCGTGGGCAGTGGTGAAGGACGCGTTCGTTGTTGACCTGCGG

[0016] TGACGTCGAGGAGAACCCGGGTCCG (SEQ ID NO: 3).

[0017] The tandem polypeptide is prepared by expression of an engineered strain;

[0018] The engineered strain, as specifically described in an embodiment, is a Pichia pastoris engineered strain.

[0019] In another aspect, the present invention provides a use of the feed additive, which is use in preparing feed for preventing and treating diarrhea in pigs.

[0020] Another aspect of the present invention provides a pig feed, wherein the above feed additive is added.

[0021] The invention provides a compound with a preventive and therapeutic effect on pig diarrhea, comprising a mulberry leaf extract and a modified green tea polypeptide GrTe005-a, which can significantly alleviate the diarrhea symptoms of diseased strains and improve the antioxidant performance of diarrheal pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 : Piglet feces water content chart;

[0023] Figure 2 : Average food intake of piglets;

[0024] Figure 3 : Average water intake of piglets;

[0025] Figure 4 : Gel electrophoresis of recombinant polypeptides, where M is a protein marker, lane A is the bacteria and supernatant; lane B is the purified recombinant tandem polypeptides;

[0026] Figure 5 : The antibacterial effect of each component on Escherichia coli O5 strain; A is mulberry leaf extract, B is polypeptide ImmunePEP-05, C is polypeptide ImmunePEP-05-a, and D is a recombinantly expressed tandem polypeptide.

[0027] Figure 6 :The effect of SI-a on the levels of TNF-α, IL-1β, IFN-γ and IL-4 in piglets;

[0028] Figure 7 :The effect of SI-a on SOD, CAT, MDA and MPO levels in piglets.

[0029] Figure 8 : Graph of SOD, CAT, MDA and MPO levels in piglet serum. DETAILED DESCRIPTION

[0030] The present invention is described in detail below in conjunction with specific embodiments and drawings.

[0031] Example 1: Extraction of plant extracts

[0032] 1. Preparation of mulberry leaf extract

[0033] Take fresh mulberry leaves, wash and dry them, grind them into pulp, filter them through 100 mesh, discard the crude fibers, and leave the fine mulberry leaf slurry. Add 75% ethanol solution at a liquid-to-solid ratio of 10:1, and stir and extract at room temperature for 14 hours. Filter the obtained extract to obtain a clear ethanol extract.

[0034] The ethanol extract was placed in a distillation flask, heated to boiling, and the ethanol was evaporated to concentrate the extract. The concentrated extract was freeze-dried, and 300 mg of the freeze-dried product was dissolved in 50 ml of deionized water to obtain a mulberry leaf extract solution.

[0035] The mulberry leaf extract solution was diluted to 6 different concentrations with PBS solution, so that the final concentrations of the extract were 12mg / ml, 6mg / ml, 3mg / ml, 1.5mg / ml, 0.75mg / ml, 0.375mg / ml and 0.1875mg / ml, respectively. The mixed solution with different final concentrations was added to a 96-well cell culture plate, 3 parallel samples were set for each concentration, and a PBS negative control group was set. The 96-well cell culture plate was placed in a 37°C constant temperature incubator for 12 hours, and the minimum inhibitory concentration (MIC) of the mulberry leaf extract against the pathogenic bacteria of pig diarrhea, Escherichia coli, Salmonella and Staphylococcus aureus was measured. As shown in Table 1, the mulberry leaf extract has antibacterial properties against the three bacteria related to pig diarrhea, and its antibacterial effect on Escherichia coli is the best.

[0036] Table 1: Minimum inhibitory concentration (MIC) of mulberry leaf extract

[0037] Dilution concentration 12mg / ml 6mg / ml 3mg / ml 1.5mg / ml 0.75mg / ml 0.375mg / ml 0.1875mg / ml Escherichia coli + + + + + + - salmonella + + + + + - - Staphylococcus aureus + + + + + -

[0038] 2. Effect of mulberry leaf extract on alleviating diarrhea in pigs

[0039] The purchased piglets were adaptively raised for one week and randomly divided into 5 groups, each with 10 pigs, namely normal group, model group, treatment group, high concentration mulberry leaf extract group, and low concentration mulberry leaf extract group. From the first day, except for the normal group, the remaining groups were gavaged with pathogenic concentrations of Escherichia coli (15 mg / kg) every morning for 7 consecutive days, and the normal group was replaced with distilled water. In the afternoon, the treatment group was gavaged with the same dose of bifidobacterium tetragenus live bacteria tablets (21.06 mg / kg), and the high (200 mg / kg) and low (100 mg / kg) concentration groups were gavaged with different concentrations of mulberry leaf extract for 14 days. The piglets' food intake and water intake were measured every day, and the piglets' feces were collected to determine the water content of the feces and observe the status of the piglets.

[0040] Figure 1 The following is a graph of the fecal content of each group of piglets. The comparison results show that the fecal water content of the diarrhea group is significantly higher than that of the normal group. The fecal water content of the three groups treated for diarrhea showed a significant decrease compared with the diarrhea group (p<0.05). This result shows that the applied plant extract has a positive and effective effect in reducing the water content of piglet feces.

[0041] Figure 2 and Figure 3 The results showed that compared with the normal group, the amount of food and water intake of the piglets in the diarrhea group after E. coli induction was significantly reduced. Compared with the diarrhea group, the average amount of food and water intake of the piglets increased after the intervention of mulberry leaf extract, indicating that mulberry leaf extract can help improve the diarrhea of ​​piglets.

[0042] Further experiments revealed that some individuals did not respond well to mulberry leaf extract, and some piglets developed diarrhea again. The pathogenic bacteria were analyzed again and drug-resistant Escherichia coli was found among them.

[0043] Example 2: Modification of functional polypeptides

[0044] In order to provide more comprehensive protection, the peptide (YQEPVLGPV) derived from bovine colostrum was modified using the bioinformatics tool PyMOL to improve its antibacterial effect on drug-resistant Escherichia coli. The amino acid sequence of the modified and screened peptide is YQEPILGPV, named ImmunePEP-05-a.

[0045] The drug-resistant bacteria isolated from the diarrhea of ​​sick piglets were identified as Escherichia coli O5 strains. The drug-resistant strains were inoculated into sterile liquid culture medium and cultured at an appropriate temperature until the logarithmic growth phase. Sterile saline was used to adjust the bacterial solution concentration to 10 6 CFU / mL, take 0.5mL of bacterial solution and evenly spread it on the culture dish, add 0.1μL of buffer (A), peptide ImmunePEP-05 (B), mulberry leaf extract (C) and modified peptide ImmunePEP-05-a (D) at 4 points respectively, put the culture dish into a constant temperature incubator, and culture it at 37℃ for 24h. After the culture is completed, observe and record the colony growth on each group of samples.

[0046] In order to recombinantly express the polypeptide ImmunePEP-05-a, three ImmunePEP-05 polypeptides were connected in series through T2A linker (GSGEGRGSLLTCGDVEENPGP) to form a tandem polypeptide. The amino acid sequence of the prepared tandem polypeptide is as follows:

[0047] YQEPVLGPVGSGERGSLLTCGDVEENPGPYQEPVLGPVGSGEGRGSLLTCGDVEENPGPYQEPVLGPVGSPVGSGERGSLLTCGDVEENPGP,

[0048] The nucleotide sequence of its coding gene is as follows:

[0049] TACCAGGAGCCCGTGCTCGGCCCCGTGGGCAGTGGTGAAGGACGCGGTTCGTTGTTGACCTGCGGTGACG

[0050] TCGAGGAGAACCCGGGTCCGTACCAGGAGCCCGTGCTCGGCCCCGTGGGCAGTGGTGAAGGACGCGGTT

[0051] CGTTGTTGACCTGCGGTGACGTCGAGGAGAACCCGGGTCCGTACCAGGAGCCCGTGCTCGGCCCCGTG

[0052] GGCAGTGGTGAAGGACCGGTTCGTTTGTTGACCTGCGGTGACGTCGAGGAGAACCCGGGTCCG.

[0053] After adding the restriction fragments corresponding to XhoⅠ and XbaⅠ to the 5′ and 3′ of the above-mentioned coding gene, the gene sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd. Subsequently, the synthesized fragments and the vector plasmid pPICZα-A were treated with double restriction endonucleases XhoⅠ and XbaⅠ. Next, the target gene fragment of the tandem polypeptide was inserted into the expression vector pPICZα-A. The successfully constructed positive recombinant plasmid was named pPICZα-A-Im, and sequencing verification confirmed that the target fragment had been correctly inserted.

[0054] Pick up Pichia from the glycerol stock stored at -80℃, streak on YPD plate medium, and incubate at 30℃ for 2-4 days to activate the strain. Use an inoculation loop or sterile pipette to pick up a fresh single yeast colony and inoculate it into 10mL YPD liquid medium. Incubate overnight at 28-30℃ and 250rpm.

[0055] Transfer the overnight culture to 50mL YPD liquid medium so that its initial OD600 is between 0.1 and 0.2. Cultivate at 30℃, 250-300rpm for 4-6 hours to make OD600 reach 0.6-0.8. When the OD600 of the culture reaches 0.6-0.8, centrifuge at 3000rpm for 3 minutes at room temperature, discard the supernatant, and retain the bacteria. Add an appropriate amount of Buffer A solution to resuspend the bacteria, and centrifuge again to collect the bacteria. Finally, resuspend the bacteria with an appropriate volume of Buffer A and dispense into sterile centrifuge tubes. Add an appropriate amount of DMSO to each tube and mix well.

[0056] Transformation of the recombinant plasmid is the process of introducing pPICZα-A-Im into Pichia pastoris competent cells.

[0057] Mix the linearized plasmid pPICZα-A-Im and the pre-denatured Carrier DNA evenly, add the mixed DNA sample to the Pichia competent cells, and mix gently. Incubate in a 30°C water bath for a period of time, and add an appropriate amount of transformation solution. After transformation, transfer the cells to a test tube or culture dish containing an appropriate culture medium, and resume culture at 30°C for a period of time. Screen and identify transformants by coating plates and colony PCR methods, and use a culture medium containing Zeocin resistance to screen cells that have been successfully transformed.

[0058] The screened positive recombinant Pichia cells were first inoculated on a YPDS plate containing bleomycin, and a single colony was picked and transferred to 2 mL of YPDS liquid medium containing bleomycin, and cultured at 30°C and 250r / min for 20 hours. Subsequently, PCR amplification was performed using the yeast genome as a template, and the PCR product was confirmed by 1% agarose gel electrophoresis to confirm that the antimicrobial peptide target gene had been integrated.

[0059] Next, the confirmed positive expression strain was inoculated into YPD liquid medium containing bleomycin, cultured at 30°C and 250r / min for 12h, and the bacterial solution was transferred to BMGY medium at a 1% inoculation ratio. Under the same conditions, the culture was cultured until OD600 reached 4-8, and the bacteria were collected by centrifugation (5000r / min, 3min). After the bacteria were resuspended in BMMY medium, they were induced under the same conditions, and 50ml / L ethanol was added every 24 hours. The induction lasted for 72h, and samples were taken regularly during the period. After the induction was completed, the supernatant was collected by centrifugation at 12000r / min and 4°C for 10 minutes.

[0060] The supernatant was purified by His tag column and identified by Tricine-SDS-PAGE ( Figure 4 ), confirming that the tandem polypeptide ImmunePEP-05-a was successfully expressed after ethanol induction.

[0061] The polypeptide solution was diluted to 6 different concentrations with PBS, so that the final concentrations of the polypeptide were 8mg / ml, 4mg / ml, 2mg / ml, 1mg / ml, 0.5mg / ml, 0.25mg / ml and 0.125mg / ml, respectively. The mixed solution with different final concentrations was added to a 96-well cell culture plate, and 3 parallel samples were set for each concentration, and a PBS negative control group was set. The 96-well cell culture plate was placed in a 37°C constant temperature incubator for 12 hours, and the minimum inhibitory concentration (MIC) of mulberry leaf extract against porcine diarrhea pathogens Escherichia coli, Salmonella and Staphylococcus aureus was measured. The results in Table 2 show that the recombinant polypeptide has a strong antibacterial ability against the three porcine diarrhea pathogens.

[0062] Figure 2 :Minimum inhibitory concentration (MIC) of recombinant peptide

[0063] Dilution concentration 8mg / ml 4mg / ml 2mg / ml 1mg / ml 0.5mg / ml 0.25mg / ml 0.125mg / ml Escherichia coli + + + + + + - salmonella + + + + + + - Staphylococcus aureus + + + + + -

[0064] The antibacterial effects of peptides ImmunePEP-05, ImmunePEP-05-a and tandem peptides on drug-resistant Escherichia coli 577 (ATCC 577, E.coli 577) were verified. Figure 5 The results showed that mulberry leaf extract and peptide ImmunePEP-05 had no antibacterial effect on drug-resistant Escherichia coli 577 strain, while the modified peptide ImmunePEP-05-a and tandem peptides had antibacterial effect on drug-resistant Escherichia coli 577 strain.

[0065] Example 3: Effects of mulberry leaf extract and polypeptide on piglet breeding

[0066] The purchased piglets were adaptively raised for one week and randomly divided into 5 groups, each with 10 piglets, namely the model group, the peptide ImmunePEP-05 group (group I), the tandem peptide group (group Ia), the mulberry leaf extract group (group S), and the mulberry leaf extract plus tandem peptide group (group SI-a). From the first day, the pathogenic concentration of Escherichia coli O5 strain (15 mg / kg) was gavaged every morning for 7 consecutive days. Starting from the 8th day, in the afternoon, except for the model group, each group was gavaged with the same dose of tandem peptide group or / and mulberry leaf extract for 98 days. The piglet weight was measured every day, the piglet feces were collected, the fecal water content was measured, the piglet status was observed, and the piglet serum was taken to analyze the piglet inflammatory factor index and oxidation index.

[0067] The average daily weight gain of piglets in each group during the experiment is shown in Figure 6 There was no significant difference in body weight between group I and model group (p>0.05), but there were significant differences between group S, group Ia and group SI-a and model group (p≤0.05), and the body weight of group SI-a was significantly higher than that of other groups.

[0068] Arterial blood was collected from piglets and centrifuged at 4°C, 4000 r / min for 10 min in a desktop high-speed refrigerated centrifuge. The supernatant was collected and the levels of interleukin-4 (IL-4), tumor necrosis factor-α (TNF-α), interleukin 1β (IL-1β), and interferon γ (IFN-γ) in piglet serum as well as the levels of superoxide dismutase (SOD), catalase (CAT), malondialdehyde (MDA), and myeloperoxidase (MPO) in serum were determined according to the instructions of the kit.

[0069] Cytokine levels in piglets Figure 7As shown. The levels of TNF-α, IL-1β, and IFN-γ in the SI-a group were significantly higher (p<0.05). IL-4 is an important anti-inflammatory cytokine. As can be seen from the figure, the level of IL-4 in the SI-a group was significantly increased compared with the model group (p<0.05). The above studies confirmed that E. coli O5 strain induced diarrhea and enteritis in piglets after intragastric administration, and after SI-a intervention, the intestinal inflammatory response was significantly reduced, and the anti-inflammatory effect was significantly enhanced, thereby achieving the purpose of alleviating intestinal inflammatory response.

[0070] like Figure 8 The levels of SOD, CAT, MDA, and MPO in piglet serum are shown in the figure. As shown in the figure, the levels of CAT and SOD in the model group piglets were significantly reduced, while the levels of MDA (p<0.05) and MPO (p<0.05) were significantly increased, indicating that E. coli O5 strain caused oxidative damage to the intestinal tissue of piglets. After oral administration of SG-a, the oxidation index showed an opposite trend to that of the model group. The levels of CAT and SOD in the piglets were significantly increased (p<0.05), while the levels of MDA and MPO were reduced. This research result is consistent with the in vitro antibacterial results, confirming that SI-a-treated enteritis piglets can improve the intestinal oxidative stress of piglets induced by E. coli O5 strain.

Claims

1. A mulberry leaf extract, characterized in that The mulberry leaf extract is characterized in that the mulberry leaves are ground into pulp, the crude fibers are discarded after filtering, the filtrate is added with ethanol solution for extraction, the extract is concentrated and freeze-dried to obtain a precipitate, the precipitate is dissolved with water, the dissolved solution is filtered, and the filtrate is the mulberry leaf extract.

2. Use of the mulberry leaf extract according to claim 1 in the preparation of antibacterial products.

3. A polypeptide, characterized in that The amino acid sequence of the polypeptide is SEQ ID NO:

1.

4. A feed additive, characterized in that: The feed additive comprises the mulberry leaf extract according to claim 1 and the polypeptide according to claim 3 or a tandem polypeptide composed of the polypeptides according to claim 3 connected in series.

5. The feed additive according to claim 4, characterized in that The amino acid sequence of the tandem polypeptide is SEQ ID NO:

2.

6. The feed additive according to claim 5, characterized in that The nucleotide sequence of the gene encoding the tandem polypeptide is SEQ ID NO:

3.

7. The feed additive according to claim 4, characterized in that The tandem polypeptides are prepared by expression of engineering strains.

8. The feed additive according to claim 7, characterized in that The engineering strain is a Pichia pastoris engineering strain.

9. Use of the feed additive according to claim 5 in preparing feed for preventing and treating diarrhea in pigs.

10. A pig feed, characterized in that: The pig feed is added with the feed additive according to claim 4.

Images