System, kit and method for detecting compound mutation of BCR:: ABL1 tyrosine kinase region

Abstract

The invention belongs to the field of gene detection, and particularly relates to a system, a kit and a method for detecting BCR:: ABL1 tyrosine kinase region compound mutation, and the detection system comprises a one-step amplification reagent, a kinase region amplification reagent and a library amplification reagent. According to the invention, RNA nucleic acid reacts with a one-step amplification reagent to obtain double-chain cDNA of M-type and m-type fusion genes at the same time, then the double-chain cDNA reacts with a kinase region amplification reagent to obtain an amplicon covering a V225-R516 site region of an ABL1 gene, and finally the amplicon reacts with a library amplification reagent to obtain a final library. According to the embodiment of the invention, the ABL1 kinase region mutation is detected by utilizing a self-built high-throughput sequencing method, the sensitivity can reach 1%, the compound mutation of more than or equal to 2 mutations can be detected, and a patient can be guided to adjust a treatment scheme in time according to a mutation detection result.

Description

Technical Field

[0001] The present invention belongs to the field of gene detection, and in particular relates to a system, a kit and a method for detecting compound mutations in the BCR::ABL1 tyrosine kinase region. Background Art

[0002] Chronic myelogenous leukemia (CML) is a malignant tumor formed by clonal proliferation of bone marrow hematopoietic stem cells, accounting for 15% of adult leukemia, with an annual global incidence of 1.6 / 100,000 to 2 / 100,000.

[0004] CML and some acute lymphoblastic leukemia (ALL) have a hallmark cytogenetic abnormality - the Ph chromosome formed by t(9;22)(q34;q11), which forms the BCR::ABL1 fusion gene at the molecular level, resulting in the continuous activation of the ABL1 tyrosine kinase. Imatinib and other tyrosine kinase inhibitors (TKIs) have become an important component of the first-line treatment of CML and Ph+ALL. Most patients can achieve satisfactory results, but some patients still develop primary or secondary drug resistance.

[0005] The results showed that more than half of CML patients resistant to imatinib, nilotinib and dasatinib were detected with mutations in the BCR::ABL1 kinase region, among which the T315I mutation had the highest proportion, and some patients were detected with compound mutations (CMs). Compound mutations refer to the presence of two mutations on the same BCR::ABL1 molecule. Currently available single-drug TKIs including ponatinib and aximinib are not sensitive, which is a thorny problem in the field of drug resistance. CMs are usually caused by the patient's continuous resistance to multiple TKIs, and the "second blow" of sequential TKI resistance is suffered when the original mutant clones are not completely eliminated. Different mutations correspond to different TKI resistance. Mutation detection can help understand the mutation status to optimize treatment and guide patients to use drugs accurately.

[0006] ABL1 mutation is currently the only one that can be used to guide clinical treatment decisions. Both the ELN and NCCN guidelines recommend that ABL1 mutation testing be performed when CML patients experience suboptimal efficacy or treatment failure, in order to guide patients to switch to appropriate, sensitive TKI drugs in a timely manner, thereby improving treatment response and outcomes and preventing the accumulation of mutations, including compound mutations, that lead to disease progression.

[0007] The "Chinese Expert Consensus on Laboratory Specifications for Mutation Detection in the BCR::ABL1 Tyrosine Kinase Region" states that direct sequencing is the conventional method for ABL1 mutation detection in current clinical work, and its results are the main indicator for guiding clinical treatment. However, the sensitivity of direct sequencing (Sanger sequencing) is only 10% to 20%, which cannot fully meet current clinical requirements. The mutation specificity of mass spectrometry (MS) is more sensitive and accurate (1% to 5%), but mass spectrometry cannot detect new mutations, and it is difficult to identify mutations caused by dinucleotide substitutions, such as T315I and T315M mutations. Problems such as low-proportion mutations, compound mutations, and clonal evolution of mutations have always plagued the accurate assessment of mutations.

[0008] Therefore, it is crucial to the patient's prognosis to use more sensitive and effective detection methods to screen BCR::ABL1 mutation sites early, especially low-proportion mutations, compound mutations, and clonal evolution of mutations, to detect changes in the disease as early as possible, and to take timely measures to intervene or change treatment plans. Summary of the invention

[0009] The purpose of the present invention is to provide a system, a kit and a method for detecting compound mutations in the tyrosine kinase region of BCR::ABL1. The detection method of the present invention utilizes high-channel sequencing technology, which not only has high detection sensitivity, but also has a mutation detection ratio that is significantly higher than the Sanger sequencing result, and can obtain the detailed mutation status of BCR::ABL1, providing important information for the prognosis and treatment of patients.

[0010] In order to achieve the above object, the present invention provides the following technical solutions:

[0011] The present invention provides a system for amplifying BCR::ABL1 fusion gene transcripts, the system comprising a one-step amplification reagent, wherein the one-step amplification reagent comprises: a PCR buffer, a one-step primer mixture, a reverse transcriptase, a DNA polymerase, a genomic DNA removal enzyme, an RNase inhibitor and nuclease-free water;

[0012] The one-step primer mixture includes primers BCR-Out1F, BCR-Out2F and ABL1-OutR, and the nucleotide sequences of the primers are shown in SEQ ID NO.1-3.

[0013] Preferably, the PCR buffer comprises: Tris-HCl, KCl, MgCl2, DTT, dNTP, Oligo d(T)23VN, random primers, and an enhancer; the enhancer is selected from a combination of one or more of betaine, NP-40, Tween20, and Triton-X100.

[0014] Preferably, the reverse transcriptase is selected from one or a combination of AMV Reverse Transcriptase, M-MuLV Reverse Transcriptase, SuperScript II Reverse Transcriptase, SuperScript III Reverse Transcriptase, SuperScript IV Reverse Transcriptase, and Maxima H Minus Reverse Transcriptase.

[0015] Preferably, the DNA polymerase is Taq enzyme or LATaq enzyme.

[0016] Preferably, the genomic DNA removal enzyme is selected from one or a combination of DNase I, Exonuclease III, Exonuclease T7, Exonuclease VIII, and dsDNase.

[0017] Preferably, the RNase inhibitor is selected from one or a combination of SDS, urea, diatomaceous earth, guanidine isothiocyanate and RNasin.

[0018] The present invention also provides a system for detecting compound mutations in the tyrosine kinase region of the BCR::ABL1 fusion gene, the system comprising the above-mentioned amplification system, and also comprising a kinase region amplification reagent and a library amplification reagent; the kinase region amplification reagent comprises: 2xPCR mix, an amplicon primer mixture and nuclease-free water; the library amplification reagent comprises: 2xPCRmix and a library amplification primer mixture;

[0019] The amplicon primer mixture includes primers ABL1F, ABL1R, ABL2F, ABL2R, ABL3F, ABL3R, ABL4F and ABL4R, and the nucleotide sequence thereof is shown in SEQ ID NO.4-11; in the nucleotide sequence, N represents a random base, and the random base has 12 positions;

[0020] The library amplification primer mixture includes primer SJ50X and primer SJ70X, the nucleotide sequence of primer SJ50X is shown in SEQ ID NO.12, and the nucleotide sequence from positions 30 to 37 is the index sequence of DNA bases; the nucleotide sequence of primer SJ70X is shown in SEQ ID NO.13, and the nucleotide sequence from positions 25 to 32 is the index sequence of DNA bases.

[0021] The present invention also provides a kit for detecting compound mutations in the tyrosine kinase region of the BCR::ABL1 fusion gene, characterized in that the kit comprises the above-mentioned system for detecting double-stranded cDNA of the BCR::ABL1 fusion gene transcript.

[0022] The present invention also provides a method for detecting compound mutations in the tyrosine kinase region of BCR::ABL1, comprising the following steps:

[0023] S1. extract RNA nucleic acid, react with the above-mentioned one-step amplification reagent after quantification, and purify the amplified product;

[0024] S2. reacting the purified product in step S1 with the above-mentioned kinase region amplification reagent, and sorting the reaction products;

[0025] S3. reacting the product sorted in step S2 with the above-mentioned library amplification reagent, and purifying the reaction product again to obtain a final library;

[0026] S4. The final library obtained after purification in step S3 is subjected to high-throughput sequencing, sequence comparison and mutation analysis to finally obtain the result of compound mutation in the tyrosine kinase region of BCR::ABL1.

[0027] Preferably, the amount of RNA input used in the reaction with the one-step amplification reagent in step S1 is 500-3000 ng, preferably 1000-3000 ng.

[0028] Preferably, step S1 further comprises a PCR reaction after reacting with a one-step amplification reagent, and the PCR reaction program is 50°C, 30 min; 95°C 5 min; 95°C 20 sec, 60°C 20 sec, 68°C 2 min, 30 cycles; 68°C 5 min.

[0029] The present invention also provides the use of the above system or kit or detection method in detecting the drug resistance of leukemia patients to tyrosine kinase inhibitors.

[0030] Beneficial effects of the present invention:

[0031] 1. The reaction system adopted in the present invention can obtain double-stranded cDNA of M-type and m-type fusion gene transcripts in one step. The amplicon primers do not contain dimers, hairpin structures and mismatches, and random base tags are introduced into the primers, which greatly improves the low-frequency detection sensitivity and reduces the probability of false positive variation detection.

[0032] 2. The kinase region detection range of the present invention covers the V225-R516 site region of the ABL1 gene (GeneBankNM_005157.6), with good coverage and an average sequencing depth of 270,000.

[0033] 3. The present invention uses a self-built high-throughput sequencing method to detect mutations in the ABL1 kinase region, which can detect low-frequency mutations with a detection sensitivity of up to 1%, and can sensitively detect compound mutations of ≥2 mutations. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0035] Figure 1 Schematic diagram of the fusion sites of the three main BCR::ABL1 fusion genes.

[0036] Figure 2 It is a schematic diagram of the process of the present invention.

[0037] Figure 3 This is a 2100 fragment analysis diagram of the library of sample 1 in Example 1.

[0038] Figure 4 This is an IGV graph of the next-generation sequencing results for the detection of the compound mutation (c.749G>A and c.763G>A) of sample 1 in Example 1.

[0039] Figure 5 This is the peak graph of the first-generation sequencing results of the mutation site c.749G>A of sample 1 in control example 1.

[0040] Figure 6 This is the peak graph of the first-generation sequencing results of the mutation site c.764A>T of sample 1 in control example 1.

[0041] Figure 7 This is the peak graph of the first-generation sequencing results of the mutation site c.944C>T of sample 1 in control example 1.

[0042] Figure 8 IGV graph of the next-generation sequencing results of the p.T315I positive mutation detected by the standard sample with a theoretical mutation ratio of 10% in Example 2.

[0043] Fig. 9 IGV graph of the next-generation sequencing results of the p.T315I positive mutation detected by the standard sample with a theoretical mutation ratio of 2% in Example 2.

[0044] Fig.10 IGV graph of the next-generation sequencing results of the p.T315I positive mutation detected by the standard sample with a theoretical mutation ratio of 1% in Example 2.

[0045] Fig.11 This is an IGV graph of the next-generation sequencing results of the standard sample with a theoretical mutation ratio of 0.5% at the p.T315I site in Example 2.

[0046] Fig.12 This is a 2100 fragment analysis diagram of the library of the sample in Example 3.

[0047] Fig.13 This is a 2100 fragment analysis diagram of the library of the sample in Example 4. DETAILED DESCRIPTION

[0048] The type of BCR::ABL1 fusion gene depends on the breakpoint of the BCR gene, such as Figure 1 As shown, it can be mainly divided into three types: M-BCR (p210), m-BCR (p190), and μ-BCR (p230). More than 95% of CML patients have BCR / ABL1 fusion genes of M type, mainly b2a2 type (40%) and b3a2 type (55%). M type: including b3a2 (e14a2) or b2a2 (e13a2), encoding BCR::ABL1 fusion protein with a relative molecular mass of 210KD, found in most CML and some adult ALL; m type: e1a2, encoding BCR::ABL1 fusion protein with a relative molecular mass of 190KD, found in 60% to 70% Ph+ adult ALL and 80% Ph+ childhood ALL; μ type: e19a2, encoding BCR::ABL1 fusion protein with a relative molecular mass of 230KD. The occurrence rate of this type is very low compared with the previous two types. Therefore, the present invention only considers the previous two types and can cover the vast majority of BCR::ABL1 fusion genes.

[0049] The present invention provides a system for amplifying BCR::ABL1 fusion gene transcripts, which includes a one-step amplification reagent, wherein the one-step amplification reagent includes: a PCR buffer, a one-step primer mixture, a reverse transcriptase, a DNA polymerase, a genomic DNA removal enzyme, an RNase inhibitor and nuclease-free water; the one-step primer mixture includes primers BCR-Out1F, BCR-Out2F and ABL1-OutR, and the nucleotide sequences of the primers are shown in SEQ ID NO.1-3.

[0050] BCR-Out1F: 5′-CTCGCAACAGTCCTTCGAC-3′ (SEQ ID NO. 1);

[0051] BCR-Out2F: 5′-GAGCAGCAGAAGAAGTGTTTCAGA-3′ (SEQ ID NO. 2);

[0052] ABL1-OutR: 5'-CTTGGAGTGAGGCATCTCAG-3' (SEQ ID NO. 3).

[0053] The amplification primers BCR-Out1F and ABL1-OutR are combined to amplify the transcript of the m-type fusion gene, and the obtained cDNA size is 1744bp; BCR-Out2F and ABL1-OutR are combined to amplify two transcripts (b3a2 or b2a2) of the M-type fusion gene, and the obtained cDNA size is 1704bp or 1779bp. The present invention uses multiple reactions and one tube reaction to simultaneously obtain the transcript cDNA of the M-type and m-type fusion genes.

[0054] The PCR buffer comprises: Tris-HCl, KCl, MgCl2, DTT, dNTP, Oligo d(T)23VN, random primers, and an enhancer; the enhancer is selected from a combination of one or more of betaine, NP-40, Tween20, and Triton-X100.

[0055] Random primers refer to the use of random hexamers, a non-specific primer, to copy the full-length mRNA when it is difficult to copy the full-length sequence of a specific mRNA because it contains a sequence that terminates the reverse transcriptase. When using this method, all RNA molecules in the system serve as cDNA first-strand templates, and the specificity required by the PCR primers during the amplification process is usually used to synthesize cDNA using these primers.

[0056] The reverse transcriptase is selected from one or a combination of AMV Reverse Transcriptase, M-MuLV Reverse Transcriptase, SuperScript II Reverse Transcriptase, SuperScript III Reverse Transcriptase, SuperScript IV Reverse Transcriptase, and Maxima H Minus Reverse Transcriptase; the DNA polymerase is Taq enzyme, preferably LATaq enzyme.

[0057] The genomic DNA removal enzyme is selected from one or a combination of DNase I, Exonuclease III, Exonuclease T7, Exonuclease VIII, and dsDNase.

[0058] A system for detecting double-stranded cDNA of BCR::ABL1 fusion gene transcripts, the system comprising a one-step amplification reagent, a kinase region amplification reagent and a library amplification reagent; the kinase region amplification reagent comprises: 2xPCR mix, an amplicon primer mixture and nuclease-free water; the library amplification reagent comprises: 2xPCR mix and a library amplification primer mixture.

[0059] The amplicon primer mixture includes primers ABL1F, ABL1R, ABL2F, ABL2R, ABL3F, ABL3R, ABL4F and ABL4R, and its nucleotide sequence table is shown in SEQ ID NO.4-11; as shown in Table 1, in the nucleotide sequence table, N represents a random base, and the random base has 12 positions.

[0060] Table 1 Primers included in the amplicon primer mix

[0061]

[0062] The primers in the four pairs of amplicon primer mixtures of the present invention all carry a UMI (Unique Molecular Identifier) ​​tag of 12 random bases ("NNNNNNNNNNNN"). UMI is a molecular barcode that adds a unique short tag sequence to each original DNA before PCR amplification, which is used for sequencing together after library construction and PCR amplification. Readout sequences with different molecular barcodes represent different original DNA molecules, while readout sequences with the same barcode are the results of PCR replication of the same original molecule. In this way, DNA templates from different sources can be distinguished according to different tag sequences.

[0063] The functions of UMI include: (1) Error correction: By adding a unique molecular barcode, bioinformatics software can filter out duplicate reads and PCR errors with high accuracy and report unique reads, thereby eliminating identified errors before final data analysis. (2) Improving the sensitivity of variant detection: Since each nucleic acid has a unique molecular barcode, this enables bioinformatics software to distinguish whether the measured reads are derived from different amplified copies of the mRNA molecule or from independent mRNA molecules, thereby performing more accurate quantification. (3) Reducing the probability of false positive variant detection: By distinguishing PCR false positives from true variants in the original molecule, variant detection can be performed when the variant allele frequency is extremely low, reducing the probability of false positive variant detection.

[0064] The library amplification primer mixture includes primer SJ50X and primer SJ70X, the nucleotide sequence of primer SJ50X is shown in SEQ ID NO.12, and the nucleotide sequence from positions 30 to 37 is the index sequence of DNA bases; the nucleotide sequence of primer SJ70X is shown in SEQ ID NO.13, and the nucleotide sequence from positions 25 to 32 is the index sequence of DNA bases.

[0065] SJ50X: 5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNACACTCTTTC CCTACACGA-3′ (SEQ ID NO. 12);

[0066] SJ70X: 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3′ (SEQ ID NO. 13).

[0067] The index in sequencing is a marker sequence used to identify DNA samples. During the sequencing process, DNA samples are usually divided into small fragments, and each fragment needs to be labeled for subsequent data analysis. Using the index, DNA fragments from different samples can be mixed together for sequencing, saving time and cost. At the same time, the use of the index can also avoid sample confusion and cross-contamination. On the Illumina sequencing platform, the index is usually a DNA sequence of 6 to 12 bases in length. During the sequencing process, the index will be attached to the end of the DNA fragment to form a "barcode". In this way, in subsequent data analysis, the data of different samples can be separated and compared according to the barcode.

[0068] A kit for detecting compound mutations in the tyrosine kinase region of a BCR::ABL1 fusion gene, the kit comprising the above-mentioned detection system.

[0069] A method for detecting compound mutations in the tyrosine kinase region of BCR::ABL1, the flow diagram of which is shown in FIG. Figure 2 As shown, the specific steps include:

[0070] S1. extract RNA nucleic acid, react with the above-mentioned one-step amplification reagent after quantification, and purify the amplified product;

[0071] S2. reacting the purified product in step S1 with the above-mentioned kinase region amplification reagent, and sorting the reaction products;

[0072] S3. reacting the product sorted in step S2 with the above-mentioned library amplification reagent, and purifying the reaction product again to obtain a final library;

[0073] S4. The final library obtained after purification in step S3 is subjected to high-throughput sequencing, sequence comparison and mutation analysis to finally obtain the result of compound mutation in the tyrosine kinase region of BCR::ABL1.

[0074] The amount of RNA input used in the reaction with the one-step amplification reagent in step S1 of the present invention is 500-3000 ng, preferably 1000-3000 ng.

[0075] Step S1 also includes a PCR reaction of the mixed reagents, and the PCR amplification program used is 50°C, 30min; 95°C 5min; 95°C 20sec, 60°C 20sec, 68°C 2min, 30 cycles; 68°C 5min. Considering that the fusion ratio of some fusion genes is very low, according to the current quantitative results of digital PCR, the lowest fusion ratio can be as low as 0.002%. The mutation of the ABL1 kinase region is detected based on the occurrence of fusion, and the ratio will also be very low, so this program sets 30 cycles to obtain more fusion transcripts.

[0076] Tyrosine kinase inhibitors (TKIs) are an important component of first-line treatment for CML and Ph+ALL, but some patients still develop primary or secondary drug resistance. More than half of CML patients resistant to tyrosine kinase inhibitors (TKIs) have been detected with mutations in the kinase region of BCR::ABL1, and some patients have compound mutations (CMs). Compound mutations refer to the presence of two mutations on the same BCR::ABL1 molecule.

[0077] The method of detecting compound mutations in the BCR::ABL1 tyrosine kinase region of the present invention is applied to detecting the drug resistance of leukemia patients to tyrosine kinase inhibitors, and can help CML patients understand the compound mutation status of their BCR::ABL1 tyrosine kinase region to optimize treatment, and guide patients to replace appropriate and sensitive TKI drugs in time, thereby improving treatment response and outcome, and preventing the accumulation of mutations including compound mutations, which leads to disease progression.

[0078] The kinase region detection range of the present invention covers the V225-R516 site region of the ABL1 gene (GeneBank NM_005157.6), and the sequence information of the entire amplified region is as follows:

[0079] Tgtctatggtgtgtcccccaactacgacaagtgggagatggaacgcacggacatcaccatgaagcacaagctgggcgggggccagtacggggaggtgtacgagggcgtgtggaagaaatacagcctgacggtggccgtgaagaccttgaaggaggacaccatggaggtggaagagttcttgaaagaagctgcagtcatgaaagagatcaaacaccctaacctggtgcagctccttggggtctgcacccgggagcccccgttctatatcatcactgagttcatgacctacgggaacctcctggactacctgagggagtgcaaccggcaggaggtgaacgccgtggtgctgctgtacatggccactcagatctcgtcagccatggagtacctggagaagaaaaacttcatccacagagatcttgctgcccgaaactgcctggtaggggagaaccacttggtgaaggtagctgattttggcctgagcaggttgatgacaggggacacctacacagcccatgctggagccaagttccccatcaaatggactgcacccgagagcctggcctacaacaagttctccatcaagtccgacgtctgggcatttggagtattgctttgggaaattgctacctatggcatgtccccttacccgggaattgacctgtcccaggtgtatgagctgctagagaaggactaccgcatggagcgcccagaaggctgcccagagaaggtctatgaactcatgcgagcatgttggcagtggaatccctctgaccggccctcctttgctgaaatccaccaagcctttgaaacaatgttccaggaatccagtatctcagacgaagtggaaaaggagctggggaaacaaggcgtccgt(SEQ ID NO.14)

[0080] In one embodiment of the present invention, after careful design and evaluation, the amplicon primers with the best dimer, hairpin structure and mismatch are screened out. Preferably, the amplification area of ​​the coding sequence is divided into four amplicons. More preferably, the four amplicons are divided into four tubes for separate reactions to avoid the occurrence of nonspecific amplification products between primers. More preferably, the products of the four tubes are combined into one tube for magnetic bead sorting.

[0081] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0082] The production processes, experimental methods or detection methods involved in the embodiments of the present invention, unless otherwise specified, are conventional methods in the prior art, and their names and / or abbreviations are conventional names in the art.

[0083] In the examples of the present invention, BCR-ABL1 (E13-E2) Fusion with ABL1 p.T315IPlus was purchased from Nanjing Kebai Biological, CBP20222R; BCR-ABL1 (E13-E2) Fusion without ABL1 p.T315I plus was purchased from Nanjing Kebai Biological, CBP20223R. The various instruments, equipment, raw materials or reagents used in the examples of the present invention are not particularly limited in terms of their sources, and are all conventional products that can be purchased through regular commercial channels, and can also be prepared according to conventional methods well known to those skilled in the art.

[0084] Example 1 Sample library construction and sequencing

[0085] After RNA is extracted, it is used for library construction and sequencing according to the process of the present invention. The specific experimental steps are as follows:

[0086] 1. RNA extraction

[0087] (1) Add 5 volumes of 1X red blood cell lysis buffer to 1 volume of sample.

[0088] (2) Incubate on ice for 10-15 min. Vortex twice during incubation.

[0089] (3) Centrifuge at 4°C, 2100 rpm for 10 min and completely remove the supernatant.

[0090] (4) Add 1X red blood cell lysis buffer (twice the original volume of the sample) to the white blood cell pellet and resuspend the cells.

[0091] (5) Centrifuge at 2100 rpm at 4°C for 10 min and completely remove the supernatant.

[0092] (6) Add lysis buffer RLH (add β-mercaptoethanol before use) to the leukocyte pellet and vortex or use a pipette to mix.

[0093] (7) The solution was transferred to the filter column CS (the filter column CS was placed in the collection tube), centrifuged at 12000 rpm for 2 min, the filter column was discarded, and the filtrate was collected.

[0094] (8) Add 1 volume of 70% ethanol to the filtrate and mix well. Transfer the resulting solution and precipitate into adsorption column CR4 (the adsorption column is placed in a collection tube). Centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column CR4 back into the collection tube.

[0095] (9) Add 700 μl of deproteinized solution RW1H (with anhydrous ethanol added in advance) to the adsorption column CR4, centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid in the collection tube.

[0096] (10) Add 500 μl of rinsing solution RW (with anhydrous ethanol added in advance) to the adsorption column CR4, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 30 sec, pour out the waste liquid in the collection tube, and put the adsorption column CR4 back into the collection tube. Repeat once.

[0097] (11) Centrifuge at 12000 rpm for 2 min and discard the waste liquid. Place the adsorption column CR4 at room temperature for several minutes to completely dry the residual rinse liquid in the adsorption material.

[0098] (12) Transfer the adsorption column CR4 into a new RNase-Free centrifuge tube, add 30 μl RNase-Free ddH2O, leave at room temperature for 2 min, and centrifuge at 12000 rpm for 2 min to obtain RNA solution.

[0099] 2. Construction of BCR::ABL1 tyrosine kinase region library

[0100] 2.1 Reaction with one-step amplification reagent

[0101] (1) Dilute 1000 ng RNA solution to 37.5 μL with nuclease-free water and place on ice until ready for use.

[0102] (2) Take out the PCR buffer and one-step primer mixture, place them on ice to dissolve, vortex to mix thoroughly, centrifuge briefly, and place on ice for later use.

[0103] (3) AMV Reverse Transcriptase, LATaq, DNase I and RNase inhibitor were gently flicked to mix and placed on ice for later use.

[0104] (4) The reaction system was prepared according to Table 2:

[0105] Table 2: One-step amplification reagent reaction system

[0106]

[0107]

[0108] (5) Use a pipette to gently pipette up and down to mix (5-10 times). After a brief centrifugation, place the tube in a PCR instrument and execute the following procedure as shown in Table 3:

[0109] Table 3: PCR instrument execution program

[0110]

[0111] 2.2 Product magnetic bead purification

[0112] (1) After completion, add 25 μl of magnetic beads to the above 50 μl PCR product and mix well.

[0113] (2) Let stand at room temperature for 5 minutes. Do not place it on the magnetic rack at this time.

[0114] (3) After 5 min, place the solution on a magnetic rack to allow it to settle and discard the supernatant.

[0115] (4) Add 200 μl of 80% ethanol, let stand for 30 seconds, discard the supernatant, and repeat once.

[0116] (5) After rapid centrifugation for 5 seconds, use a 10 μl pipette to discard the remaining ethanol and place at room temperature to dry.

[0117] (6) Remove the tube from the magnetic rack, add 33 μl of nuclease-free water to resuspend the magnetic beads, mix thoroughly, let stand at room temperature for 2 min, centrifuge quickly for 5 sec, place on the magnetic rack for 2 min, take the supernatant and transfer it to a new PCR tube. Do not touch the magnetic beads.

[0118] 2.3 Reaction with kinase region amplification reagent

[0119] (1) Take out the amplicon primer mixture, place it on ice to dissolve, vortex to mix thoroughly, centrifuge briefly, and place it on ice for later use.

[0120] (2) Gently flick 2xPCRmix to mix thoroughly and place on ice for later use.

[0121] (3) The four amplicons were reacted separately in four tubes, and each reaction system was prepared according to the following Table 4-7:

[0122] Table 4: Reaction components for Amplicon 1

[0123] Amplicon 1 component Volume (μl) Purification of products 8 ABL1F(10uM) 1 ABL1R(10uM) 1 2xPCRmix 10 Total 20

[0124] Table 5: Reaction components for Amplicon 2

[0125] Amplicon 2 component Volume (μl) Purification of products 8 ABL2F(10uM) 1 ABL2R(10uM) 1 2xPCRmix 10 Total 20

[0126] Table 6: Reaction components for Amplicon 3

[0127] Amplicon 3 components Volume (μl) Purification of products 8 ABL3F(10uM) 1 ABL3R(10uM) 1 2xPCRmix 10 Total 20

[0128] Table 7: Reaction components for Amplicon 4

[0129]

[0130]

[0131] (4) Use a pipette to gently pipette and mix (5-10 times). Centrifuge briefly for 5 seconds and place in a PCR instrument to execute the program in Table 8:

[0132] Table 8: PCR instrument execution program

[0133]

[0134] 2.4 Magnetic bead separation of products

[0135] (1) After completion, combine the four tubes of products, add 52 μl of magnetic beads to the products, and mix well.

[0136] (2) Let stand at room temperature for 5 minutes. Do not place it on the magnetic rack at this time.

[0137] (3) After 5 min, place the tube on a magnetic rack to allow it to settle. Transfer the supernatant to a clean PCR tube and discard the magnetic beads.

[0138] (4) Add 32 μl of magnetic beads to the above supernatant and mix well.

[0139] (5) Let stand at room temperature for 5 min. Do not place it on the magnetic rack at this time.

[0140] (6) After 5 min, place the solution on a magnetic rack to clarify and discard the supernatant.

[0141] (7) Add 200 μl of 80% ethanol, let stand for 30 seconds, discard the supernatant, and repeat once.

[0142] (8) After rapid centrifugation, use a 10 μl pipette to discard the remaining ethanol and place at room temperature to dry.

[0143] (9) Remove the tube from the magnetic rack, add 21 μl of nuclease-free water to resuspend the magnetic beads, mix thoroughly, let stand at room temperature for 2 min, centrifuge quickly for 5 sec, place on the magnetic rack for 2 min, take the supernatant and transfer it to a new PCR tube. Do not touch the magnetic beads.

[0144] 2.5 Reaction with library amplification reagent

[0145] (1) Take out the library amplification primer mixture, place it on ice to dissolve, vortex to mix thoroughly, centrifuge briefly, and place it on ice for later use.

[0146] (2) Mix 2xPCR mix by flicking gently and place on ice for later use.

[0147] (3) The reaction system was prepared according to Table 9:

[0148] Table 9: Library amplification reagent reaction system

[0149] Components Volume (μl) Sorting products 20 SJ50X(10uM) 2.5 SJ70X(10uM) 2.5 2xPCRmix 25 Total 50

[0150] (4) Use a pipette to gently pipette up and down to mix (5-10 times). After a brief centrifugation, place the tube in a PCR instrument and execute the following procedure as shown in Table 10:

[0151] Table 10: PCR instrument execution program

[0152]

[0153] 2.6 Product magnetic bead purification

[0154] (1) After completion, add 35 μl of magnetic beads to the above 50 μl PCR product and mix well.

[0155] (2) Let stand at room temperature for 5 minutes. Do not place it on the magnetic rack at this time.

[0156] (3) After 5 min, place the solution on a magnetic rack to allow it to settle and discard the supernatant.

[0157] (4) Add 200 μl of 80% ethanol, let stand for 30 seconds, then discard the supernatant and repeat once.

[0158] (5) After rapid centrifugation, use a 10 μl pipette to discard the remaining ethanol and place at room temperature to dry.

[0159] (6) Remove the tube from the magnetic rack, add 20 μl of nuclease-free water to resuspend the magnetic beads, mix thoroughly, let stand at room temperature for 2 min, centrifuge quickly for 5 sec, place on the magnetic rack for 2 min, take the supernatant and transfer it to a new PCR tube. Do not touch the magnetic beads to obtain the final library.

[0160] 2.7 Take 1 μl of the library and place it on the Qubit instrument to measure the concentration. The result shows that the library concentration is 102 ng / μl. The library is placed on the Agilent 2100 Bioanalyzer to analyze the fragment distribution range. The result is as follows: Figure 3 shown.

[0161] 2.8 The library was subjected to PE150 high-throughput sequencing, sequence alignment, and mutation analysis on the Illumina Novaseq platform. The data quality control results are shown in Table 11:

[0162] Table 11: Data quality control results

[0163] Sequencing data volume (G) 1.78 Sequencing base quality Q30 (%) 94.11 Sequencing base GC content (%) 54.87 Connector contamination rate (%) 10.33 Percentage of valid sequences (%) 15.01 Comparison rate (%) 100 Repetition rate (%) 0 Target hit rate (%) 100 Target area coverage (%) 100 Average coverage depth of target area (X) 277315.84 Target area coverage uniformity (%) 98.74 Insert length (bp) 245

[0164] From the quality control results, we can see that the alignment rate, on-target rate, coverage and uniformity are all very good, and the average sequencing depth can reach 270,000, indicating that the obtained data is highly credible. Then, we analyzed the mutations in the highly credible data and obtained the results shown in Table 12:

[0165] Table 12: Mutation analysis results

[0166] ref alt gDNA cDNA protein AF(%) G A 133738349G>A c.749G>A p.G250E 50.73 G A 133738363G>A c.763G>A p.E255K 9.19 A T 133738364A>T c.764A>T p.E255V 40.13 C T 133748283C>T c.944C>T p.T315I 99.86

[0167] From the results, we can see that 4 mutations were detected, and Figure 4 It can be seen that a compound mutation was detected, and c.749G>A and c.763G>A were detected simultaneously in the same clone (the area marked with a box in the figure). In the area marked with a box in the figure, the lowest mutation ratio among the four mutations was 9.19%.

[0168] Comparative Example 1

[0169] The RNA from the same bone marrow blood was used as a sample for nested PCR amplification and sequencing. The specific experimental steps are as follows:

[0170] 1. Reverse transcription of RNA into cDNA

[0171] (1) Remove Reaction Buffer, Random Primer, and 1000 ng RNA, place on ice to dissolve, vortex to mix thoroughly, centrifuge briefly, and place on ice for later use.

[0172] (2) Gently flick Enzyme Mix to mix thoroughly and place on ice for later use.

[0173] (3) The RNA sample was diluted to 4 μl with nuclease-free water, first reacted at 70°C for 5 min to open the secondary structure, and then quickly placed on ice for at least 5 min.

[0174] (4) Add reagents to the RNA sample tube as shown in Table 13:

[0175] Table 13: RNA Sample Tube Reagents

[0176] Components Volume (μl) Previous RNA 4 ReactionBuffer,RandomPrimer 4 EnzymeMix 2 Total 10

[0177] (5) Use a pipette to gently pipette and mix (5-10 times). After a brief centrifugation, place the mixture in a PCR instrument and execute the program as shown in Table 14:

[0178] Table 14: PCR instrument execution program

[0179] Temperature(℃) time 25 5min 42 60min 70 15min 4 Hold

[0180] 2. Nested PCR first round

[0181] (1) Take out 10x Buffer, dNTP, primer SMBF1 and SMAR, place them on ice to dissolve, vortex to mix thoroughly, centrifuge briefly and place on ice for later use.

[0182] (2) Mix LATaq by flicking gently and place on ice until ready for use.

[0183] (3) The reaction system was prepared as shown in Table 15:

[0184] Table 15: Nested PCR first round reaction system

[0185] Components Volume (μl) Previous cDNA 10 10xBuffer 2 dNTP (10 mM each) 1.6 LATaq (5U / μl) 0.3 SMBF1 (10 μM) 1 SMAR (10 μM) 1 Nuclease-free water 4.1 Total 20

[0186] Among them, the primer SMBF1 sequence is: TGACCAACTCGTGTGTGAAACTC, and the SMAR sequence is: TCCACTTCGTCTGAGATACTCGGATT.

[0187] (4) Use a pipette to gently pipette and mix (5-10 times). After a brief centrifugation, place the mixture in a PCR instrument and execute the program as shown in Table 16:

[0188] Table 16: PCR instrument execution program

[0189]

[0190] 3. Second round of nested PCR

[0191] (1) Take out 10x Buffer, dNTPs, primers SMAF and SMAR, dissolve them on ice, vortex to mix thoroughly, centrifuge briefly, and place on ice for later use.

[0192] (2) Mix LATaq by flicking gently and place on ice until ready for use.

[0193] (3) The reaction system was prepared as shown in Table 17:

[0194] Table 17: Nested PCR second round reaction system

[0195]

[0196]

[0197] Among them, the primer SMAF sequence is: CGCAACAAGCCCACTGTCT.

[0198] (4) Use a pipette to gently pipette up and down to mix (5-10 times), centrifuge briefly, and place in a PCR instrument to execute the program shown in Table 18:

[0199] Table 18: PCR instrument execution program

[0200]

[0201] 4. Product magnetic bead purification

[0202] (1) After completion, fill the product volume to 50 μl with nuclease-free water, then add 35 μl of magnetic beads to the above product and mix well.

[0203] (2) Let stand at room temperature for 5 minutes. Do not place it on the magnetic rack at this time.

[0204] (3) Place the solution on a magnetic rack and let it stand for clarification, then discard the supernatant.

[0205] (4) Add 200 μl of 80% ethanol, let stand for 30 seconds, and discard the supernatant. Repeat once.

[0206] (5) After rapid centrifugation, use a 10 μl pipette to discard the remaining ethanol and place at room temperature to dry.

[0207] (6) Remove the tube from the magnetic rack, add 20 μl of nuclease-free water to resuspend the magnetic beads, mix thoroughly, let stand at room temperature for 2 min, centrifuge quickly for 5 sec, place on the magnetic rack for 2 min, take the supernatant and transfer it to a new PCR tube. Do not touch the magnetic beads to obtain the final library.

[0208] 5. The library was sequenced on a first-generation sequencer, and then the sequencing results were analyzed for mutations. Figure 5 , Figure 6 and Figure 7 As shown, the bases of the mutation sites are clearly identifiable, and the corresponding mutation sites are c.749G>A (p.G250E), c.764A>T (p.E255V) and c.944C>T (p.T315I).

[0209] From the comparison of the detection results of Example 1 and Control Example 1, it can be seen that the method of the present invention can not only detect all mutation sites of the first-generation sequencing, but also detect an additional mutation site (c.763G>A, p.E255K), and the mutation rate of this site is 9.19%, which is lower than the detection limit of the first-generation sequencing.

[0210] Example 2 Sensitivity Experiment

[0211] In order to determine the minimum detection limit of the method of the present invention, standard products BCR-ABL1 (E13-E2) Fusion with ABL1 p.T315IPlus and BCR-ABL1 (E13-E2) Fusion without ABL1p.T315I plus were purchased, and a series of standard RNAs with gradient mutation ratios were mixed, with the mutation ratios being 10%, 2%, 1%, and 0.5%, respectively. The specific experimental steps refer to Example 1.

[0212] The data quality control results are shown in Table 19:

[0213] Table 19: Data quality control results

[0214]

[0215] From the quality control results, it can be seen that the alignment rate, on-target rate, coverage and uniformity are all very good, and the average sequencing depth is also very high, indicating that the data obtained by the detection method of the present invention is highly credible. Then, mutations are analyzed in the highly credible data, and the results are shown in Table 20:

[0216] Table 20: Mutation analysis results

[0217]

[0218]

[0219] from Figure 8-11 It can be seen that the standard samples with theoretical mutation ratios of 10%, 2%, and 1% can all detect p.T315I positive mutations, while the standard sample with theoretical mutation ratio of 0.5% has no positive mutations detected. Therefore, the sensitivity of the method of the present invention is 1%.

[0220] Example 3 Verification Test

[0221] In order to test the effect of the present invention, samples with a lower fusion ratio were selected as materials. Accordingly, clinical bone marrow fluid sample 2 was selected as material, the QPCR result of the sample was P210 positive, the ABL1 copy number was 69100, and the fusion ratio was about 0.08%. The specific experimental steps refer to Example 1.

[0222] The obtained library quality inspection concentration is 158ng / μl, and the fragment analysis chart is as follows Fig.12 The data quality control results are shown in Table 21:

[0223] Table 21: Data quality control results

[0224] Sequencing data volume (G) 1.55 Sequencing base quality Q30 (%) 95.88 Sequencing base GC content (%) 54.7 Connector contamination rate (%) 8.67 Percentage of valid sequences (%) 16.7 Comparison rate (%) 99.98 Repetition rate (%) 0 Target hit rate (%) 100 Target area coverage (%) 100 Average coverage depth of target area (X) 269160.09 Target area coverage uniformity (%) 98.74 Insert length (bp) 275

[0225] From the quality control results, we can see that the alignment rate, on-target rate, coverage and uniformity are all very good, and the average sequencing depth is close to 270,000, indicating that the obtained data is highly credible. Then, we analyzed the mutations in the highly credible data, and the results are shown in Table 22:

[0226] Table 22: Mutation analysis results

[0227] POS ref alt gDNA cDNA protein AF(%) 133738330 A G 133738330A>G c.730A>G p.M244V 1.21

[0228] From the results, it can be seen that 1 low-frequency mutation was detected, and its mutation ratio was 1.21%. However, when the site was verified by direct sequencing, no positive site was obtained, indicating that the present invention has higher sensitivity than direct sequencing and can detect low-frequency mutations.

[0229] Example 4 Verification Test

[0230] In order to test samples with lower fusion ratios and other sample types, this example selected clinical peripheral blood sample 3 as material, the QPCR result of which was P210 positive, the ABL1 copy number was 152,000, and the fusion ratio was about 0.014%. The specific experimental steps refer to Example 1.

[0231] The obtained library quality inspection concentration is 143ng / μl, and the fragment analysis chart is as follows Fig.13 The data quality control results are shown in Table 23:

[0232] Table 23: Data quality control results

[0233] Sequencing data volume (G) 1.51 Sequencing base quality Q30 (%) 95.68 Sequencing base GC content (%) 54.91 Connector contamination rate (%) 9.9 Percentage of valid sequences (%) 16.49 Comparison rate (%) 99.93 Repetition rate (%) 0 Target hit rate (%) 100 Target area coverage (%) 100 Average coverage depth of target area (X) 259640.06 Target area coverage uniformity (%) 98.74 Insert length (bp) 275

[0234] From the quality control results, we can see that the alignment rate, on-target rate, coverage and uniformity are all very good, and the average sequencing depth is close to 260,000, indicating that the obtained data is highly credible. Then, we analyzed the mutations in the highly credible data, and the results are shown in Table 24:

[0235] Table 24: Mutation analysis results

[0236] POS ref alt gDNA cDNA protein AF(%) 133738355 A G 133738355A>G c.755A>G p.Q252R 1.47 133748363 T C 133748363T>C c.1024T>C p.Y342H 1.60

[0237] It can be seen from the results that 2 low-frequency mutations were detected. However, when the site was verified by direct sequencing, no positive site was obtained, indicating that the present invention has higher sensitivity than direct sequencing and can detect low-frequency mutations.

[0238] It can be seen that the present invention improves the buffer system and enzyme system, applies the one-step method to reverse transcription and cDNA amplification, and can obtain the double-stranded cDNA of the transcript of M-type and m-type fusion genes in one step; the amplicon primers are screened to contain no dimers, hairpin structures and mismatches, and the UMI tags are introduced into the primers, which greatly improves the low-frequency detection sensitivity, the sensitivity can reach 1%, and can also detect compound mutations of ≥2 mutations. It can be seen that the present invention is a great improvement on the prior art.

[0239] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A system for amplifying BCR::ABL1 fusion gene transcripts, characterized in that: The system comprises a one-step amplification reagent, wherein the one-step amplification reagent comprises: a PCR buffer, a one-step primer mixture, a reverse transcriptase, a DNA polymerase, a genomic DNA removal enzyme, an RNA enzyme inhibitor and nuclease-free water; The one-step primer mixture includes primers BCR-Out1F, BCR-Out2F and ABL1-OutR, and the nucleotide sequences of the primers are shown in SEQ ID NO.1-3.

2. The system according to claim 1, characterized in that: The PCR buffer comprises: Tris-HCl, KCl, MgCl2, DTT, dNTP, Oligo d(T)23VN, random primers, and an enhancer; the enhancer is selected from a combination of one or more of betaine, NP-40, Tween20, and Triton-X100.

3. The system according to claim 1, characterized in that: The reverse transcriptase is selected from one or a combination of AMV Reverse Transcriptase, M-MuLV Reverse Transcriptase, SuperScript II Reverse Transcriptase, SuperScript III Reverse Transcriptase, SuperScript IV Reverse Transcriptase, and Maxima H Minus Reverse Transcriptase.

4. The system according to claim 1, characterized in that: The DNA polymerase is Taq enzyme or LA Taq enzyme; the genomic DNA removal enzyme is selected from one or a combination of DNase I, Exonuclease III, Exonuclease T7, Exonuclease VIII, and dsDNase; the RNase inhibitor is selected from one or a combination of SDS, urea, diatomaceous earth, guanidine thiocyanate, and RNasin.

5. A system for detecting compound mutations in the tyrosine kinase region of the BCR::ABL1 fusion gene, characterized in that: The system comprises the amplification system according to any one of claims 1 to 4, and further comprises a kinase region amplification reagent and a library amplification reagent; The kinase region amplification reagent includes: 2xPCRmix, amplicon primer mixture and nuclease-free water; the library amplification reagent includes: 2xPCRmix and library amplification primer mixture; The amplicon primer mixture includes primers ABL1F, ABL1R, ABL2F, ABL2R, ABL3F, ABL3R, ABL4F and ABL4R, and the nucleotide sequence thereof is shown in SEQ ID NO.4-11; in the nucleotide sequence, N represents a random base, and the random base has 12 positions; The library amplification primer mixture includes primer SJ50X and primer SJ70X, the nucleotide sequence of primer SJ50X is shown in SEQ ID NO.12, and the nucleotide sequence from positions 30 to 37 is the index sequence of DNA bases; the nucleotide sequence of primer SJ70X is shown in SEQ ID NO.13, and the nucleotide sequence from positions 25 to 32 is the index sequence of DNA bases.

6. A kit for detecting compound mutations in the tyrosine kinase region of the BCR::ABL1 fusion gene, characterized in that: The kit comprises the system according to claim 5.

7. A method for detecting compound mutations in the tyrosine kinase region of BCR::ABL1, characterized in that: The following steps are involved: S1. Extract RNA nucleic acid, quantify it, and react it with the one-step amplification reagent according to claim 1 or 5, and purify the amplified product; S2. reacting the purified product in step S1 with the kinase region amplification reagent according to claim 5, and sorting the reaction products; S3. reacting the product sorted in step S2 with the library amplification reagent described in claim 5, and purifying the reaction product again to obtain a final library; S4. The final library obtained after purification in step S3 is subjected to high-throughput sequencing, sequence comparison and mutation analysis to finally obtain the result of compound mutation in the tyrosine kinase region of BCR::ABL1.

8. The method according to claim 7, characterized in that: The amount of RNA input used in the reaction with the one-step amplification reagent in step S1 is 500-3000 ng.

9. The method according to claim 7, characterized in that: The step S1 also includes a PCR reaction after reacting with a one-step amplification reagent, and the PCR reaction program is 50°C, 30 minutes; 95°C 5 minutes; 95°C 20 seconds, 60°C 20 seconds, 68°C 2 minutes, 30 cycles; 68°C 5 minutes.

10. Use of the system according to any one of claims 1 to 4, the system according to claim 5, the kit according to claim 6, or the method according to any one of claims 7 to 9 in detecting drug resistance of leukemia patients to tyrosine kinase inhibitors.

Images