Recombinant pichia pastoris strain for producing beta-fructofuranosidase as well as preparation method and application of recombinant pichia pastoris strain

Abstract

The invention discloses a recombinant pichia pastoris strain for producing beta-fructofuranosidase as well as a preparation method and application of the recombinant pichia pastoris strain. A pichia pastoris X33 strain is selected, a GAP promoter is used for driving and alpha-factor signal peptide is used for secretory expression of a fopA gene, an AOX promoter is used for driving and expression of a molecular chaperone PDI, generated beta-fructofuranosidase is located in fermentation supernate, and the beta-fructofuranosidase target protein can be obtained through simple purification steps. The saccharomyces cerevisiae can act on cane sugar to produce kestose, and has good application value. The positive clone is subjected to shake flask fermentation for 72 hours, the enzyme activity of the nystose generated by catalyzing the cane sugar by the fermentation supernatant is determined to be 694.83 U / mL, the proportion of the nystose in the product is the highest and is 45.5%, and the proportion of the fructo-oligosaccharide in the total sugar is 63.84%.

Description

Technical Field

[0001] The invention relates to a recombinant Pichia yeast strain producing beta-fructose furanosidase and a preparation method and application thereof, belonging to the field of genetic engineering. Background Art

[0002] Fructooligosaccharides (FOS) are natural ingredients found in small amounts in fruits, vegetables, barley, honey, etc. They are mostly a mixture of kenetose (GF2), kenetetrosaccharides (GF3) and kenetpentasaccharides (GF4), which are composed of sucrose connected to fructose groups in other molecules through β-(2,1) glycosidic bonds. FOS is considered to be a generally recognized safe (GRAS) ingredient in food, which can promote the growth of bifidobacteria in the intestine, inhibit the growth and reproduction of exogenous pathogenic bacteria and inherent spoilage bacteria in the intestine, improve the intestinal microecological environment, and enhance the body's immunity. Among them, kenetose is a component with a relatively rich content of prebiotic effects in oligofructose.

[0003] At present, the large-scale production of oligofructose is mainly synthesized by transglycosylation of sucrose. In the transglycosylation process, high-concentration sucrose is used as a raw material and synthesized by β-fructofuranosidase (β-fructofuranosidase, FopA) with fructosyl transfer activity. FopA mainly comes from fungi, such as Aspergillus niger, A. japonicus, Aureobasidium pullulans and Penicillium expansum. For example, Aspergillus niger ATCC20611 is the main industrial strain for the synthesis of oligofructose. In 1988, the strain was screened by Hidaka et al. (Hidaka Het al, Agricultural and Biological Chemistry, 1988, 52 (5): 1181-1187), and the β-fructofuranosidase produced by it mainly exists in the form of intracellular enzyme.

[0004] However, the above technology has the disadvantages that the β-fructofuranosidase is located inside the cell, which makes the enzyme purification step more complicated, and the content of saccharide in the product is relatively low. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the present invention provides a recombinant Pichia pastoris strain producing β-fructofuranosidase and a preparation method and application thereof, aiming to solve the technical problem that the β-fructofuranosidase is located intracellularly and the content of kaemose in the generated oligofructose is relatively low.

[0006] The first technical solution provided by the present invention is a recombinant Pichia pastoris producing β-fructose furanosidase, with Pichia pastoris as the host cell, and the β-fructose furanosidase encoding gene fopA and the protein disulfide isomerase encoding gene PDI integrated into the genome of the host cell.

[0007] In certain embodiments, the β-fructofuranosidase is GAP The promoter starts the expression, and the N-terminus of the β-fructofuranosidase is connected to the α-factor signal peptide.

[0008] In certain embodiments, the β-fructose furanosidase is derived from Aspergillus niger, and the amino acid sequence of the β-fructose furanosidase is shown in SEQ ID NO:1.

[0009] Furthermore, the nucleotide sequence of the fopA gene is shown in SEQ ID NO:2.

[0010] In certain embodiments, the nucleotide sequence of the gene encoding the α-factor signal peptide is shown in SEQ ID NO:6.

[0011] In certain embodiments, the protein disulfide isomerase is composed of P AOX Promoter-driven expression

[0012] In certain embodiments, the nucleotide sequence of the PDI gene is as shown in SEQ ID NO:3.

[0013] In certain embodiments, P GAP The nucleotide sequence of the promoter is shown in SEQ ID NO:4.

[0014] In certain embodiments, P AOX The nucleotide sequence of the promoter is shown in SEQ ID NO:5.

[0015] In certain embodiments, the host cell is Pichia pastoris X33.

[0016] In certain embodiments, the β-fructofuranosidase is expressed using pGAPZαA plasmid.

[0017] In certain embodiments, the β-fructofuranosidase is integrated into the GAP site of the Pichia genome.

[0018] In certain embodiments, the protein disulfide isomerase is expressed using pPIC9K plasmid.

[0019] In certain embodiments, the protein disulfide isomerase is integrated into the AOX site of the Pichia genome.

[0020] The second technical solution provided by the present invention is a method for constructing a recombinant Pichia pastoris that produces β-fructose furanosidase. The method comprises integrating the β-fructose furanosidase encoding gene fopA and the protein disulfide isomerase encoding gene PDI into the genome of Pichia pastoris, wherein the β-fructose furanosidase is integrated at the GAP site of the Pichia pastoris genome; and the protein disulfide isomerase is integrated into the genome AOX of Pichia pastoris.

[0021] In some embodiments, the steps include:

[0022] (1) The fopA gene was subcloned into the EcoR I and Sal I restriction sites downstream of the α-factor signal peptide on the pGAPZαA vector, the ligation products were transformed into Escherichia coli TOP10 competent cells, positive clones were screened, and the recombinant plasmid pGAPZαA-fopA was extracted;

[0023] (2) The recombinant plasmid pGAPZαA-fopA in step (1) was digested with restriction endonuclease Avr II, and the linearized plasmid was electroporated into Pichia pastoris X33 to produce a recombinant Pichia pastoris strain named X33-fopA.

[0024] (3) The PDI gene was subcloned between the BamH I and Not I sites on the pPIC9K vector, the ligation product was transformed into the competent E. coli TOP10, the positive clones were screened, and the recombinant plasmid pPIC9K-PDI was extracted;

[0025] (4) Using X33-fopA as the starting strain, a competent cell was prepared. The recombinant plasmid pPIC9K-PDI in step 3 was digested with restriction endonuclease Sac I, and the linearized plasmid was electroporated into Pichia pastoris X33-fopA. The recombinant Pichia pastoris was named X33-fopA-PDI.

[0026] The third technical solution provided by the present invention is a method for preparing β-fructose furanosidase, which comprises inoculating the recombinant Pichia pastoris described in the first technical solution into a fermentation medium for fermentation and enzyme production.

[0027] In certain embodiments, the fermentation medium is BMMY medium.

[0028] In certain embodiments, the fermentation temperature is 28-30° C., and the fermentation time is 60-80 h.

[0029] The fourth technical solution provided by the present invention is a method for preparing kestose, wherein sucrose is used as a substrate, and the supernatant after fermentation of the recombinant Pichia yeast described in the first technical solution is used as a catalyst to form a catalytic system to catalytically generate kestose.

[0030] In certain embodiments, in the catalytic system, the added amount of the catalyst is 6 U / g sucrose.

[0031] In certain embodiments, in the catalytic system, the concentration of the substrate is 55%.

[0032] In certain embodiments, the temperature of the catalytic reaction is 50-55° C., and the pH of the catalytic reaction is 7.0-7.5.

[0033] The fifth technical solution provided by the present invention is the use of the recombinant Pichia yeast described in the first technical solution, or the method described in the second technical solution, or the method described in the third technical solution, or the method described in the fourth technical solution in the production of β-fructose furanosidase, kestose or products containing kestose.

[0034] The technical effects of the present invention are as follows:

[0035] The Pichia pastoris X33 strain was selected and the fopA gene was expressed by secretion driven by the GAP promoter and the α-factor signal peptide. The molecular chaperone PDI was expressed by the AOX promoter. The β-fructose furanosidase produced was located in the fermentation supernatant. After a simple purification step, the β-fructose furanosidase target protein was obtained, and it was used to act on sucrose to produce sucrose trisaccharide, which has good application value. Specifically, according to the amino acid sequence of fopA in Aspergillus niger, its base sequence was codon optimized, and the molecular chaperone protein PDI was expressed on this basis. The positive clone obtained was shaken in a flask for fermentation for 72 hours, and the enzyme activity of the fermentation supernatant to catalyze sucrose to produce sucrose trisaccharide was determined to be 694.83U / mL. The proportion of sucrose trisaccharide in the product was the highest, at 45.5%, and oligofructose accounted for 63.84% of the total sugar. DETAILED DESCRIPTION

[0036] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0037] Test method:

[0038] 1. Detection method of saccharide: The product was detected by high performance liquid chromatography system equipped with amino column Asahipak NH2P-50-4E and differential refractometer detector. 65% acetonitrile (v / v) was used as mobile phase, the flow rate was 1 mL / min, the column temperature was set at 35°C, and the injection volume was 10 μL.

[0039] 2. Enzyme activity determination method: 5g sucrose is dissolved and fixed to 50mL 50mM pH 5.0 citric acid-sodium hydrogen phosphate buffer solution. Take 0.9mL substrate solution and place it in a 50℃ water bath for 10min, then add 0.1mL enzyme solution diluted 20 times, mix immediately and time the reaction for 10min, immediately boil with hot water to inactivate the enzyme for 5min, filter with 0.22μm micropores and perform amino column liquid phase detection. Enzyme activity definition: the amount of 1μmol of sucrose produced per minute.

[0040] The raw materials used in the embodiment:

[0041] 1. The expression vectors pGAPZαA and pPIC9K were from Invitrogen.

[0042] 2. Pichia pastoris X33 strain was obtained from Shanghai Bio-Tech Biotechnology Co., Ltd.

[0043] 3. Formula of low-salt LB solid culture medium: 10 g / L tryptone, 5 g / L yeast extract, 5 g / L NaCl, and 2% agar powder.

[0044] 4. Formula of YPD liquid culture medium: soy peptone 20g / L, yeast powder 10g / L, glucose 20g / L.

[0045] 5. Formula of YPD solid culture medium: soy peptone 20g / L, yeast powder 10g / L, glucose 20g / L, agar 20g / L.

[0046] 6.Formula of BMGY medium: yeast extract 10 g / L, peptone 20 g / L, glycerol 1%, YNB 13.4 g / L, potassium phosphate buffer 10%, biotin 0.4 mg / L.

[0047] 7. Formula of BMMY medium: yeast extract 10 g / L, peptone 20 g / L, YNB 13.4 g / L, potassium phosphate buffer 10%, biotin 0.4 mg / L, methanol 0.5%.

[0048] Example 1 Construction of recombinant expression plasmid pGAPZαA-fopA

[0049] β-fructofuranosidase is derived from Aspergillus niger, with an amino acid sequence (NCBI: BAB67771.1). Its signal peptide was predicted by signalP6.0, and the amino acid sequence after removing the signal peptide was shown in SEQ ID NO: 1. The base sequence of FopA was codon-optimized according to the codon preference of Pichia pastoris, and the base sequence obtained was shown in SEQ ID No: 2.

[0050] Seamless cloning primers were designed based on the optimized fopA gene sequence and the Pichia pastoris expression vector pGAPZαA. The primer sequences are as follows:

[0051] fopA-F:AGAGAGGCTGAAGCTTCCTACCACTTGGACACTACTGC

[0052] fopA-R:ATGATGATGGTCGACGTTTCTCTCAGGCCAAGCGTTG

[0053] pGAPZαA-F:GTCGACCATCATCATCATCATCATTGAGT

[0054] pGAPZαA-R:AGCTTCAGCCTCTCTTTTCTCGAG

[0055] The fopA gene (target gene fragment) was obtained by PCR amplification using fopA-F / R primers, and the vector backbone fragment was amplified using pGAPZαA-F / R. The PCR enzyme was selected High-Fidelity DNA Polymerases (NEB), the amplified target gene fragment and vector backbone fragment were gel-recovered (SanPrep column DNA gel recovery kit, Shanghai Biotechnology Co., Ltd.), the fopA gene was ligated with the pGAPZαA vector fragment using In-Fusion Snap Assembly Master Mix reagent (Takara), the ligation product was transformed into Escherichia coli TOP10 competent cells, coated with low-salt LB solid culture medium, and 25 μg / mL bleomycin was added to screen positive clones. The recombinant plasmid was named pGAPZαA-fopA.

[0056] Example 2: Construction of a recombinant Pichia pastoris strain producing β-fructofuranosidase

[0057] The recombinant plasmid pGAPZαA-fopA of Example 1 was linearized by restriction endonuclease AvrII (NEB), and the linearized vector was recovered by using a common DNA product purification kit (Tiangen Biochemical Technology Beijing Co., Ltd.). Pichia pastoris X33 competent cells were prepared with reference to the Invtrogen (Catalog nos. V200-20 and V205-20) operation manual, and the linearized fragment was electrotransformed into the X33 competent cells, coated with YPD solid medium containing 100 μg / mL bleomycin, and cultured at 30°C for 3 to 5 days until a single colony appeared. The single colony was verified by colony PCR, and the primers used were as follows:

[0058] pGAP Forward:GTCCCTATTTCAATCAATTGAA

[0059] 3'AOX1:GCAAATGGCATTCTGACATCC

[0060] The product with the correct size verified by PCR was sent to Shanghai Biotech Co., Ltd. for sequencing, and the strain in which the PGAP-α-factor-fopA expression cassette was successfully integrated into the genome of Pichia pastoris X33 was named X33-fopA strain.

[0061] Example 3: Construction of recombinant expression plasmid pPIC9K-PDI

[0062] Seamless cloning primers were designed based on the PDI gene sequence and the Pichia pastoris expression vector pPIC9K. The primer sequences are as follows:

[0063] PDI-F:AACTAATTATTCGAAATGCAATTCAACTGGGATATTAAAACTGTGG

[0064] PDI-R:AAGGCGAATTAATTCTTAAAGCTCGTCGTGAGCGTCT

[0065] pPIC9K-F:GAATTAATTCGCCTTAGACATGACTGTTCCT

[0066] pPIC9K-R:TTCGAATAATTAGTTGTTTTTTGATCTTCTCAAGTTGTC

[0067] The PDI gene (target gene fragment) was obtained by PCR amplification using the PDI-F / R primer pair, and the vector backbone fragment was amplified using pPIC9K-F / R. The PCR enzyme was selected High-Fidelity DNA Polymerases (NEB), the amplified target gene fragment and vector backbone fragment were gel-recovered (SanPrep column DNA gel recovery kit, Shanghai Biotechnology Co., Ltd.), the PDI gene was connected to the pPIC9K vector fragment using In-Fusion Snap Assembly Master Mix reagent (Takara), the ligation product was transformed into Escherichia coli DH5α competent cells, LB solid culture medium was coated, 50 μg / mL kanamycin was added to screen positive clones, and the recombinant plasmid was named pPIC9K-PDI.

[0068] Example 4: Expression of molecular chaperone PDI

[0069] The recombinant plasmid pPIC9K-PDI of Example 3 was linearized by restriction endonuclease Sac I (NEB), and the linearized vector was recovered by using a common DNA product purification kit (Tiangen Biochemical Technology Beijing Co., Ltd.). Pichia pastoris X33-fopA competent cells were prepared with reference to the Invtrogen (Catalog nos. V200-20 and V205-20) operation manual, and the linearized fragment was electrotransformed into the X33-fopA competent cells, coated with YPD solid medium containing 500 μg / mL geneticin G418, and cultured at 30°C for 3 to 5 days until single colonies appeared. Colony PCR verification was performed on single colonies, and the primers used were as follows:

[0070] 5'AOX1:GACTGGTTCCAATTGACAAGC

[0071] 3'AOX1:GCAAATGGCATTCTGACATCC

[0072] The product with the correct size verified by PCR was sent to Shanghai Biotech Co., Ltd. for sequencing. AOX The strain in which the -PDI expression cassette was successfully integrated into the Pichia pastoris X33-fopA genome was named X33-fopA-PDI strain.

[0073] Example 5: Determination of enzyme activity in the supernatant of recombinant Pichia pastoris

[0074] A single colony of the recombinant Pichia pastoris X33-fopA-PDI in Example 4 was picked and inoculated into 5 mL of YPD liquid culture medium, cultured in a constant temperature shaker at 30°C for 24 h, and transferred to 50 mL of BMGY culture medium at an inoculum rate of 1% and cultured in a constant temperature shaker at 30°C for 24 h. The cells were collected by centrifugation, suspended with an equal amount of BMMY culture medium, and cultured in a shaker at 28°C at 240 rpm, with 0.5% methanol added every day; the fermentation broth cultured for 72 h was taken, centrifuged at 6000 rpm for 10 min, and the supernatant was taken for enzyme activity determination, and the enzyme activity was 694.83 U / mL.

[0075] Example 6: Enzymatic conversion process conditions

[0076] Taking the yield of sucrose and oligofructose as indicators, the study on the enzymatic conversion conditions for oligofructose showed that when the supernatant of Example 5 was added as a catalyst 6U / g sucrose, the substrate concentration was 55% (m / v, 550g / L), the reaction temperature was 50-55°C, the reaction pH was 7.0-7.5, and the reaction time was 6h, the proportion of sucrose in oligofructose was the highest at 45.5%, and the proportion of oligofructose in total sugar was 63.84%.

[0077] Comparative Example 1

[0078] Other conditions or parameters were consistent with those in Example 5, except that the fermentation broth cultured for 72 hours in Example 5 was replaced with the fermentation broth cultured for 48 hours, and the enzyme activity was determined to be 446.20 U / mL.

[0079] Comparative Example 2

[0080] Other conditions or parameters were consistent with those in Example 5, except that the fermentation broth after 72 hours of culture in Example 5 was replaced with the fermentation broth after 96 hours of culture, and the enzyme activity was determined to be 561.59 U / mL.

[0081] Comparative Example 3

[0082] Other conditions or parameters were consistent with those in Example 6, except that the reaction temperature of 50-55° C. in Example 6 was replaced by a reaction temperature of 60° C., the proportion of saccharide was 38.1%, and the proportion of oligofructose in the total sugar was 57.8%.

[0083] Comparative Example 4

[0084] Other conditions or parameters were consistent with those in Example 6, except that the reaction pH 7.0-7.5 in Example 6 was replaced with a reaction pH 8.0, the proportion of kestose was 26.6%, and the proportion of oligofructose in the total sugar was 40.1%.

[0085] Comparative Example 5

[0086] The X33-fopA strain obtained in Example 2 was cultured according to the method of Example 5, and the fermentation broth after 72 hours of cultivation was taken. The enzyme activity in the supernatant was measured to be 511.3 U / mL.

[0087] Comparative Example 6

[0088] The molecular chaperone PDI in Example 4 was replaced with HAC1 to obtain the recombinant strain X33-fopA-HAC1. Referring to the method of Example 5, the fermentation broth after 72 hours of cultivation was taken and the enzyme activity in the supernatant was measured to be 625.9 U / mL.

[0089] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A recombinant Pichia pastoris, characterized in that: Pichia pastoris is used as a host cell, and a gene fopA encoding beta-fructose furanosidase and a gene PDI encoding protein disulfide isomerase are integrated into the genome of the host cell.

2. The recombinant Pichia pastoris according to claim 1, characterized in that The fusion protein is composed of P GAP The promoter starts the expression, and the N-terminus of the fusion protein is connected to the α-factor signal peptide.

3. The recombinant Pichia pastoris according to claim 1, characterized in that The β-fructose furanosidase is derived from Aspergillus niger, and the amino acid sequence of the β-fructose furanosidase is shown in SEQ ID NO:

1.

4. The recombinant Pichia pastoris according to claim 1, characterized in that The host cell is Pichia pastoris X33; the pGAPZαA plasmid is used as an expression vector; and the protein disulfide bond isomerase is expressed by the pPIC9K plasmid.

5. A method for constructing a recombinant Pichia pastoris, characterized in that: The method comprises the following steps: integrating a gene fopA encoding beta-fructose furanosidase and a gene PDI encoding a protein disulfide bond isomerase into the genome of Pichia pastoris; the beta-fructose furanosidase is integrated into the GAP site of the Pichia pastoris genome; and the protein disulfide bond isomerase is integrated into the genome AOX of Pichia pastoris.

6. The method according to claim 5, characterized in that The steps include: (1) The fopA gene was subcloned into the downstream of the α-factor signal peptide on the pGAPZαA vector to construct the recombinant plasmid pGAPZαA-fopA; (2) transforming the recombinant plasmid pGAPZαA-fopA in step (1) into Pichia pastoris X33 to obtain recombinant Pichia pastoris X33-fopA; (3) Subcloning the PDI gene into the pPIC9K vector to construct the recombinant plasmid pPIC9K-PDI; (4) Transform the recombinant plasmid pPIC9K-PDI in step (3) into the recombinant Pichia pastoris X33-fopA in step (2) to obtain the recombinant Pichia pastoris X33-fopA-PDI.

7. A method for preparing β-fructose furanosidase, characterized in that: The method comprises inoculating the recombinant Pichia yeast according to any one of claims 1 to 4 into a fermentation medium for fermentation and enzyme production.

8. The preparation method according to claim 7, characterized in that: The fermentation temperature is 28-30° C., and the fermentation time is 60-80 hours.

9. A method for preparing kestose, the method comprising using sucrose as a substrate and utilizing the supernatant after fermentation of the recombinant Pichia yeast described in the first technical solution as a catalyst to form a catalytic system to catalytically produce kestose.

10. Use of the recombinant Pichia yeast according to any one of claims 1 to 4, or the method according to claim 5 or 6, or the method according to claim 7 or 8, or the method according to claim 9 in the production of β-fructofuranosidase, kestose, or a product containing kestose.