Synergistic effects for increasing insulin sensitivity

Abstract

The present invention relates to compositions and methods for treating metabolic disorders.

Description

[0001] This application is an international application that claims priority to U.S. Provisional Patent Application No. 63 / 324,515 filed on March 28, 2022, the contents of which are incorporated herein by reference in their entirety.

[0002] All patents, patent applications, and publications cited herein are hereby incorporated by reference in their entirety. The disclosures of these publications are hereby incorporated by reference in their entirety into this application in order to more fully describe the state of the art as known to those skilled in the art as of the date of the invention described and claimed herein.

[0003] This patent disclosure contains material that is subject to copyright protection. The copyright owner has no objection to the facsimile reproduction by anyone of the patent document or the patent disclosure, as it appears in the U.S. Patent and Trademark Office patent files and records, but otherwise reserves any and all copyrights whatsoever. Background Art

[0004] Obesity and overweight now affect more than half of the adult U.S. population, and the obesity epidemic is followed by an increase in the prevalence of type 2 diabetes about a decade after the onset of the obesity epidemic. Not only is the growing obesity epidemic fueling the increase in type 2 diabetes, but treatments for type 2 diabetes that induce weight loss can be used to combat both health problems and improve public health. Summary of the invention

[0005] Aspects of the invention relate to a composition comprising a therapeutically effective amount of at least one flavanone and a therapeutically effective amount of at least one flavonol. For example, the flavanone is naringenin. For example, the flavonol is myricetin.

[0006] In an embodiment, the composition further comprises a therapeutically effective amount of at least one carotenoid. For example, the at least one carotenoid is selected from the group consisting of beta carotene, lycopene or lutein.

[0007] In embodiments, the flavanone is naringenin, wherein the flavonol is myricetin, and wherein the carotenoid is beta carotene.

[0008] In an embodiment, the composition further comprises a sufficient amount of a pharmaceutically acceptable carrier.

[0009] In an embodiment, the composition comprises from about 150 mg to about 900 mg of at least one flavanone.

[0010] In embodiments, the composition comprises from about 1 mg to about 100 mg of at least one flavonol.

[0011] In an embodiment, the composition comprises from about 1 mg to about 12 mg of at least one carotenoid.

[0012] In an embodiment, the composition further comprises one or more additional active agents. For example, the additional active agent comprises an anti-obesity agent.

[0013] In embodiments, the composition is provided in the form of an injectable solution, an oral dosage, a topical cream, a topical gel, or a medical food.

[0014] Aspects of the invention also relate to a method for localized fat reduction. In embodiments, the method comprises administering to a site of a subject a therapeutically effective amount of a composition as described herein.

[0015] In addition, aspects of the invention relate to a method for treating a subject suffering from a metabolic disorder. For example, the metabolic disorder includes obesity or an insulin resistance disease, such as type 2 diabetes, polycystic ovary syndrome, non-alcoholic steatohepatitis, or metabolic syndrome.

[0016] In embodiments, the method comprises administering to the subject a therapeutically effective amount of a composition as described herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Shown is the expression of UCP1 and GLUT4 mRNA in human adipocyte cultures treated with a combination of the CDK5 inhibitor flavonol and naringenin. Human adipocyte cultures from individuals with obesity were treated with 8 μM naringenin extract (nar) and 2.5 μM myricetin, 2.5 μM quercetin or 2.5 μM kaempferol for seven days.

[0018] Figure 2 Shown is the synergistic gene expression effect of myricetin and naringenin in human adipocytes. Mature human adipocytes derived from the stromal vascular fraction of adult adipose tissue from individuals with obesity and diabetes were differentiated in culture and treated with 8 μM naringenin (in sweet orange extract) and 2.5 μM myricetin for seven days. C = vehicle control, nar = naringenin extract, and myr = myricetin, * indicates p ≤ 0.05 by one-way ANOVA.

[0019] Figure 3The concentration dependence of the effects of myricetin and naringenin on gene expression in human adipocytes is shown. Panels a and b: Naringenin concentration curves with a constant concentration of myricetin (3 μM myr). Panel a shows the UCP1 mRNA content, while panel b shows the GLUT4 mRNA content. Naringenin (nar) was added in a concentration range of 0.03 μM to 8 μM. Naringenin addition increased gene expression in a concentration-dependent manner. Panels c and d: Myricetin concentration curves with a constant concentration of naringenin (8 μM nar). Panel c shows the UCP1 mRNA content, while panel d shows the GUUT4 mRNA content. Adipocytes were treated with 8 μM naringenin extract (nar) for seven days. Myricetin (myr) was added in a concentration range of 0.1 μM to 6 μM as shown.

[0020] Figure 4 Shown are adipocytes treated with 8 μM naringenin extract (naringeninext, ne) and 5 nM to 50 nM myricetin (myr).

[0021] Figure 5 Upregulation of metabolic genes by naringenin and β-carotene with myricetin (rym) is shown. Top panel: Naringenin and β-carotene synergistically induce gene expression. Differentiation cultures of human adipocytes from overweight or obese donors were treated for 7 days with 8 μM naringenin extract (nar) and 2 μM βC as indicated. (* indicates statistical synergy). Bottom panel: Myricetin (50 nM) enhances the effect of nar+βC (NRβC) on gene expression.

[0022] Figure 6 Shown is UCP-1 mRNA expression after 7 days of exposure to naringenin orange extract.

[0023] Figure 7 Shown is UCP-1 mRNA expression in adult abdominal fat explants from 3 donors.

[0024] Figure 8 Naringenin was shown to increase the metabolic rate of human adipocytes.

[0025] Fig. 9 Adiponectin mRNA was shown to increase in a manner similar to UCP-1.

[0026] Fig.10 It is shown that the protein levels of UCP-1 and adiponectin increased gradually over 7 days at 8 μM.

[0027] Fig.11It is shown that 150 mg of naringenin taken three times a day in orange extract capsules increased metabolic rate by 3%. The blue line shows her metabolic rate at the beginning of the study before fat had a chance to increase UCP-1. The green line is what her metabolic rate looked like after 8 weeks. The orange line subtracts the blue line from the green line to give the actual increase in metabolic rate from baseline compared to the end of the study.

[0028] Fig.12 It is shown that a synergistic increase in gene expression for thermogenesis and insulin sensitivity was observed after 7 days of treatment of human adipocytes with 8 μM naringenin and 2 μM β-carotene in orange extract.

[0029] Fig.13 The addition of the flavonoid myricetin (rym) to 8 μM nar extract at concentrations ranging from 0.1 μM to 6 μM is shown. The lowest concentration tested (0.1 μM) had the greatest activity for enhancing nar extract activity to induce UCP1 expression.

[0030] Fig.14 It was shown that myricetin (Rym) along with the combination of naringenin extract and β-carotene was most active at 50 nM.

[0031] Fig.15 The mRNA data levels after 7 days of treatment are provided, showing that combining myricetin with NR does not upregulate SIRT 1 or SIRT3 mRNA compared to NR alone.

[0032] Fig.16 Western blot data of SIRT3 protein levels are provided, showing that the addition of myricetin to NR does not increase SIRT3 protein levels.

[0033] Fig.17 Western blot data of PGC-1α protein levels are provided, showing that myricetin and NR do not induce PGC-1α compared to NR or myricetin alone.

[0034] Fig.18 Shown is the PPARγ-Ser-273 level after NRBC treatment.

[0035] Fig.19 Data are presented that demonstrate that the addition of myricetin to NRBCs does not further reduce PPARgP-273 relative to NRBCs.

[0036] Fig. 20Provitamin A carotenoids and NR are shown to act synergistically to increase UCP1 mRNA levels. Adipocytes from four obese donors were treated with vehicle (control) or 8 μM NR and 2 μM carotenoids for seven days. Panel A: NR+BC; Panel B: NR+lutein; Panel C: NR+lycopene mRNA levels were measured using quantitative RTPCR. Data are presented as least squares mean ± standard error. Synergy for mRNA was calculated as: the sum of the differences of ((NR-control)+(BC-control)) relative to (NRBC-control). *p<0.001 for synergy, relative to the sum of the differences of NRBC. NR: naringenin, BC: beta-carotene.

[0037] Fig.21 NR and BC are shown to synergistically induce metabolic genes. Panel A provides mRNA content. Panel B provides a Western blot of protein content. Panel C provides a graph showing protein content measured with β-actin as a loading control. Adipocytes from three or more donors with obesity were treated for seven days. mRNA data are expressed as least squares mean ± standard error. Synergy for mRNA was calculated as: the sum of the differences of ((NR-control)-(BC-control)) relative to (NRBC-control). *p<0.05 for synergy. NR: naringenin, BC: β-carotene, NRBC: naringenin and β-carotene

[0038] Fig. 22 NRBCs are shown to upregulate a subset of key regulatory proteins, while mRNA is not increased. Panel A provides data for PPARα. Panel B provides data for PPARγ. Panel C provides data for PGC-1α. Panel D provides data for NAMPT. Adipocytes from three to five obese donors were treated for seven days. Protein was measured by Western blotting using β-actin to adjust the loading. mRNA was quantified by real-time PCR. Data are expressed as least squares mean ± standard error, *p<0.001, NR: naringenin, BC: β-carotene, NRBC: naringenin and β-carotene

[0039] Fig.23 Whole transcriptome sequencing analysis of pathways stimulated by naringenin and β-carotene (NRBC) is shown. Adipocytes from two donors with BMI of 27 kg / m2 and 36 kg / m2 were treated with cell culture medium (vehicle control) or NRBC for seven days. cDNA libraries from expressed transcripts were constructed, sequenced, and analyzed for differential gene expression. Gene sets with a false discovery rate (FDR) ≤ 5% were considered significantly enriched, and the top pathways are shown.

[0040] Fig.24RT-PCR validation of genes upregulated by naringenin and beta carotene (NRBC) in RNA sequencing analysis is shown. Adipocytes from three donors with obesity were treated for seven days. mRNA levels were measured using quantitative RT-PCR. Data are expressed as mean ± standard error, *p < 0.001.

[0041] Fig.25 Relative receptor content in the cells processed by white adipocytes (untreated) and NRBC is shown. Figure A shows the data of low abundance. Figure B shows the data of high abundance. Adipocytes from two donors with obesity were processed with cell culture medium (control) or NRBC for seven days, and transcript sequencing analysis was performed. Data are expressed as average standardized transcript counts (DEseq2). * Indicates that the Padj of control is <0.002 relative to NRBC. β adrenergic receptor (β1AR, β2AR, β3AR), G protein-coupled bile acid receptor (TGR5), transient receptor potential cation channel subfamily M member 8 (TRPM8), melanocortin-1 receptor (MC1R), adenosine receptor A1 and A2B (ADORA1, ADORA2B), natriuretic peptide receptor (NPR1, NPR3), G protein-coupled estrogen receptor 1 (GPER1), parathyroid hormone receptor 1 (PTHR1), growth hormone receptor (GHR).

[0042] Fig.26 Hormone-stimulated lipolysis in white adipocytes (untreated) and NRBC-pretreated cells is shown. After 7 days of pretreatment with vehicle (untreated) or NRBC, adipocytes were exposed to receptor agonists in KRB buffer for 4.5 hours. Supernatants were removed to measure glycerol. Data are presented as least squares mean ± standard error from experiments using cells from four different donors with a BMI range of 27 to 36, with at least 6 replicates per cell (* indicates difference between untreated white adipocytes and NRBC-treated adipocytes, p≤0.02) 200 μM cAMP 8-Cpt-cAMP, 0.1 μM ANP atrial natriuretic peptide, 1 μM PTH parathyroid hormone (1-34), 1 μM isoprot isoproterenol, 1 μM dobutam dobutamine, 1 μM estradiol, 250 ng / ml GH growth hormone, 1 μM ATH adrenocorticotropic hormone, 30 μM CDCA chenodeoxycholic acid, 1 μM adenosine, 100 μM menthol.

[0043] Fig. 27The analysis of RXR isoforms bound to the PPARγ complex of immunoprecipitation is shown. Adipocytes were treated with vehicle or NRBC for seven days. RXRγ, RXRα and PPARγ protein content were analyzed by western blotting. For whole cell protein content (input) analysis, 50 μg protein lysates were loaded in each channel. PPARγ was immunoprecipitated from 600 μg of the same whole cell lysate for PPARγ cofactor binding analysis. Anti-IgG κ light chain secondary antibody was used for detection. This experiment was repeated three times with adipocytes from obese donors.

[0044] Fig.28 A schematic diagram showing the paradigm by which NRBC remodels white adipocytes is provided. NR and BC bind to nuclear receptors and activate gene expression at PPRE motifs. UCP1 and other uncoupling compounds and mitochondrial proteins mediate multiple thermogenic, energy-consuming enzymatic cycles. PM20D 1 regulates the synthesis and degradation of N-acylamino acids (NAA), molecules that directly uncouple mitochondria and increase energy expenditure. The synthesis and breakdown of phosphocreatine by mitochondrial creatine kinases CKMT 1A, CKMT 1B, and CKMT2 promote ATP-coupled respiration and enhance oxygen consumption. PDK4 directs pyruvate to synthesize glycerol, fatty acids, and TG to promote ineffective TG recycling. Lipolytic receptors and PKA are upregulated, thereby increasing responsiveness to hormones and lipolysis. Fatty acids are transferred to mitochondria to stimulate thermogenesis. Genes are activated to produce bioactive peptides and lipid factors, which have autocrine insulin-sensitizing effects and are secreted into the circulation. NR (naringenin), BC (beta-carotene) are produced by Biorender.com

[0045] Fig.29 NR and BC were shown to synergistically induce metabolic proteins. Fig.21 Uncropped Western blot of proteins provided in. Adipocytes from obese donors were treated for seven days. NR (naringenin), BC (beta carotene), NRBC (naringenin and beta carotene)

[0046] Fig.30 NRBCs were shown to upregulate a subset of key regulatory proteins without an increase in mRNA. Fig. 22 Uncropped Western blot of proteins provided in. Adipocytes from obese donors were treated for seven days. NR (naringenin), BC (beta carotene), NRBC (naringenin and beta carotene) DETAILED DESCRIPTION

[0047] The specific implementation of one or more embodiments is provided herein. However, it should be understood that the present invention can be embodied in various forms. Therefore, the specific details disclosed herein should not be interpreted as limiting, but as the basis of the claims and as a representative basis for teaching those skilled in the art to adopt the present invention in any appropriate manner.

[0048] In order to make the present invention more easily understood, some terms are first defined. Additional definitions are set forth throughout this disclosure. Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those commonly understood by those of ordinary skill in the art in relation to the present invention.

[0049] Any heading provided herein is not a limitation of the various aspects or embodiments of the invention, which aspects or embodiments can be obtained by reference to the entire specification. Therefore, the terms defined immediately below are more fully defined by reference to the entire text of this specification.

[0050] The phrases or terms in the present disclosure are used for the purpose of description rather than limitation, so that the phrases or terms of the present specification will be interpreted by those skilled in the art based on the teachings and guidance.

[0051] Unless the context clearly dictates otherwise, the singular forms "a / an" and "the / the" include plural references. In the claims and / or specification, when used in conjunction with the term "comprising", the use of the word "a / an" may mean "one", but it is also consistent with the meaning of "one or more", "at least one", and "one or more than one".

[0052] Furthermore, "and / or" should be considered as a specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and / or" used in phrases such as "A and / or B" is intended to include A and B, A or B, A (alone) and B (alone). Similarly, the term "and / or" used in phrases such as "A, B and / or C" is intended to include A, B and C; A, B or C; A or B; A or C; B or C; A and B; A and C; B and C; A (alone); B (alone); and C (alone).

[0053] Wherever an embodiment is described with the language "comprising / including," this includes other similar embodiments described with respect to "consisting of" and / or "consisting essentially of."

[0054] Wherever any phrase "for example," "such as," "including," etc. is used herein, unless expressly stated otherwise, it should be understood that the phrase "and but not limited to" follows it. Similarly, "one example," "exemplary," etc. should be understood as non-limiting.

[0055] The term "substantially" may refer to the qualitative condition of exhibiting a characteristic or property of interest in whole or to a near-whole limit or degree. One of ordinary skill in the art will appreciate that biological and chemical phenomena are rarely, if ever, completed and / or performed to completeness, or to achieve or avoid an absolute result. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0056] The term "substantially" allows deviations from the descriptor that do not adversely affect the intended purpose. Even if the term "substantially" is not explicitly recited, the descriptive term should be understood to be modified by the term "substantially".

[0057] The terms "comprising" and "including" and "having" and "involving" (and similarly "includes," "comprising," "having," and "involving") and the like are used interchangeably and have the same meaning. Specifically, each of these terms is defined to be consistent with the common U.S. patent law definition of "comprising," and thus should be interpreted as open terms meaning "at least the following," and should also be interpreted as not excluding additional features, limitations, aspects, etc. Thus, for example, "a process involving steps a, b, and c" means a process that includes at least steps a, b, and c. Whenever the terms "a" or "an" are used, they should be understood to mean "one or more," unless such an interpretation does not make sense in the context.

[0058] The term "about" or "approximately" can mean within an acceptable error range for a value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 3 or more than 3 standard deviations, according to the practice in the art. Alternatively, "about" can mean a range of up to 20%, e.g., up to 10%, up to 5%, or up to 1% of a given value. Alternatively, with respect to biological systems or processes, the term can mean within an order of magnitude of a value, e.g., within 5-fold or within 2-fold.

[0059] Units, prefixes and symbols are represented by their international system of units (SI) recognized forms. Numerical ranges include the numerical values ​​defining the scope, and any individual value provided herein can serve as the endpoint value of a scope including other individual values ​​provided herein. For example, a group of values ​​such as 1, 2, 3, 8, 9 and 10 is also disclosed to the numerical ranges of 1-10, 1-8, 3-9, etc. Similarly, the disclosed range is the disclosure of each individual value covered by the scope. For example, the stated range of 5-10 is also disclosed to 5, 6, 7, 8, 9 and 10.

[0060] "Median" may refer to the median value obtained from a population of subjects suffering from cancer. The median value may be a previously determined reference value or may be a value determined contemporaneously.

[0061] It should be understood that although the terms first, second, etc. can be used to describe various elements in this article, these elements cannot be limited by these terms. These terms are only used to distinguish one element from another element. For example, without departing from the scope of the present disclosure, the first subject can be referred to as the second subject, and similarly, the second subject can be referred to as the first subject. The first subject and the second subject are both subjects, but they are not the same subject. In addition, the terms "subject", "user" and "patient" are used interchangeably in this article.

[0062] The term "consisting essentially of..." can refer to a composition whose only active ingredient is the specified active ingredient, however, other compounds that serve to stabilize, preserve, etc. the formulation may be included, but are not directly involved in the therapeutic action of the specified active ingredient. In some embodiments, the term "consisting essentially of..." can refer to components that promote the release of the active ingredient. For example, the composition described herein may consist essentially of at least one flavanone and at least one flavonol. Such compositions may also be other compounds that serve to stabilize, preserve, or promote the release of the formulation, but are not directly involved in the therapeutic action of the specified active ingredient.

[0063] The term "consisting of" may refer to a composition containing an active ingredient and a pharmaceutically acceptable carrier or excipient. For example, the composition described herein may consist of at least one flavanone and at least one flavonol and a pharmaceutically acceptable carrier or excipient.

[0064] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The following references provide those of ordinary skill in the art with general definitions of many of the terms used herein: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker, ed., 1988); The Glossary of Genetics, 5th ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale and Marham, The Harper Collins Dictionary of Biology (1991), Molecular Cloning: a Laboratory Manual 3rd ed., JF Sambrook and DW Russell, eds. Cold Spring Harbor Laboratory Press 2001; Recombinant Antibodies for Immunotherapy, Melvyn Little, ed. Cambridge University Press 2009; "Oligonucleotide Synthesis" (MJ Gait, ed., 1984); "Animal Cell Culture" (RI Freshney, ed., 1987); "Methods in Enzymology" (Academic "PCR: The Polymerase Chain Reaction", (Mullis et al., 1994), "A Practical Guide to Molecular Cloning" (Perbal Bernard V., 1988); "Phage Display: A Laboratory Manual" (Barbas et al., 2001). The contents of these references and other references containing standard protocols (including manufacturers' instructions) widely known and relied upon by those skilled in the art are hereby incorporated by reference as part of the subject matter disclosed herein.

[0065] Various exemplary embodiments of the invention described herein may include compositions and methods for treating a subject suffering from a metabolic disorder or preventing the onset of a metabolic disorder, such as obesity, insulin resistance, type 2 diabetes, and non-alcoholic steatohepatitis. For example, an embodiment may include administering to a subject a composition comprising a therapeutically effective amount of at least one flavanone and at least one flavonol. In an embodiment, the composition may also include at least one carotenoid. In an embodiment, the composition may be applied to the subject's skin in the form of a topical cream or gel, ingested by the subject in the form of food or oral dosage, or injected in the form of an injectable solution.

[0066] In embodiments, the composition comprises a therapeutically effective amount of at least one active agent, such as at least one flavanone and at least one flavonol. The term "active agent" may refer to a compound as described herein, such as at least one flavanone and / or at least one flavonol. For example, one or more active ingredients may be responsible for a desired biological effect (i.e., for treating or preventing a metabolic disease).

[0067] In embodiments, the composition may optionally include at least one additional active agent, such as at least one carotenoid. In embodiments, the one or more additional active agents may also include anti-obesity agents such as phentermine and other agents described herein. The phrase "additional active agent" may refer to an agent that exerts pharmacological activity or any other beneficial activity in addition to the compound of the composition of the invention.

[0068] Those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific compositions and methods described herein. Such equivalents are considered to be within the scope of the present invention and are covered by the appended claims.

[0069] Aspects of the present disclosure relate to a composition comprising a therapeutically effective amount of at least one flavanone and at least one flavonol, optionally comprising at least one carotenoid.

[0070] As used herein, "therapeutic composition" may refer to a composition comprising one or more active ingredients that are required to cause an effect when an effective amount of the composition is administered to a subject in need thereof. For example, the effect may be prevention or treatment of metabolic disorders or localized fat reduction.

[0071] In an embodiment, the composition may include a therapeutically effective amount of at least one flavanone. For example, the flavanone may be naringenin. Naringenin is a flavanone, a type of flavonoid, odorless and colorless. It is the main flavanone in grapefruit and is present in a variety of fruits and herbs. Naringenin has a skeletal structure of a flavanone with three hydroxyl groups at 4' carbon, 5 carbon and 7 carbon. It can exist in the form of a diol, naringenin, or in the form of its glycoside, naringin, which has added a disaccharide neohesperidose attached via a glycosidic bond at 7 carbon. Naringenin and its glycosides are present in a variety of herbs and fruits, including grapefruit, bergamot, lime, sour cherry, tomato, cocoa, Greek oregano, water mint, quercetin and beans. The ratio of naringenin to naringin varies depending on the source, as does the enantiomeric ratio. Naringenin separation methods are well known in the art. See, for example, Wang, Chung-Yi et al. "Quality changes in high hydrostatic pressure and thermal pasteurized grapefruit juice during cold storage." Journal of foodscience and technology 55.12 (2018): 5115-5122.

[0072]

[0073]

[0074] Embodiments may also include a therapeutically effective amount of at least one flavonol. Flavonols are a class of flavonoids found in a wide variety of fruits and vegetables. The backbone and substituent numbering of flavonols is:

[0075]

[0076] Non-limiting examples of flavonols include 3-hydroxyflavone, erucicin, fisetin, galangin, gossypiiin, kaempferol, kaempferol, isorhamnetin, morin, myricetin, naringenin, geraniol, quercetin, rhamnetin, and rhamnetin.

[0077] Myricetin is a flavonoid that can be present in many common foods such as berries, vegetables, fruits, tea and red wine. It is extracted from all parts of Japanese bayberry (Myrica Rubra), and in Japan it is used to flavor snacks and beverages. It is listed as generally recognized as safe (GRAS) by the Flavor and Extract Manufacturer Association of the United States, and recently by the Joint Food and Agriculture Organization of the United Nations (FAO) / World Health Organization (WHO) Joint Expert Committee on Food Additives (Expert Committee on Food Additives, JECFA) It is judged to be safe under the current estimated dietary exposure. JECFA has established specifications related to the identity and purity of myricetin used as a flavoring agent.

[0078]

[0079] Quercetin is a flavonol found in fruits, vegetables, leaves, seeds, and grains. For example, quercetin can be found in caper buds, lovage leaves, buckwheat seeds, radish leaves, dill, cilantro, fennel leaves, red onions, chicory, watercress, kale, aronia, moss blueberries, cranberries, lingonberries, and plums.

[0080]

[0081] Kaempferol is a natural flavonol found in a variety of plants and plant-derived foods. Common foods containing kaempferol include apples, grapes, tomatoes, green tea, potatoes, onions, broccoli, Brussels sprouts, squash, cucumbers, lettuce, green beans, peaches, blackberries, raspberries, and spinach. Plants known to contain kaempferol include aloe vera, Coccinia grandis, Cuscuta chinensis, Euphorbia pekinensis, Glycine max, Hypericum perforatum, Pinus sylvestris, Moringa oleifera, Rosmarinus officinalis, Sambucus nigra, and Toona sinensis, as well as Ilex. It is also found in endive.

[0082]

[0083] Embodiments can also include at least one carotenoid of therapeutically effective amount, such as beta-carotene, lutein or lycopene. Carotenoids are yellow, orange and red organic pigments produced by plants and algae and several bacteria and fungi. [There are more than 1,100 known carotenoids here, which can be divided into two categories, namely lutein (which contains oxygen) and carotene (which is a pure hydrocarbon and does not contain oxygen). Carotenoids can be derivatives of tetraterpenes, which means that they are produced by 8 isoprene molecules and contain 40 carbon atoms. Carotenoids absorb wavelengths (violet to green light) ranging from 400 nanometers to 550 nanometers. This makes the compound appear dark yellow, dark orange or dark red. The structure of carotenoids confers biological capabilities, including photosynthesis, light protection, plant coloring and cell signaling. The structure of carotenoids is a polyene chain composed of 9-11 double bonds, and in the case of not wishing to be bound by theory, the end is in a ring. This structure of conjugated double bonds produces a high reduction potential or the ability to transfer electrons in the entire molecule.

[0084]

[0085] Structure of carotenoids: polyene tail with double bond and terminal ring (without wishing to be bound by theory)

[0086] Methods for isolating carotenoids are well known in the art. See, for example, Vieira, Flávia A. and Sónia M M Ventura. "Efficient Extraction of Carotenoids from Sargassum muticum Using Aqueous Solutions of Tween 20." Marine drugs 17.5 (2019): 310.

[0087] Lutein is one of the xanthophylls and one of the 600 known naturally occurring carotenoids. Lutein is synthesized only by plants and, like the other xanthophylls, is found in large quantities in green leafy vegetables such as spinach, kale, and yellow carrots.

[0088]

[0089] Lycopene is a bright red carotenoid hydrocarbon found in tomatoes and other red fruits and vegetables such as red carrots, watermelon, gac melon, and papaya, but not in strawberries or cherries. Although lycopene is chemically a carotene, it does not have vitamin A activity. Non-red foods may also contain lycopene, such as asparagus and parsley.

[0090]

[0091] β-carotene is an organic, intensely reddish-orange pigment abundant in plants and fruits. It is a member of the carotene family, which is a terpenoid (isoprenoid) biochemically synthesized from eight isoprene units and therefore has 40 carbons. Among the carotenes, β-carotene is distinguished by having β-rings at both ends of the molecule. β-carotene is biosynthesized by geranylgeranyl pyrophosphate. β-carotene is the most common form of carotene in plants. In nature, β-carotene becomes a precursor (inactive form) of vitamin A via the action of β-carotene 15,15′-monooxygenase.

[0092] As described herein, aspects of the present disclosure relate to compositions comprising a therapeutically effective amount of at least one flavanone and at least one flavonol, optionally comprising at least one carotenoid. In addition, aspects of the present disclosure relate to methods, comprising a therapeutically effective amount of a composition comprising at least one flavanone and at least one flavonol, optionally comprising at least one carotenoid. The term "therapeutically effective amount" may refer to those amounts that will have a therapeutic effect when applied to a subject in view of the nature and severity of the subject's disease or condition, such as an amount that will cure, prevent, inhibit, alleviate, or at least partially contain or partially prevent a target disease or condition. In some embodiments, the term "therapeutically effective amount" or "effective amount" may refer to an amount that effectively prevents or improves a disease or condition (such as a metabolic disorder) or the development of a disease or condition when a therapeutic agent is applied to a cell, tissue, or subject alone or in combination with an additional therapeutic agent. A therapeutically effective dose also refers to an amount of a therapeutic agent sufficient to cause symptom improvement, such as the treatment, cure, prevention, alleviation, or improvement of a related medical condition (such as localized fat reduction), or an increase in the rate of treatment, cure, prevention, or improvement of such a condition. When applied to an individual active ingredient administered alone, a therapeutically effective dose may refer to that ingredient alone. When applied to a combination, a therapeutically effective dose may refer to the combined amounts of the active ingredients that produce the therapeutic effect, whether administered in combination, serially or simultaneously.

[0093] The dosage may vary depending on many factors known to those of ordinary skill in the art. For example, the dosage may vary depending on the identity, age, sex, health condition, weight, size and condition of the subject or sample being treated, as well as the nature and extent of the condition. The dosage may also depend on the effect desired by the physician, the pharmacodynamic characteristics of the active ingredient and its mode and route of administration, the time of administration of the active ingredient; the type, frequency and effect of simultaneous treatment; and the excretion rate. These amounts can be readily determined by those skilled in the art.

[0094] The toxicity and therapeutic efficacy of the active ingredients described herein can be determined in vitro, in cell culture or experimental animals by standard pharmaceutical procedures. The data obtained from these in vitro and cell culture assays and animal studies can be used to formulate a dosage range for humans. The dosage can vary depending on the dosage form used and the route of administration utilized. The exact formulation, route of administration and dosage can be selected by individual physicians based on the patient's condition. (See, for example, Fingl, E. et al. (1975), "The Pharmacological Basis of Therapeutics," Chapter 1, page 1).

[0095] Depending on the severity of the condition and the subject's responsiveness to treatment, administration may be a single or multiple administrations, with the course of treatment lasting from days to weeks, months or years, or until a cure is achieved or a reduction in the disease state is achieved. Alternatively, the compositions are administered to prevent the occurrence of metabolic disorders in subjects at risk of developing the metabolic disorder. The compositions may be administered over a long period of time (e.g., days, weeks, months or years) to prevent the occurrence of metabolic disorders.

[0096] In some embodiments, the therapeutically effective amount of a carotenoid such as beta-carotene, lycopene, or lutein may comprise less than about 1 mg / day, about 1 mg / day, about 2 mg / day, about 3 mg / day, about 4 mg / day, about 5 mg / day, about 6 mg / day, about 7 mg / day, about 8 mg / day, about 9 mg / day, about 10 mg / day, about 11 mg / day, about 12 mg / day, about 13 mg / day, about 14 mg / day, about 15 mg / day, about 16 mg / day, about 17 mg / day, about 18 mg / day, about 19 mg / day, about 20 mg / day, about 21 mg / day, about 22 mg / day, about 23 mg / day, about 24 mg / day, about 25 mg / day, or greater than 25 mg / day. For example, the therapeutically effective amount of beta-carotene comprises about 12 mg / day or less than about 12 mg / day.

[0097] In some embodiments, a therapeutically effective amount of a flavanone such as naringenin may comprise about 10 mg / day, about 50 mg / day, about 100 mg / day, about 200 mg / day, about 300 mg / day, about 400 mg / day, about 500 mg / day, about 600 mg / day, about 700 mg / day, about 800 mg / day, about 900 mg / day, about 1000 mg / day, about 1100 mg / day, about 1200 mg / day, or about 1500 mg / day.

[0013] In some embodiments, the therapeutically effective amount of naringenin is about 150 mg / day, about 1300 mg / day, about 1400 mg / day, about 1500 mg / day, about 1600 mg / day, about 1700 mg / day, about 1800 mg / day, about 1900 mg / day, about 2000 mg / day, about 2500 mg / day, about 3000 mg / day, about 3500 mg / day, about 4000 mg / day, about 4500 mg / day, about 5000 mg / day, or greater than about 5000 mg / day. For example, the therapeutically effective amount of naringenin is between about 150 mg / day and about 900 mg / day.

[0098] In some embodiments, a therapeutically effective amount of a flavonol, such as myricetin, can comprise about 1 mg / day, about 5 mg / day, about 10 mg / day, about 20 mg / day, about 30 mg / day, about 40 mg / day, about 50 mg / day, about 60 mg / day, about 70 mg / day, about 80 mg / day, about 90 mg / day, or about 100 mg / day.

[0099] In embodiments, a therapeutically effective amount of a compound and / or composition may be administered once a day, twice a day, three times a day, or more as needed.

[0100] According to one embodiment of the present disclosure, the compositions can be applied at least once a day. For example, the compositions can be applied every day. According to another embodiment, the compositions can be applied twice a day, three times a day or more. In embodiments, the compositions can be applied weekly, such as about once a week or about twice a week. In embodiments, the compositions can be applied monthly, such as about once a month or about twice a month.

[0101] According to one embodiment of the present disclosure, the composition can be applied to the subject for a long time. For example, when treating a subject suffering from a chronic disease or illness, this is the case. In other embodiments, as long as the subject is under the risk of disease or illness, or as long as the symptoms of disease or illness persist, the composition can be applied to the subject. For example, embodiments of the present invention can be applied to the subject for at least 7 days, at least 10 days, at least 12 days, at least 14 days, at least 16 days, at least 18 days, at least 21 days, at least 24 days, at least 27 days, at least 30 days, at least 60 days, at least 90 days or longer than 90 days.

[0102] The compound (e.g., at least one flavanone and at least one flavonol, optionally comprising at least one carotenoid) can be incorporated into a pharmaceutical composition suitable for administration to a subject. The term "pharmaceutical composition" can refer to a therapeutically effective amount of a compound and / or composition described herein, with a pharmaceutically acceptable carrier or diluent. Such a pharmaceutical composition can comprise at least one flavanone and at least one flavonol, optionally comprising at least one carotenoid, and a pharmaceutically acceptable carrier or excipient. Thus, in some embodiments, the compound of the invention is present in a pharmaceutical composition.

[0103] The phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier," which may be used interchangeably, may refer to a carrier, excipient, or diluent that does not cause significant irritation to a subject and does not abrogate the biological activity and properties of the administered active ingredient. Adjuvants are included under these phrases.

[0104] Pharmaceutically acceptable carriers may include one or more solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc., compatible with drug administration to a subject. The use of such media and agents for pharmaceutically active substances is well known in the art. Any conventional media or agents compatible with the active compound may be used. Supplementary active compounds may also be incorporated into the composition.

[0105] The term "excipient" may refer to an inert substance added to a composition (pharmaceutical composition) to further facilitate administration of the active ingredients of the invention.

[0106] Techniques for formulating and administering drugs may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., most recent edition, which is incorporated herein by reference.

[0107] The compositions of the present disclosure can be manufactured by processes well known in the art, such as by conventional mixing, dissolving, granulating, dragee-making, powdering, emulsifying, encapsulating, embedding or lyophilizing processes.

[0108] Therefore, the compositions used according to embodiments of the present invention can be formulated in a conventional manner using one or more physiologically acceptable carriers, which include excipients and adjuvants to facilitate processing of the active ingredients into pharmaceutically usable preparations. Appropriate formulations depend on the selected route of administration.

[0109] Any therapeutic application or method of use described herein can be applied to any subject in need of such therapy, including, for example, a mammal, such as a mouse, rat, dog, cat, cow, horse, rabbit, monkey, pig, sheep, goat, or human. In some embodiments, the subject is a mouse. In some embodiments, the subject is a rat. In some embodiments, the subject is a human.

[0110] The pharmaceutical composition of the present invention can be formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, such as intravenous, intradermal, subcutaneous, oral (i.e., capsules or medical foods), nasal (e.g., inhalation), transdermal (topical, such as cream), transmucosal and rectal administration.

[0111] Solutions or suspensions for parenteral, intradermal or subcutaneous administration may include the following components: a sterile diluent, such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerol, propylene glycol or other synthetic solvents; antibacterial agents, such as benzyl alcohol or methyl paraben; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetates, citrates or phosphates; and agents for adjusting tonicity, such as sodium chloride or dextrose. pH can be adjusted with an acid or base, such as hydrochloric acid or sodium hydroxide. Parenteral preparations may be packaged in ampoules, disposable syringes, or multiple dose vials made of glass or plastic.

[0112] Pharmaceutical compositions suitable for injectable use may include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers may include physiological saline, bacteriostatic water, Cremophor EM TM(BASF, Parsippany, New Jersey) or phosphate buffered saline (PBS). The composition can be sterile and can be a fluid to the extent of being easy to inject. In embodiments, the composition can be stable under manufacturing and storage conditions and must be preserved to prevent microbial (such as bacteria and fungi) contamination. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, pharmaceutically acceptable polyols (such as glycerol, propylene glycol, liquid polyethylene glycol) and their suitable mixtures. For example, by using a coating such as lecithin, by maintaining the required particle size in the case of a dispersion, and by using a surfactant, appropriate fluidity can be maintained. The effect of preventing microorganisms can be achieved by various antibacterial and antifungal agents (such as parabens, chlorobutanol, phenol, ascorbic acid and thimerosal). In many cases, it can be useful to include isotonic agents in the composition, for example, sugars, polyols (such as mannitol, sorbitol), sodium chloride. The extended absorption of injectable compositions can be achieved by including agents (such as aluminum monostearate and gelatin) that delay absorption in the composition.

[0113] Sterile injectable solutions can be prepared by mixing the required amount of the compound with one or a combination of the ingredients listed herein (as required) in an appropriate solvent, followed by sterilization by filtration. Dispersions are prepared by mixing the active compound into a sterile vehicle containing a basic dispersion medium and other ingredients required from those listed herein. For sterile powders for preparing sterile injectable solutions, examples of available preparation methods are vacuum drying and freeze drying, which produce the powder from a previously sterile filtered solution of the active ingredient plus any additional ingredients.

[0114] Oral compositions may contain an inert diluent or an edible carrier. They may be encapsulated in gelatin capsules, compressed into tablets, or prepared as medical foods. For the purpose of oral therapeutic administration, the active compound may be blended with an excipient and then used in the form of tablets, lozenges or capsules. Oral compositions may also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is administered orally and spit out or swallowed after rinsing the mouth.

[0115] Pharmaceutically compatible binders and / or adjuvant materials may be included in the composition as part of the composition. Tablets, pills, capsules, lozenges, etc. may contain any of the following ingredients, or compounds of similar nature: binders, such as microcrystalline cellulose, tragacanth or gelatin; excipients, such as starch or lactose; disintegrants, such as alginic acid, Primogel or corn starch; lubricants, such as magnesium stearate or sterotes; glidants, such as colloidal silicon dioxide; sweeteners, such as sucrose or saccharin; or flavorings, such as peppermint, methyl salicylate or orange flavoring.

[0116] In embodiments, said composition can be prepared as medical food, dietary articles or food ingredients.Term " dietary articles " can include any product that experiences at least one processing or cooking step and is eaten by experimenter before distribution.The non-limiting example of processing and cooking step includes mixing, cooking, baking, heating, chopping, refrigerating, freezing, packaging, canning, bagging and storing.The non-limiting example of dietary articles includes food, dietary ingredients, medical food, functional food, beverage, dietary supplement, vitamin, mineral substance and their combination.Unprocessed, original or fresh food (such as fresh fruit and vegetables) is not included in this term in this article.

[0117] The term "food ingredient" may refer to any edible substance that is combined with other edible substances, wherein the final combination is consumed as a food. The term "medical food" herein is defined by the U.S. Orphan Drug Act, Section 5(b) (21 U.S.C. 360ee(b)(3)), which defines "medical food" as "a food formulated for enteral consumption or administration under the supervision of a physician and intended for the specific dietary management of a disease or condition whose unique nutritional requirements are determined by medical evaluation based on recognized scientific principles."

[0118] Systemic administration can also be carried out by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants suitable for the permeation barrier are used in the formulation. Such penetrants are known in the art and include, for example, detergents, bile salts and fusidic acid derivatives for transmucosal administration. Transmucosal administration can be achieved by using nasal sprays or suppositories. For transdermal administration, the active compound is formulated into ointments, salves, gels or creams known in the art.

[0119] Many embodiments of the present invention are applicable to topical application to a subject. The non-limiting example of such embodiments includes solutions, lotions, creams, ointments, gels, pastes, sprays, liquids, detergents, hydrating agents or hydrating solutions and perfusion agents or perfusion solutions. The local dose of the composition is higher than those doses in the case of oral or intravenous administration, for example, when passing through the skin, a higher dose is usually required. Such dosage can include 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times or more than 10 times of the oral dose. Such dosage can include 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times or more than 10 times of the intravenous dose.

[0120] Compositions as described herein may include a synergistic combination of at least one flavanone and at least one flavonol, optionally including at least one carotenoid. The term "synergistic" may refer to a combination whose efficacy is more effective than the additive effect of any single monotherapy alone. The term "combination" may refer to a fixed combination in the form of a dosage unit, or a kit for a part of a combined administration, wherein a compound and a combination partner (e.g., another drug, also referred to as a "therapeutic agent" or "adjuvant") may be administered independently or separately at time intervals at the same time, and in particular, these time intervals allow the combination partner to show a cooperative effect, such as a synergistic effect. The term "co-administration" or "combination administration" as used herein, etc., may encompass the administration of a selected combination partner to a single subject (e.g., patient) in need, and may include a treatment regimen in which the medicament is not necessarily administered by the same route of administration or at the same time.

[0121] The term "pharmaceutical combination" may refer to a product that results from the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients.

[0122] The term "fixed combination" may refer to active ingredients, e.g. a compound and a combination partner, which are administered to a patient simultaneously in the form of a single entity or dosage. The term "non-fixed combination" may refer to active ingredients, e.g. a compound and a combination partner, which are both administered to a patient as separate entities simultaneously, concurrently or sequentially without specific time limits, wherein such administration provides therapeutically effective levels of the two compounds in the patient. The latter also applies to cocktail therapy, e.g. administration of three or more active ingredients.

[0123] The term "simultaneously" may refer to actions occurring at or about the same time, such as within about one minute of each other or within about five minutes of each other.

[0124] "Parallel" may refer to actions occurring close enough in time to produce a combined effect (eg, parallel may be simultaneous, or it may be two or more events occurring within a certain period of time before or after each other).

[0125] The term "sequentially" can refer to actions in a series or sequence of events. For example, the term can refer to one active agent being administered after another active agent, such as within about 60 minutes of each other.

[0126] Embodiment can be applied to the subject alone, in combination with another drug, as a part of a treatment regimen or as a component of a test kit. In some embodiments, other drugs are drugs for metabolic disorders or for helping local fat reduction. For example, such metabolic disorders can be diabetes, metabolic syndrome or obesity, and such other drugs can be insulin, amylinomimetic agents, alpha-glucosidase inhibitors, biguanides, dopamine agonists, glucagon-like peptides, meglitinides, sodium-glucose transporter 2 inhibitors, sulfonylureas, thiazolidinediones and dipeptidyl peptidase-4 inhibitors. In some embodiments, the drug includes regular insulin, such as but not limited to Humulin or Novolin; insulin aspart, such as but not limited to Novolog or FlexPen; insulin glulisine, such as but not limited to Apidra; insulin lispro, such as but not limited to Humalog; insulin isophane, such as but not limited to Humulin N or Novolin N; insulin degludec, such as but not limited to Tresiba; insulin detemir, such as but not limited to Levemir; insulin glargine, such as but not limited to Lantus; insulin glargine, such as but not limited to Toujeo; combination insulin drugs, such as but not limited to insulin aspart protamine-insulin aspart, insulin lispro protamine-insulin lispro, human insulin isophane-human regular insulin, insulin degludec-insulin aspart, NovoLog Mix 70 / 30 70 / 30), Humalog Mix 75 / 25, Humalog Mix 50 / 50, Humulin 70 / 30, Novolin 70 / 30, or Ryzodeg; Pramlintide, such as, but not limited to, SymlinPen; Acarbose, such as, but not limited to, Precose; Miglitol, such as, but not limited to, Glyset; Metformin, such as, but not limited to, Glucophage, Metformin HCl ER, Glumetza, Riomet, or Fortamet;Drugs containing metformin, such as, but not limited to, metformin-alogliptin, Kazano, metformin-canagliflozin, Invokamet, metformin-dapagliflozin, Xigduo XR, metformin-empagliflozin, Synjardy, metformin-glipizide, metformin-glyburide, Glucovance, metformin-linagliptin, Jentadueto, metformin-pioglitazone, Actoplus, Actoplus Met, Actoplus Met XR, metformin-repaglinide, PrandiMet, metformin-rosiglitazone, Avandamet, metformin-saxagliptin, Kombiglyze XR XR), metformin-sitagliptin, Janumet or Janumet XR; bromocriptine, such as but not limited to Parlodel; alogliptin, such as but not limited to Nesina; alogliptin-pioglitazone, such as but not limited to Oseni; linagliptin, such as but not limited to Tradjenta; linagliptin-empagliflozin, such as but not limited to Glyzami; saxagliptin, such as but not limited to Onglyza; sitagliptin, such as but not limited to Januvia; sitagliptin and simvastatin, such as but not limited to Giovanni (Juvisync); albiglutide, such as but not limited to Tanzeum; dulaglutide, such as but not limited to Trulicity; exenatide, such as but not limited to Byetta; exenatide extended release, such as but not limited to Bydureon; liraglutide, such as but not limited to Victoza; nateglinide, such as but not limited to Starlix; repaglinide, such as but not limited to Prandin; dapagliflozin, such as but not limited to Farxiga;Canagliflozin, such as but not limited to Invokana; empagliflozin, such as but not limited to Jardiance; empagliflozin-linagliptin, such as but not limited to Glyxambi; glimepiride, such as but not limited to Amaryl; glimepiride-pioglitazone, such as but not limited to Duetact; glimepiride-rosiglitazone, such as but not limited to Avandaryl; gliclazide, glipizide, such as but not limited to Reynin ( Glucotrol); glibenclamide, such as but not limited to DiaBeta, Glynase or Micronase; chlorpropamide, such as but not limited to Diabinese; tolazamide, such as but not limited to Tolinase; tolbutamide, such as but not limited to Orinase or TolTab; rosiglitazone, such as but not limited to Avandia; or pioglitazone, such as but not limited to Actos. In some embodiments, the treatment regimen includes the administration of one or more drugs, each of which is administered separately to the subject; behavioral modification, such as dietary changes and increased daily exercise; or surgery, such as weight loss surgery. The pharmaceutical composition of the present invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, such as intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions for parenteral, intradermal or subcutaneous administration may include the following components: a sterile diluent, such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerol, propylene glycol or other synthetic solvents; antibacterial agents, such as benzyl alcohol or methyl paraben; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetates, citrates or phosphates, and agents for adjusting tonicity, such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be packaged in ampoules, disposable syringes, or multiple-dose vials made of glass or plastic. ;

[0127] The compositions of the present disclosure can be formulated as unit dosage forms. Preparations in such forms are subdivided into unit doses containing an appropriate amount of active ingredient, such as for single administration. Unit dosage forms can be packaged preparations containing discrete amounts of preparations, such as ampoules, dispensers, adhesive bandages, non-adhesive bandages, wipes, baby wipes, gauze, pads, and sanitary pads.

[0128] The quantity of active compound in a unit dose of preparation may be varied or adjusted according to the present application.

[0129] The composition of the present disclosure may be present in a package or dispenser device such as a kit, which may contain one or more unit dosage forms containing an active ingredient. The package may, for example, include a metal foil or plastic foil, such as a blister package. The package or dispenser device may be accompanied by instructions for use. The package or dispenser device may also be accompanied by a notice in a form prescribed by a government agency that regulates drug manufacturing, use or sales, which reflects the form of the composition approved by the agency for human or veterinary administration. For example, such notices may include a prescription drug label approved by the U.S. Food and Drug Administration or an approved product instruction label. As described in detail herein, a composition of the preparation of the present invention formulated in a pharmaceutically acceptable carrier may also be prepared, placed in an appropriate container, and labeled for treatment of a specified condition.

[0130] Since the compositions of the present disclosure are utilized in vivo, the compositions can be of high purity and substantially free of harmful contaminants, such as at least National Food (NF) grade. Compositions as described herein can be at least analytical grade. Compositions as described herein can be at least pharmaceutical grade. To the extent that a given compound must be synthesized prior to use, such synthesis or subsequent purification can produce a product that is substantially free of any contaminating toxic agents that may have been used during the synthesis or purification procedure.

[0131] Aspects of the present disclosure also relate to methods of treating a subject suffering from a metabolic disorder, the methods comprising administering to the subject a therapeutically effective amount of a composition described herein.

[0132] The term "treatment" may refer to partial or complete alleviation, relief, amelioration, alleviation, delay in onset, inhibition of development, reduction in severity, and / or reduction in incidence of one or more symptoms, features, or clinical manifestations of a disease, disorder, and / or condition (such as a metabolic disorder). Treatment may be administered to subjects who do not exhibit signs of the disease, disorder, and / or condition (e.g., prior to an identifiable disease, disorder, and / or condition) and / or to subjects who exhibit only early signs of the disease, disorder, and / or condition for the purpose of reducing the risk of developing pathology associated with the disease, disorder, and / or condition.

[0133] The therapeutic effects of treatment include, but are not limited to, preventing the occurrence or recurrence of a disease, alleviating symptoms, reducing any direct or indirect pathological consequences of a disease, reducing the rate of disease progression, relieving or alleviating the disease state, and alleviating or improving prognosis. By preventing the development of a disease or disorder, treatment can prevent deterioration caused by the disorder in an affected or diagnosed subject or a subject suspected of having a disorder, and treatment can prevent the onset of a disease or disorder symptoms in a subject at risk of or suspected of having a disorder.

[0134] The term "subject" or "patient" can refer to any organism to which aspects of the present invention can be administered, for example, for experimental, diagnostic, preventive and / or therapeutic purposes. The subject to which the compounds described herein can be administered can be a mammal, for example, a primate (such as a human). For veterinary applications, a wide variety of subjects will be suitable, for example, livestock, such as cattle, sheep, goats, cows, pigs, etc.; poultry, such as chickens, ducks, geese, turkeys, etc.; and domesticated animals, for example, pets, such as dogs and cats. For diagnostic or research applications, a variety of mammals will be suitable subjects, including rodents (e.g., mice, rats, hamsters), rabbits, primates, and pigs (such as inbred pigs), etc. The term "living subject" refers to a subject mentioned herein or another living organism. The term "living subject" refers to the entire subject or organism, not just a part removed from a living subject (e.g., a liver or other organ).

[0135] The term "metabolism" can refer to, for example, the sum of material processing processes in a living body and / or the sum of metabolic activities that occur. For example, metabolism can refer to chemical changes in living cells by which energy is provided for important processes and activities and new substances are assimilated.

[0136] The term "metabolic health" can refer to the presence or absence of a metabolic disease. For example, metabolic health can refer to blood glucose, triglycerides, high-density lipoprotein (HDL) cholesterol, blood pressure, and / or waist circumference being below ideal levels or being at ideal levels. For example, a subject with poor metabolic health may have a metabolic disease or be at risk for a metabolic disease. The subject's blood glucose, triglycerides, high-density lipoprotein (HDL) cholesterol, blood pressure, and / or waist circumference may be below ideal levels.

[0137] The term "metabolic disorder" may refer to any disease including changes in the normal metabolism of carbohydrates, lipids, proteins, nucleic acids or combinations thereof. Metabolic disorders may be associated with a deficiency or excess in a metabolic pathway that causes an imbalance in the metabolism of nucleic acids, proteins, lipids and / or carbohydrates. Factors affecting metabolism include, but are not limited to, endocrine (hormone) control systems (e.g., insulin pathways, enteroendocrine hormones (including GLP-1, PYY, etc.)), neural control systems (e.g., GLP-1 in the brain), etc. Examples of metabolic disorders include, but are not limited to, diabetes (e.g., type 1 diabetes, type 2 diabetes, gestational diabetes), hyperglycemia, hyperinsulinemia, insulin resistance, metabolic syndrome and obesity.

[0138] The term "metabolic syndrome" may refer to a group of metabolic abnormalities, including abdominal obesity, insulin resistance, glucose intolerance, diabetes, hypertension, and dyslipidemia. These abnormalities are known to be associated with an increased risk of vascular events.

[0139] The term "obesity" may refer to a condition in which there is excess body fat. The operational definition of obesity is based on the body mass index (BMI), which is calculated as weight per square meter of height (kg / m 2 "Obesity" may refer to a condition in which an otherwise healthy subject has a body mass index (BMI) greater than or equal to 30 kg / m 2 or a BMI greater than or equal to 27 kg / m 2 An "obese subject" is a subject with a body mass index (BMI) greater than or equal to 30 kg / m 2 Other healthy subjects or BMI greater than or equal to 27kg / m 2 A "subject at risk of obesity" is a subject with a BMI of 25 kg / m 2 To less than 30kg / m 2 Other healthy subjects or BMI 25kg / m 2 Less than 27kg / m 2 of a subject with at least one comorbidity. As used herein, the term "obesity" is intended to encompass the definition of obesity herein.

[0140] Obesity-induced complications or obesity-related complications include, but are not limited to, diabetes, non-insulin-dependent type 2 diabetes, obesity-related diabetes, impaired glucose tolerance, impaired fasting glucose, insulin resistance syndrome, dyslipidemia, hypertension, obesity-related hypertension, hyperuricemia, gout, coronary artery disease, myocardial infarction, angina pectoris, sleep apnea syndrome, Pickwickian syndrome, fatty liver; cerebral infarction, cerebral thrombosis, transient ischemic attack, orthopedic disease, deforming arthritis, low back pain, menstrual disorders and infertility. Complications may include, but are not limited to: hypertension, hyperlipidemia, dyslipidemia, glucose intolerance, cardiovascular disease, sleep apnea, diabetes and other obesity-related conditions.

[0141] Treatment of obesity and obesity-related disorders may refer to the administration of a compound or combination described herein to reduce or maintain the weight of an obese subject. One result of treatment may be a weight loss of the subject relative to the weight of the obese subject before the administration of a compound or combination described herein. Another result of treatment may be the prevention of weight regain from weight previously lost due to diet, exercise, or medication. Another result of treatment may be a reduction in the incidence and / or severity of obesity-related diseases. Treatment may appropriately cause a reduction in the subject's food or caloric intake, including a reduction in total food intake or a reduction in specific components of the diet such as carbohydrates or fat intake; and / or inhibition of nutrient absorption; and / or inhibition of reduced metabolic rate; and reduction in the weight of patients in need. Treatment may also cause a change in metabolic rate, such as an increase in metabolic rate rather than inhibition of reduced metabolic rate, or in addition to inhibition of reduced metabolic rate, an increase in metabolic rate; and / or minimization of metabolic resistance typically caused by weight loss.

[0142] Prevention of obesity and obesity-related diseases can refer to the administration of compounds or combinations described herein to reduce or maintain the weight of a subject at risk of obesity. One result of prevention can be a weight loss of the subject relative to the weight of the subject at risk of obesity before the administration of compounds or combinations described herein. Another result of prevention can be to prevent weight recovery from the weight previously reduced due to diet, exercise or drug therapy. If treatment is administered before the onset of obesity in a subject at risk of obesity, another result of prevention can be to prevent obesity from occurring. If treatment is administered before the onset of obesity in a subject at risk of obesity, another result of prevention can be to reduce the incidence and / or severity of obesity-related diseases. In addition, if treatment is initiated in an already obese subject, such treatment can prevent the onset, development or severity of obesity-related diseases, such as, but not limited to, arteriosclerosis, type 2 diabetes, polycystic ovary disease, cardiovascular disease, osteoarthritis, skin diseases, hypertension, insulin resistance, hypercholesterolemia, hypertriglyceridemia and cholelithiasis.

[0143] As used herein, the term "diabetes" includes both insulin-dependent diabetes mellitus (i.e., IDDM, also known as type 1 diabetes) and non-insulin-dependent diabetes mellitus (i.e., NIDDM, also known as type 2 diabetes). Type 1 diabetes or insulin-dependent diabetes is due to an absolute deficiency of insulin, a hormone that regulates glucose utilization. Type 2 diabetes or insulin-independent diabetes mellitus (i.e., non-insulin-dependent diabetes) typically occurs in the face of normal or even high insulin levels and appears to be due to the inability of tissues to respond appropriately to insulin. Most patients with type 2 diabetes are also obese. The compositions disclosed herein can be used to treat both type 1 diabetes and type 2 diabetes. Such compositions are particularly effective for treating type 2 diabetes. The compositions described herein can also be used to treat and / or prevent gestational diabetes.

[0144] Treatment of diabetes may refer to administering a compound or combination of the invention to treat diabetes. One result of treatment may be to reduce the glucose content of a subject with high glucose content. Another result of treatment may be to reduce the insulin content of a subject with high insulin content. Another result of treatment may be to reduce the plasma triglycerides of a subject with high plasma triglycerides. Another result of treatment may be to reduce the LDL cholesterol of a subject with high LDL cholesterol content. Another result of treatment may be to increase the HDL cholesterol of a subject with low HDL cholesterol content. Another result of treatment may be to improve insulin sensitivity. Another result of treatment may be to enhance the glucose tolerance of a subject with glucose intolerance. Yet another result of treatment may be to reduce the insulin resistance of a subject with high insulin resistance or high insulin content.

[0145] Prevention of diabetes refers to administration of a compound or combination described herein to prevent the onset of diabetes in a subject in need thereof.

[0146] According to the present invention, the term "NASH" or "non-alcoholic steatohepatitis" refers to a non-alcoholic fatty liver disease condition characterized by the presence of hepatic steatosis, hepatic ballooning, and hepatic inflammation upon histological examination (i.e., NAS>3, and a steatosis score of at least 1, a lobular inflammation score of at least 1, and a hepatic ballooning score of at least 1) in the absence of excessive alcohol consumption and after exclusion of other liver diseases such as viral hepatitis (HCV, HBV). The embodiments can prevent the development of NASH, which includes, for example, spider angiomas, ascites, splenomegaly, marginal cirrhosis of the liver, palmar erythema, asterixis, liver fibrosis, one or more symptoms of degeneration, and hepatocellular carcinoma. Exacerbations of non-alcoholic steatohepatitis are also associated with symptoms such as cirrhosis and liver failure, and are associated with liver transplantation.

[0147] The term "administering" may refer to the physical introduction of an agent (e.g., a therapeutically effective amount of a compound or composition described herein) into a subject using various methods and delivery systems known to those of ordinary skill in the art. Modes of administration include those disclosed herein. Exemplary routes of administration include, for example, intravenous, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration by injection or infusion. As used herein, the phrase "parenteral administration" may refer to modes of administration other than enteral and topical administration, typically by injection, and includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracystic, intraorbital, intracardiac, intradermal, intraperitoneal, transcervical, subcutaneous, subcutaneous, intraarticular, subcapsular, subarachnoid, intrathecal, epidural and intrasternal injection and infusion, and in vivo (including electroporation). In some embodiments, the formulation is administered via a parenteral route, such as oral administration. Other parenteral routes include topical, epidermal or mucosal administration routes, such as intranasal, vaginal, rectal, sublingual or topical. Administration can, for example, be performed once, several times and / or over one or more extended periods of time.

[0148] Aspects of the present disclosure relate to weight loss and fat reduction methods. The term "body fat" may refer to loose connective tissue known as "adipose tissue". Body fat may be present throughout the body of an individual. Non-limiting examples of body fat (adipose tissue) include visceral fat, perirenal fat, mesenteric fat, epididymal fat, and subcutaneous fat. The amount of body fat of an individual may be determined and / or estimated by various methods recognizable to a technician. For example, body fat percentage (body fat mass divided by body weight) may be estimated by techniques known to the technician, such as hydrostatic (underwater) weighing, whole body air displacement plethysmography, near infrared interaction, dual energy X-ray absorptiometry (DEXA), average body density measurement (in combination with Brozek or Siri formulas), bioelectrical impedance analysis, anthropometric methods (e.g., skinfold measurements, ultrasound measurements, and estimates based on subject weight index), magnetic resonance imaging, computed tomography, and other methods recognizable to the technician. In addition, although not a direct measurement of body fat mass, the body mass index (BMI) of an individual may also indicate the amount of body fat of an individual. Additional methods for determining and / or estimating body fat mass will be recognizable to those skilled in the art.

[0149] As used herein, the term "reduce" in "reduce body fat" refers to reducing the amount, mass or volume of body fat. For example, "weight and body fat reduction" can refer to the presence of a reduced amount of weight or body fat after administering a therapeutically effective amount of a compound or composition described herein. The term "reduce" can refer to reducing the volume, size, mass, capacity, density, amount and / or quantity of a substance. Such reduction can be measured and determined by measuring the amount of fat at an initial time point before administering the compound or composition described herein according to one or more of the methods described herein, and then measuring the amount of body fat at different time points (e.g., during the period of administering the compound described herein and after administration has been stopped). For example, the subject's weight can be measured before starting a treatment regimen using the compound described herein, and then measured during and after the treatment regimen. Weight loss indicates a reduction in body fat. Similarly, skinfold measurements and / or other techniques (e.g., magnetic resonance imaging and / or computed tomography) can be performed or performed together with weight measurements, wherein a reduction in the parameters (i.e., body fat percentage) measured by those techniques indicates a reduction in fat. In addition, fat reduction can be determined qualitatively, such as by photographing the whole body or body parts at different time points before, during and after the treatment regimen, wherein fat reduction can be determined by visual inspection of the images (e.g., by seeing a visible reduction in the size and / or volume of fat deposits such as submental fat, waist fat, subcutaneous fat masses, and other forms of body fat that withstand visual inspection). The methods of the present invention described herein can reduce the body fat of an individual of total body weight by about 5%, about 10%, or about 20% or more. For example, this translates into an individual losing about 2 to 3 pounds of weight per week. In one embodiment, the amount of weight loss can be about 1% body fat / week.

[0150] Since other modifications and changes to adapt to operational requirements and environment will be apparent to those skilled in the art, the present invention is not considered to be limited to the examples selected for the purpose of disclosure, and encompasses all changes and modifications that do not constitute departure from the true spirit and scope of the present invention. This written description provides an illustrative explanation and / or explanation of the present invention. Without departing from the concept of the present invention, it is possible to use variations of specific embodiments to provide equivalent benefits. Therefore, this description and these drawings should be considered illustrative rather than restrictive.

[0151] Unless otherwise indicated, all numbers used in this specification and claims to represent the number of components, properties such as molecular weight, percentage, ratio, reaction conditions, etc. should be understood to be modified by the term "about" in all cases, regardless of whether the term "about" exists. Therefore, unless otherwise indicated, the numerical parameters set forth in this specification and claims are approximate values, which may vary depending on the properties attempted to be obtained by the present disclosure. At least and without attempting to limit the application of the principle of equivalents to the scope of the claims, each numerical parameter may at least be interpreted according to the number of reported significant figures and by applying ordinary rounding techniques. Although the numerical ranges and parameters setting forth the wide range of the present disclosure are approximate values, the numerical values ​​set forth in the specific embodiments are reported as accurately as possible. However, any numerical value inherently contains certain errors that are inevitably caused by the standard deviation found in the test measurement.

[0152] It will also be understood that persons skilled in the art may make various changes in the details, materials and arrangements of parts described and illustrated to illustrate embodiments of the invention without departing from the embodiments of the invention as covered by the following claims.

[0153] In this specification, including any claims, the term "each" may be used to refer to one or more specified features of a plurality of the aforementioned elements or steps. When used with the open-ended term "comprising," the recitation of the term "each" does not exclude additional, unrecited elements or steps. Thus, it should be understood that an apparatus may have additional, unrecited elements, and a method may have additional, unrecited steps, where the additional, unrecited elements or steps do not have one or more specified features.

[0154] Aspects of the invention relate to kits. The term "kit" may refer to a set of articles that facilitate a process, method, assay, analysis, or manipulation of a sample. The kit may include instructions for use of the kit (e.g., instructions for the methods of the invention), materials, solutions, components, reagents, chemicals, or enzymes required for the method, and other optional components.

[0155] For example, the compositions as described herein can be provided in a kit. In one embodiment, the kit includes (a) a container containing the compositions described herein or components thereof (e.g., solvents, buffers, extracts, plant compounds) and optionally (b) informational materials. The informational materials can be descriptive, instructive, marketing, or other materials covering the use of the methods and / or medicaments described herein for obtaining therapeutic benefits. In one embodiment, the kit also includes a second agent, such as at least one additional active agent.

[0156] The information material of the kit is not limited by its form. In one embodiment, the information material can include information about compound production, compound molecular weight, concentration, expiration date, batch or production site information, etc. In one embodiment, the information material covers methods of manufacturing one or more compositions and / or methods of administering the composition to a subject to treat a subject, for example, with a suitable dosage, dosage form or mode of administration (e.g., dosage, dosage form or mode of administration described herein). The information can be provided in various forms, including printed text, computer readable material, video recording or audio recording, or information providing a link or address to substantive material.

[0157] The composition in the kit may include other ingredients, such as solvents or buffers, culture media, stabilizers or preservatives. The composition of the kit may be provided in any form, such as liquid, dry or lyophilized form, and may be substantially pure and / or sterile. When the composition is provided in the form of a liquid solution, the liquid solution may be an aqueous solution or an alcohol solution. When the composition or its components are provided in dry form, for example, reconstitution is performed by adding a suitable solvent. A solvent, such as sterile water or a buffer, may optionally be provided in the kit. The kit may include one or more containers for the composition or the composition containing such reagents. In some embodiments, the kit contains separate containers, partitions or compartments for the composition and the informational material. For example, the composition may be contained in a bottle, a vial or a syringe, and the informational material may be contained in a plastic sleeve or packaging. In other embodiments, the separate elements of the kit are contained in a single undivided container. For example, the composition is contained in a bottle, a vial or a syringe with informational material in the form of a label. In some embodiments, the kit includes a plurality of (e.g., a pack) of separate containers, each container containing one or more unit dosage forms of the reagent (e.g., the dosage forms described herein). The container may include a combined unit dose, such as a unit including, for example, a composition and a second agent in a desired ratio. For example, the test kit includes a plurality of syringes, ampoules, foil packets, blister packages, or medical devices, for example, each containing a single combined unit dose. The container of the test kit may be airtight, waterproof (e.g., not affected by moisture or evaporative changes) and / or opaque. The test kit optionally includes a device suitable for administering the composition, such as a syringe or other suitable delivery device. The device may be provided with one or two reagents pre-loaded, or may be empty, but suitable for loading.

[0158] Example

[0159] Examples are provided herein to facilitate a more comprehensive understanding of the present invention. The following examples show exemplary modes of preparing and practicing the present invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples for illustrative purposes only, because similar results can be obtained using alternative methods.

[0160] Example 1

[0161] The synergistic effect of naringenin and myricetin increased UCP-1 and GLUT-4.

[0162] We previously found that the sweet orange extract naringenin increased UCP-1 and GLUT-4 in human adipocytes and tested 150 mg of naringenin three times a day in patients with type 2 diabetes and found improved insulin sensitivity, increased metabolic rate, and increased weight loss. We subsequently found that beta-carotene synergistically increased UCP-1 and GLUT-4 in human adipocytes with naringenin. We demonstrated that higher doses of naringenin were safe in pharmacokinetic studies, and a study is about to begin testing synergistic doses of naringenin and beta-carotene in humans with diabetes, evaluating metabolic rate, insulin resistance, and body weight.

[0163] We have now demonstrated in human adipocytes that myricetin synergistically increases UCP-1 and GLUT-4 many fold with naringenin. The synergistic effect of myricetin and naringenin of the present invention to increase UCP-1 and GLUT-4 may represent a more effective and safe treatment for obesity and type 2 diabetes. Obesity and overweight now affect more than half of the adult population in the United States, and the prevalence of type 2 diabetes has increased about a decade after the obesity epidemic. Not only has the increasing obesity epidemic provoked an increase in type 2 diabetes, but treatments for type 2 diabetes that cause weight loss can be used to combat these two health problems and improve public health. Since both naringenin and myricetin are foods, they are safe, inexpensive, and can be sold without a prescription with only efficacy trials. Thus, without wishing to be bound by theory, naringenin and myricetin may provide cost-effective treatments for two problems attributed to the lack of safety studies required for new chemical entities, and have a large public health impact.

[0164] Drugs are very expensive, mainly due to the fact that most drugs are new chemical entities with strong patents but have never been used in humans. Therefore, the FDA conducts safety studies required to ensure safety before approving them for treating diseases. These studies to determine safety are very expensive, and drug costs have steadily occupied a large share of our health care costs. Both myricetin and naringenin are foods and are generally recognized as safe (GRAS). Efficacy trials that give statistically and clinically significant weight loss and improvement in type 2 diabetes are relatively cheap. Therefore, myricetin and naringenin are not only cheap foods, but they also do not have drug development costs. Therefore, without wishing to be bound by theory, they can provide safer and more effective treatments for obesity and type 2 diabetes at a much lower cost. Better products with lower costs are likely to achieve huge economic success.

[0165] Example 2

[0166] Myricetin and naringenin together to treat metabolic diseases

[0167] Myricetin is a flavonoid that can be found in many common foods such as berries, vegetables, fruits, tea and red wine. It is extracted from all parts of the Japanese bayberry, where it is used to flavor snacks and beverages. It is listed as Generally Recognized as Safe (GRAS) by the American Flavor and Extract Manufacturers Association and was recently determined to be safe at currently estimated dietary exposures by the Joint Food and Agriculture Organization (FAO) / World Health Organization (WHO) Expert Committee on Food Additives (JECFA). JECFA has established specifications related to the identity and purity of myricetin used as a flavoring agent [1]. Without wishing to be bound by theory, studies on in vitro cells and rodents suggest that myricetin may be a therapeutic agent for many diseases, including diabetes, cancer, cardiovascular disease and Alzheimer's disease [2],

[0168] Chemical properties: Myricetin has six hydroxyl groups and is water soluble at 17 μg / ml (11 nM). As the pH decreases, the solubility in acetic acid buffer solution increases. The solubility in acidic solutions with a pH of 1, 2, or 3 is 777 μg / ml, 576 μg / ml, and 150 μg / ml, respectively. In rats, myricetin is absorbed in the duodenum due to its weak acidity, and it has a moderate membrane permeability with a coefficient of 1.7×10-6 cm / s [3]. Myricetin is stable at 25°C and has a half-life of 23 hours.

[0169] The oral bioavailability of myricetin is approximately 10% and is dose-dependent in rats orally administered 50 mg / kg and 100 mg / kg, with the time to maximum concentration (Tmax) being 6.5 hours [4]. It has been reported to inhibit cytochrome P450 and drug efflux pumps such as P-glycoprotein to enhance the availability of co-administered drugs such as tamoxifen [5] and losartan [6] in rats.

[0170] Effects on Biological Pathways: Myricetin reduces inflammation in cell culture models by reducing TNF-α and inhibiting several pathways, including Toll receptor activity, NF-kB and ikB, Jak / STAT1, and MAPK[2]. It also reduces oxidative stress by increasing the cellular activity of the antioxidant enzymes superoxide dismutase, glutathione peroxidase, catalase, and GSH in rodent models and macrophage cultures. The inhibitory effects of myricetin on human cancer cell invasion and proliferation have been documented in several studies using lung, breast, liver, ovarian, and colon cancer cells[7]. Myricetin reduces MTORC1 and MTORC2 activity in glioblastoma cells, reduces VEGF and neovascularization, promotes apoptosis by downregulating Bcl-2, reduces invasion and metastasis by reducing the expression of matrix metalloproteinases, and inhibits the STAT3 pathway[7].

[0171] Obesity, diabetes, and fatty liver disease: Studies in rodents have shown that myricetin can treat obesity and diabetes by altering the expression of genes that regulate energy expenditure. Myricetin increases mitochondrial density, muscle endurance, and BAT energy expenditure genes in muscle and BAT by increasing SIRT1 activity [8, 9]. In mice fed a high-fat and sucrose diet, the group that included 0.12% myricetin in the diet had reduced fat gain and reduced circulating glucose and insulin

[10] . In mice, myricetin induced mitochondrial oxygen consumption rate and improved glucose tolerance by upregulating Sirt3 in adipose tissue

[11] . Low micromolar concentrations of myricetin have activity as a GLP-1R agonist. In rat islets incubated in high glucose, myricetin stimulated insulin release, and a single dose injection in rats maintained low blood glucose levels for eight hours

[12] . Oral administration of myricetin in rats on a high-fat diet improved fatty liver disease and reduced circulating triglycerides

[13] .

[0172] PPARγ is a key transcriptional activator of genes that promote insulin sensitivity and lipogenesis. Cyclin-dependent kinase 5 (CDK5) can phosphorylate PPARγ on specific serine residues, and this modification regulates PPARγ target gene selectivity. Inhibition of CDK5 in adipose tissue is sufficient to stimulate the antidiabetic effects of PPARγ while blocking the lipogenic effects that lead to weight gain

[14] . Several flavonols, including myricetin, quercetin, and kaempferol, inhibit CDK5 kinase activity with EC50s in the low micromolar range

[15] . CDK5 is expressed in pancreatic β cells, and myricetin treatment of β cells exposed to high glucose prevents apoptosis and enhances insulin secretion through multiple mechanisms, including CDK5 inhibition

[16] .

[0173] Several clinical trials have shown that supplements containing myricetin improve type 2 diabetes. In a 4-week randomized placebo-controlled clinical trial, cyanobacterium (a supplement consisting of blueberry leaves with 50 mg myricetin and 50 mg chlorogenic acid) was administered three times a day. Compared with placebo, cyanobacterium significantly reduced fasting blood glucose from 143+ / -5.2 mg / L to 104+ / -5.7 mg / L (p<0.001) and had anti-inflammatory effects

[17] . In a randomized, double-blind, placebo-controlled, parallel-group study in individuals with type 2 diabetes and a BMI>30, Emulin (a supplement containing myricetin, chlorogenic acid, and quercetin) was evaluated against metformin. Emulin increased the efficacy of metformin in improving fasting blood glucose by 30-fold, while there was no statistical difference between Emulin alone and metformin alone

[18] . A study in a Chinese population showed that higher dietary myricetin levels were associated with a lower prevalence of type 2 diabetes

[19] .

[0174] Characterization of naringenin effects in human adipocytes

[0175] Our group has demonstrated that naringenin and naringenin extract (30% from whole orange) stimulate the expression of genes for fat oxidation, energy expenditure, and insulin sensitivity in human adipose tissue

[20] . Naringenin also upregulates the expression of secreted factors that increase whole-body energy expenditure, including adiponectin, ANGPTL4, GDF11, and PM20DI. Naringenin activates PPARa and PPARγ (Goldwasser), and studies with selective inhibitors have shown that the activity of PPARα and PPARγ is required for the effects of naringenin on gene expression in human adipocytes

[21] . In a case report, individuals with obesity and diabetes who ingested 150 mg of naringenin in orange extract three times a day for eight weeks experienced weight loss, increased insulin levels, and a measurable increase in energy expenditure

[22] .

[0176] Flavonols enhance the effects of naringenin on gene expression in human adipocytes

[0177] Quercetin, kaempferol, and myricetin inhibit CDK5 with EC50s of 63, 66, and 71, respectively

[15] . In adipocytes, CDK5 inhibitors reduce lipogenesis and increase genes for energy expenditure by altering PPARγ target gene selection. We measured expression of UCP1, a direct PPARa / γ target gene, after seven days of treatment of human adipocyte cultures with a combination of CDK5-inhibiting flavonols and naringenin. Based on rodent pharmacokinetic studies, we estimated the human Cmax of myricetin to be approximately 2.5 μM [4] and evaluated all flavonols at this concentration. GLUT4 expression, an indicator of insulin sensitivity that is upregulated following the conversion of white adipocytes to beige adipocytes, was also assessed.

[0178] When combined with naringenin, myricetin was more effective than quercetin or kaempferol in upregulating gene expression ( Figure 1 Myricetin was the only flavonol that synergistically increased UCP1 and GLUT4 expression compared with naringenin alone, despite being a weaker CDK5 inhibitor than quercetin or kaempferol.

[0179] Combination of myricetin and naringenin has therapeutic effects on obesity and diabetes

[0180] Treatment of adipocytes with a combination of myricetin and naringenin synergistically increased key genes for human lipolysis and energy expenditure (including UCP1, peptidase M20 domain-containing 1 (PM20D1)

[23] , mitochondrial creatine kinase 1 (CKMT1)

[24] , β1-adrenergic receptor (β1AR) [25, 26], and protein kinase A regulatory subunit 2B (PKA)

[27] ) ( Figure 2 ). The glucose transporter GLUT4 and adiponectin (a secreted protein that improves systemic insulin sensitivity) were also synergistically upregulated. PPARγ, neurotrophin S 100B

[28] , and adipose triglyceride lipase (ATGL)

[29] were increased, but not synergistically with naringenin.

[0181] Based on the strong effects on gene expression shown above, without wishing to be bound by theory, myricetin and naringenin in combination may have greater efficacy in treating obesity and diabetes compared to naringenin alone

[22] .

[0182] After addition of 8 μM naringenin, upregulation of gene expression by myricetin was most potent at the lowest concentration of myricetin tested in this assay, 0.1 μM. This effect decreased at higher concentrations ( Figure 3, Figure c and Figure d). There are no published human pharmacokinetic studies of myricetin Cmax or Tmax. These results suggest that myricetin can be effective even at concentrations much lower than our estimated human Cmax.

[0183] Low nanomolar concentrations of myricetin enhance the effects of naringenin on gene expression

[0184] To determine the lowest concentration associated with activity, low nanomolar concentrations of myricetin were tested. Treatment with myricetin alone for 7 days had no effect at any concentration. In combination with naringenin, the effect of myricetin remained strong at 50 nM and 25 nM, but was slightly reduced at 5 nM.

[0185] Combination of myricetin with naringenin and β-carotene induces thermogenic energy expenditure, insulin sensitivity, and lipid metabolism The expression of genes involved in lipolysis was the most effective

[0186] β-Carotene (βC), a vitamin A precursor and ligand for the PPARγ coactivator RXR, synergistically enhances the effects of naringenin on gene expression in human adipocytes (provisional patent filed). Addition of nanomolar concentrations of myricetin also up-regulated gene expression.

[0187] Overview

[0188] Naringenin, a flavonoid found in sweet orange, activates PPARα and PPARγ in human adipocytes and induces the expression of genes for thermogenesis and insulin sensitivity. We conducted pharmacokinetic studies and confirmed its safety and bioavailability at doses ranging from 150 mg to 900 mg

[30] . In a case study, the lowest dose of 150 mg was administered to subjects with obesity and diabetes for 8 weeks and caused weight loss, decreased fasting blood insulin concentrations, and improved metabolic rate.

[0189] Addition of β-carotene to naringenin during treatment of human adipocytes synergistically increased the expression of genes for thermogenic energy expenditure and insulin sensitivity.

[0190] In this application, we show that adding myricetin to naringenin alone or to the combination of naringenin and beta-carotene roughly doubles the upregulation of thermogenic gene expression and secretion of the insulin-sensitizing hormone adiponectin in human adipocytes. Myricetin, naringenin, and beta-carotene will be potent therapeutic treatments for metabolic diseases including obesity, NASH, and diabetes.

[0191] References cited in this example offer:

[0192] 1. Hobbs, CA, et al., Genotoxicity evaluation of the flavonoid, myricitrin, and its aglycone, myricetin. Food Chem Toxicol, 2015. 83: 283-92.

[0193] 2. Song, X. et al., Myricetin: A review of the most recent research. Biomed Pharmacother, 2021. 134: p. 111017.

[0194] 3. Yao, Y. et al., Preformulation studies of myricetin: a naturalantioxidant flavonoid. Pharmazie, 2014. 69(1): pp. 19-26.

[0195] 4.Dang, Y. et al., Quantitative determination of myricetin in rat plasma by ultra performance liquid chromatography tandem mass spectrometry and its absolute bioavailability. Drug Res (Stuttg), 2014.64(10): pp. 516-22.

[0196] 5. Li, C. et al., Effects of myricetin, an anticancer compound, on the bioavailability and pharmacokinetics of tamoxifen and its main metabolite, 4-hydroxytamoxifen, in rats. Eur J Drug Metab Pharmacokinet, 2011.36(3): Page 175-82.

[0197] 6. Choi, D.H., C. Li and I.S. Choi, Effects of myricetin, an antioxidant, on the pharmacokinetics of losartan and its active metabolite, EXP-3174, in rats: possible role of cytochrome P450 3A4, cytochrome P450 2C9 and P-glycoprotein inhibition by myricetin. J Pharm Pharmacol, 2010. 62(7): pp. 908-14.

[0198] 7. Jiang, M. et al., Anti-tumor effects and associated molecular mechanisms of myricetin. Biomed Pharmacother, 2019. 120: pp. 109506.

[0199] 8. Hu, T. et al., Myricetin-induced brown adipose tissue activation prevents obesity and insulin resistance in db / db mice. Eur J Nutr, 2018. 57(1): pp. 391-403.

[0200] 9. Jung, H.Y. et al., Myricetin improves endurance capacity and mitochondrial density by activating SIRT1 and PGC-1alpha. Scientific Reports, 2017. 7.

[0201] 10. Choi, H.N. et al., Ameliorative effect of myricetin on insulin resistance in mice fed a high-fat, high-sucrose diet. Nutrition Research and Practice, 2014. 8(5): pp. 544-549.

[0202] Myricetin Exerts Anti-Obesity Effects throughUpregulation of SIRT3 in Adipose Tissue.Nutrients,2018.10(12).

[0203] Faseb Journal, 2017.31(6):Myricetin: A potent approach for the treatment of type2diabetes as a natural class B GPCR agonist.

[0204] Cell Rep, 2021.36(9):Myricetin supplementation decreases hepatic lipid synthesis and inflammation by modulating gut microbiota.

[0205] Nature, 2015.517(7534):391-U581:14.Banks,As an ERK / Cdk5 axis controls the diabetogenic actiohsof PPAR gamma.

[0206] Journal of Natural Products, 2004. 67(3): Effects of natural flavones and flavonols on the kinase activity of Cdk5.

[0207] 16. Katunakaran, U. et al., Myricetin Protects Against High Glucose-Induced beta-Cell Apoptosis by Attenuating Endoplasmic Reticulum Stress via Inactivation of Cyclin-Dependent Kinase 5. Diabetes&Metabolism Journal, 2019. 43(2): pp. 192-205.

[0208] 17. Abidov, M. et al., Effect of Blueberin on fasting glucose, C-reactive protein and plasma aminotransferases, in female volunteers with diabetes type 2: double-blind, placebo controlled clinical study. Georgian Med News, 2006(141): pp. 66-72.

[0209] 18. Ahrens.M.J. and D.L. Thompson, Effect of emulin on blood glucose in type 2 diabetics. J Med Food, 2013. 16(3): pp. 211-5.

[0210] 19. Yao, Z. et al., Dietary myricetin intake is inversely associated with the prevalence of type 2 diabetes mellitus in a Chinese population. Nutr Res, 2019. 68: pp. 82-91.

[0211] 20. Rebello, C.J. et al., Naringenin Promotes Thermogenic Gene Expression in Human White Adipose Tissue. Obesity(Silver Spring), 2019. 27(1): pp. 103-111.

[0212] 21. Goldwasser, J. et al., Transcriptional regulation of human and rat hepatic lipid metabolism by the grapefruit flavonoid naringenin: role of PPARalpha, PPARgamma and LXRalpha. PLoS One, 2010. 5(8): p. e12399.

[0213] 22. Murugesan, N. et al., Naringenin Increases Insulin Sensitivity and Metabolic Rate: A Case Study. J Med Food, 2020. 23(3): pp. 343 - 348.

[0214] 23. Long, J.Z. et al., The Secreted Enzyme PM20D1 Regulates Lipidated Amino Acid Uncouplers of Mitochondria. Cell, 2016. 166(2): pp. 424 - 435.

[0215] 24. Muller, S. et al., Proteomic Analysis of Human Brown Adipose Tissue Reveals Utilization of Coupled and Uncoupled Energy Expenditure Pathways. Sci Rep, 2016. 6: p. 30030.

[0216] 25. Riis - Vestergaard, M.J. et al., Beta - 1 and Not Beta - 3 Adrenergic Receptors May Be the Primary Regulator of Human Brown Adipocyte Metabolism. J Clin Endocrinol Metab, 2020. 105(4).

[0217] 26. Mattsson, C. L. et al., beta(1)-Adrenergic receptors increase UCP1 in human MADS brown adipocytes and rescue cold-acclimated beta(3)-adrenergic receptor-knockout mice via nonshivering thermogenesis. Am J Physiol Endocrinol Metab, 2011. 301(6): pp. E1108-18

[0218] 27. Mantovani, G. et al., Protein kinase A regulatory subunits in human adipose tissue: decreased R2B expression and activity in adipocytes from obese subjects. Diabetes, 2009. 58(3): pp. 620-6

[0219] 28. Zeng, X. et al., Innervation of thermogenic adipose tissue via a cal syntenin 3beta-S100b axis. Nature, 2019. 569(7755): pp. 229-235

[0220] 29. Khan, S. A. et al., ATGL-catalyzed lipolysis regulates SIRT1 to control PGC-1alpha / PPAR-alpha signaling. Diabetes, 2015. 64(2): pp. 418-26

[0221] 30. Rebello, C J. et al., Safety and pharmacokinetics of naringenin: A randomized, controlled, single-ascending-dose clinical trial. Diabetes Obes Metab, 2020. 22(1): pp. 91-98

[0222] Example 3

[0223] References Figure 6 and Figure 7 , naringenin stimulates metabolism in human fat. We were able to use cultured human adipocytes and adult fat samples removed during surgery to show that naringenin causes an increase in uncoupling protein-1 (UCP-1). UCP-1 indicates that the adipocytes are generating energy as heat, which is another way of saying that the adipocytes are increasing their metabolic rate.

[0224] refer to Figure 8 , cells consume oxygen while metabolizing fat for thermogenic energy expenditure, and we directly measured the rate of oxygen consumption. Naringenin is a strong inducer of basal and maximal energy expenditure in human adipocytes.

[0225] refer to Fig. 9 , naringenin promotes insulin sensitivity. Naringenin also increases the production of the hormone adiponectin, which increases glucose uptake by many tissues and reduces insulin resistance, the root cause of type 2 diabetes.

[0226] refer to Fig.10 , naringenin stimulated an increase in protein content. In addition to upregulating messenger RNA, protein levels of UCP-1 and adiponectin were also increased. β-actin was a loading control.

[0227] refer to Fig.11 , naringenin shows efficacy at low doses in humans. Next, we gave a woman who was obese and had type 2 diabetes treated with diet alone 150 mg of naringenin extract in 500 mg of orange extract via capsules three times a day. She took the capsules three times a day for 8 weeks and did not diet or change her exercise habits. She lost 2.3% of her body weight, which suggests that when her weight loss plateaus at about 6 months, her weight loss could be 4.6% of her body weight. For an obesity drug to be approved for weight loss, it should cause a 5% loss, so the results are close to what one would expect from a drug. Her insulin resistance went down 20%, and her metabolic rate went up 3%.

[0228] We then performed a pharmacokinetic study which showed that doses of naringenin up to 900 mg were safe and without side effects. The pharmacokinetic study confirmed that doses up to 900 mg were safe and without side effects. We went back to this woman that we tested with 150 mg naringenin three times a day and tested her with 300 mg three times a day. She maintained the weight loss at the lower dose of naringenin and also lost further weight so that she was below her natural weight set point. The 300 mg three times a day just maintained her weight loss without increasing the weight loss further. The weight loss she achieved after the 150 mg dose test had resolved her diabetes.

[0229] refer to Fig.12 , the addition of β-carotene (BC) to 8 μM naringenin extract synergistically induced gene expression in human adipocytes treated for 7 days. We showed that both mRNA and protein levels of genes for energy expenditure and insulin sensitivity were significantly increased in the combination compared to naringenin extract alone.

[0230] 300 mg naringenin extract three times a day is tested in humans with 7.5 mg beta carotene twice a day. We are currently treating a series of obese humans who need to lose weight to safely undergo bariatric surgery. These human subjects will be treated for 8 weeks and body weight, fasting insulin, and fasting blood glucose will be measured at baseline and 8 weeks. Without wishing to be bound by theory, weight loss and insulin sensitivity improved.

[0231] Naringenin extracts were combined with beta-carotene and rym (myricetin). The flavonoid myricetin (rym) modulates biological pathways activated by naringenin at different levels than beta-carotene. We examined the effects of different concentrations of rym and found that naringenin activity in human adipocytes was strongly upregulated. We observed that rym enhanced naringenin activity at low concentrations.

[0232] Adding myricetin (rym) to nar extract + beta-carotene (NRBC) almost doubled the effect on gene expression. We tested the ability of rym to enhance the efficacy of the NRBC combination. The activity of rym was evaluated in combination with 0.1 μM (100 nM) NRBC and at lower concentrations of 50 nM and 25 nM.

[0233] These effects were observed for both energy expenditure genes and insulin sensitivity genes, suggesting that supplementation containing all three compounds could be a potent therapeutic for weight loss and insulin sensitivity. Because Rym is active at low concentrations, approximately 15 mg per capsule may be sufficient to achieve blood concentrations in this range.

[0234] Combine 300 mg naringenin and 15 mg rym 3 times a day with 7.5 mg beta carotene twice a day. Without wishing to be bound by theory, the effect of adding naringenin to the rym and beta carotene will give the greatest weight loss and improvement in insulin sensitivity. A case series of obese people who need to lose weight before bariatric surgery will have baseline and 8 week measurements of weight, fasting insulin, and fasting blood glucose.

[0235] We will test the triple combination in a double-blind clinical trial in which body weight, metabolic rate measured over a 4-hour period, fasting insulin, and fasting blood glucose are measured at baseline and at the end of the study, which may extend for 8, 12, 16, or 24 weeks.

[0236] Example 4

[0237] Background of the Patented Discovery in the Human Obesity Laboratory

[0238] Our goal is to develop a combination of safe, potent natural compounds that target energy expenditure and insulin sensitivity in adipose tissue for the treatment of obesity and diabetes. Most currently approved obesity drugs target the brain to reduce appetite and may have off-target side effects.

[0239] Naringenin

[0240] Adipose tissue is a complex tissue composed of multiple types of adipocytes with different functions. White adipocytes store triglycerides and expand in number and size under conditions of excess energy intake. White adipocytes can be converted to beige adipocytes with high levels of mitochondrial energy expenditure. The hallmark of beige adipocytes is the expression of mitochondrial uncoupling protein 1 (Ucp1), a protein that promotes thermogenesis and fatty acid metabolism. Beige adipocytes secrete factors into the circulation that increase systemic fat and glucose metabolism, insulin sensitivity, and reduce appetite.

[0241] Our laboratory found that treatment of human white adipocytes with 8 μM naringenin (NR), a flavonoid from orange, can turn on the expression of "beige" genes for thermogenesis and insulin sensitivity. We also showed that naringenin requires both the transcriptional activators PPARγ and PPARα to reprogram gene expression.

[0242] Next, we conducted clinical studies to determine whether naringenin could act as a therapeutic agent for weight loss and diabetes. First, a single-dose randomized pharmacokinetic analysis showed that the Cmax of a 150 mg dose of NR was approximately 16 μM and the half-life was 3 hours. Circulating levels reached 48 μM at a 600 mg dose, and there were no adverse events at a 900 mg dose. In a case study of individuals with obesity and untreated diabetes, three-times-a-day intake of 150 mg NR for eight weeks reduced body weight by 2.3%, reduced fasting insulin concentrations by 20%, and produced a 3.5% increase in energy expenditure. These clinical data suggest that naringenin is bioavailable and has the potential to serve as a therapeutic agent for obesity and diabetes. For these reasons, we consider adipose tissue to be a relevant peripheral target for obesity drugs.

[0243] Naringenin and beta-carotene

[0244] Recently, we found that the effect of NR on the expression of thermogenic genes was enhanced by adding 2 μM beta-carotene (BC) to NR during treatment. BC is a food component that is converted to retinoic acid, a ligand for the retinoic acid X receptor (RXR). PPARγ and PPARα can each form heterodimers with RXR to regulate gene expression. In human adipocytes, the combination of NR and BC (NRBC) enhanced UCP1 expression and genes for several other energy dissipation pathways, beneficial secreted peptides and adipokines.

[0245] Naringenin, beta-carotene, and myricetin

[0246] We found that myricetin roughly doubled the effect of NR+BC by upregulating beige genes for thermogenesis and insulin sensitivity. Myricetin was most active at nanomolar concentrations (50 nM to 100 nM).

[0247] Example 5

[0248] Naringenin (NR) acts on human adipocytes by binding to the nuclear receptors PPARg and PPARα to modulate target genes for thermogenesis and insulin sensitivity. Addition of myricetin (myr) to NR enhanced the expression of many of these target genes, including UCP1, GLUT4, PM20D1, adiponectin, PPARg, 1β1AR, CKMT1, ATGL, S100b, and PKA, in adipocytes compared with NR alone. We investigated several mechanisms for the effects of myricetin on gene expression based on published literature, including upregulation of SIRT 1 and SIRT3 expression, induction of PGC-1α protein, and inhibition of CDK5 phosphorylation of PPARg at serine 273. In some experiments, we analyzed combinations of all three compounds.

[0249] Myricetin does not enhance SIRT1 or SIRT3 expression compared with NR alone

[0250] Myricetin increases the levels of multiple Sirt proteins (including SIRT1, Sirt3, and SIRT5) in adipocytes from mice. This study shows that Sirt3 is the specific protein responsible for the anti-obesity effect of myricetin in mice fed a high-fat diet 1. Sirt proteins have deacetylase activity and can act on transcription factors such as PPARg to upregulate target gene expression. Sirt1 and Sirt3 are known to act on PPARg in adipocytes, so we analyzed whether mRNA content would be affected by myricetin in our human adipocyte model. Human adipocytes were treated with 8μM NR and 50nM myricetin for seven days, and the results are shown in Fig.15Myricetin alone did not affect SIRT1 or SIRT3 mRNA levels. Myricetin + NR did not increase SIRT1 or SIRT3 expression compared to NR alone ( Fig.15 ). Addition of 2 μM BC to the NR+myr combination significantly increased SIRT3 expression in adipocytes compared with NR or NR+myricetin.

[0251] Since we saw an increase in SIRT3 mRNA in adipocytes from mice and myricetin upregulated SIRT3 protein, we analyzed the amount of SIRT3 protein in human adipocytes treated with the same concentrations of the compounds for seven days. Protein was isolated from adipocytes and analyzed on immunoblots probed with antibodies that specifically bind to human SIRT3 or human β-actin. Fig.16 Western blot of SIRT3 protein from human adipocytes is shown. The right histogram shows the values ​​of SIRT3 protein normalized to the loading control β-actin. Fig.16 The results shown in show that NR and myricetin individually up-regulated SIRT3 protein levels, but the combination did not increase levels further. Combining NR and myr did not increase SIRT3 protein compared to either NR or myr alone. However, adding myr to NR+BC increased SIRT3 protein by 37%.

[0252] Elevated levels of SIRT3 can cause deacetylation and upregulation of PPARg and PPARα activity. PGC-1α is another coactivator of both PPARs and is known to be a target for SIRT3 deacetylation and activation. 2 It is possible that the addition of myricetin could enhance gene expression above NR+ BC via an increase in SIRT3 and subsequent deacetylation of PPARg, PPARα, and PGC-1α.

[0253] Myricetin induces PGC-1α protein content

[0254] PGC-1α is an important coactivator for both PPARg and PPARα of mitochondrial genes involved in thermogenesis and energy expenditure 3 Myricetin increases Pgc-1α in metabolic tissues of mice 1，4 Increased PGC-1α protein drives an increase in target genes for PPARg and PPARα 5，6 We evaluated PGC-1α protein content in human adipocytes treated with 8 μM NR, 2 μM BC, and 50 nM myricetin for seven days.

[0255] We found that myricetin robustly upregulated PGC-1α protein content, as shown in Fig.17NR induced roughly two-fold levels compared to untreated controls, and the NRBC combination also increased the protein two-fold. Adding myricetin to NR induced a small increase in PGC-1α. Adding myricetin to NRBCs upregulated PGC-1α levels more than two-fold compared to NRBCs. The increase in PGC-1α protein provides evidence that adding myricetin to NRBCs can increase mitochondrial biogenesis as well as other target genes.

[0256] Myricetin does not reduce PPARg phosphorylation at serine 273 compared to NRBC

[0257] Phosphorylation of PPARg by CDK5 at serine 273 is an important mechanism for repressing target genes for insulin sensitivity 7 CDK5 inhibitors have potential as diabetes drugs 8 Several studies have provided evidence that myricetin is a CDK5 inhibitor and has insulin sensitizing properties, making it a potential therapeutic agent for diabetes. 9，10 We previously analyzed the effect of NRBC on PPARg phosphorylation at serine 273. Human adipocytes were treated with 8 μM NR and 2 μM BC for three, five, and seven days, and proteins were isolated and analyzed on immunoblots probed with an antibody specific for human P-serine 273 PPARg. The same blots were stripped and reprobed with an antibody against total human PPARg. Protein was quantified and the results are shown in Fig.18 The values ​​in the histogram represent (P-serine 273 PPARg) / (total PPARg). Treatment of human adipocytes with NRBC induced PPARg protein content and in parallel inhibited P-serine 273 phosphorylation. This effect increased over time.

[0258] The experiment for analyzing PPARg phosphorylation at P-273 was repeated to determine whether the addition of myricetin to NRBCs could further inhibit PPARg P-273 phosphorylation. Cells were treated with 8 μM NR, 2 μM BC, and 50 nM myricetin for seven days. Proteins were analyzed on immunoblots probed with the same antibodies. Fig.19 The data in suggest that the addition of myricetin to NRBCs did not further reduce PPARg P-273 relative to NRBCs.

[0259] Overview

[0260] Adding myricetin to NR did not increase SIRT3 protein levels. Adding myr to the NRBC combination increased SIRT3 mRNA and protein by two-fold. Adding myricetin to NRBCs increased PGC-1α protein levels by two-fold compared to NR or NRBCs alone. Myricetin did not alter PPARg phosphorylation at serine 273.

[0261] References cited in this example:

[0262] 1.Akindehin, S., Jung, YS, Kim, SN, Son, YH, Lee, I., Seong, JK, Jeong, HW and Lee, YH (2018). Myricetin Exerts Anti-Obesity Effects throughUpregulation of SIRT3 in Adipose Tissue. Nutrients 10.10.3390 / nu10121962.

[0263] 2. Shi, T., Wang, F. Stieren, E. and Tong, Q. (2005). S1RT3, a mitochondrialsirtuin deacetylase, regulates mitochondrial function and thermogenesis in brown adipocytes. J Biol Chem 280, 13560-13567.10.1074 / jbc.M414670200.

[0264] 3. Puigserver, P., Wu, Z., Park, CW, Graves, R., Wright, M. and Spiegelman, BM (1998). A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92, 829-839.10.1016 / s0092-8674(00)81410-5.

[0265] 4. Jung, H.Y., Lee, D., Ryu, H.G., Choi, B.H., Go, Y., Lee, N., Lee, D., Son, H.G., Jeon, J., Kim, S.H. et al. (2017). Myricetin improves endurance capacity and mitochondrial density by activating SIRT1 and PGC-1alpha. Sci Rep-Uk 7. ARTN 62371 0.1038 / s41598-017-05303-2.

[0266] 5. Puigserver, P. and Spiegelman, B.M. (2003). Peroxisome proliferator-activated receptor-gamma coactivator 1alpha (PGC-1alpha): transcriptional coactivator and metabolic regulator. Endocr Rev 24, 78-90. 10.1210 / er.2002-0012.

[0267] 6. Mazzucotelli, A., Viguerie, N., Tiraby, C., Annicotte, J.S., Mairal, A., Klimcakova, E., Lepin, E., Delmar, P., Dejean, S., Tavernier, G. et al. (2007). The transcriptional coactivator peroxisome proliferator activated receptor (PPAR) gamma coactivator-1alpha and the nuclear receptor PPAR alpha control the expression of glycerol kinase and metabolism genes independently of PPAR gamma activation in human white adipocytes. Diabetes 56, 2467-2475. 10.2337 / db06-1465.

[0268] 7. Choi, J.H., Banks, A.S., Estall, J.L., Kajimura, S., Bostrom, P., Laznik, D., Ruas, J.L., Chalmers, M.J., Kamenecka, T.M., Bluher, M. et al. (2010). Anti-diabetic drugs inhibit obesity-linked phosphorylation of PPARgamma by Cdk5. Nature 466, 451 - 456. 10.1038 / nature09291.

[0269] 8. Choi, J.H., Banks, A.S., Kamenecka, T.M., Busby, S.A., Chalmers, M.J., Kumar, N., Kuruvilla, D.S., Shin, Y., He, Y., Bruning, J.B. et al. (2011). Antidiabetic action of a non-agonist PPARgamma ligand blocking Cdk5-mediated phosphorylation. Nature 477, 477 - 481. 10.1038 / nature10383.

[0270] 9. Karunakaran, U., Elumalai, S., Moon, J.S., Jeon, J.H., Kim, N.D., Park, K.G., Won, K.C., Leem, J. and Lee, I.K. (2019). Myricetin Protects Against High Glucose-Induced beta-Cell Apoptosis by Attenuating Endoplasmic Reticulum Stress via Inactivation of Cyclin-Dependent Kinase 5. Diabetes Metab J 43, 192 - 205, 10.4093 / dmj.2018.0052.

[0271] 10. Zapata-Torres, G., Opazo, F., Salgado, C., Munoz, JP, Krautwurst, H., Mascayano, C., Sepulveda-Boza, S., Maccioni, RB and Cassels, BK (2004), Effects of natural flavones and flavonols on the kinase activity of Cdk5.J Nat Prod 67, 416-420.10.1021 / np034011s.

[0272] Example 6

[0273] Pharmacokinetics of Myricetin

[0274] Myricetin supplements: A 10mg dose gives a Cmax of approximately 400nM

[0275] Human Cmax: 564 mg dose = 39.4 μM Cmax (based on Table 1)

[0276] Converting from RAT:

[0277] 50 mg / kg for rats is 50 / 6.2 mg / kg for humans (from the rat myricetin table below) x 70 kg = 564 mg human dose

[0278] A human has about 45L of fluid, so 560mg / 45L=12.5mg / L=12.5μg / μl

[0279] If mw = 318 (myricetin), 1 mM = .318 mg / ml (μg / μl), then 12.5 / .318 = 39.4 μM Cmax x 10% bioavailability = 4 μM or 8 μM at a 100 mg dose

[0280] The absolute bioavailability was found to be 9.62% and 9.74% at 2 oral doses (50 mg / kg and 100 mg / kg)

[0281] (Cayman 10012600) Cmax 39.4 μM, 10 μM for use in cell culture, up to 100 μM for use in primary islets for 24 hours, no loss of viability (Karunakaran), dissolved in DMSO 5 mM = 1.6 mg / ml, 1:2000 dilution

[0282] According to Table 1 (rat): 1.5 μg / μl = 5 μM and 2.6 μg / μl = 8.7 μM Cmax

[0283] Table 1. Conversion table showing parameters and administration routes of myricetin .

[0284]

[0285] a Peak serum concentration of the drug after administration

[0286] b The amount of time a drug remains in serum at maximum concentration

[0287] c Total drug exposure over time

[0288] d The rate at which the drug is cleared from the blood

[0289] e Volume of distribution, a constant proportional to the total amount of drug in the body and its plasma concentration

[0290] f The fraction of a drug that reaches the bloodstream when compared to the amount of drug administered

[0291] Tox: 1000 mg / kg / day for mice = 11 g for humans

[0292] References cited in this example :

[0293] Choi, Jang Hyun et al. "Antidiabetic actions of a non-agonist PPARγligandblocking Cdk5-mediated phosphorylation." Nature 477.7365 (2011): 477-481.

[0294] Akindehin, Seun et al. "Myricetin exerts anti-obesity effects through upregulation of STRT3 in adipose tissue." Nutrients 10.12 (2018): 1962.

[0295] Dang, Y. et al. "Quantitative determination of myricetin in rat plasma by ultra performance liquid chromatography tandem mass spectrometry and its absolute bioavailability." Drug research 64.10 (2014): 516 - 522.

[0296] Guo, Rui Xue et al. "Preparation and characterization of microemulsions of myricetin for improving its antiproliferative and antioxidative activities and oral bioavailability." Joumal of agricultural and food chemistry 64.32 (2016): 6286 - 6294.

[0297] Hu, Tao et al. "Myricetin-induced brown adipose tissue activation prevents obesity and insulin resistance in db / db mice." European journal of nutrition 57 (2018): 391 - 403.

[0298] Karunakaran, Udayakumar et al. "Myricetin protects against high glucose-induced β-eell apoptosis by attenuating endoplasmic reticulum stress via inactivation of cyclin-dependent kinase 5." Diabetes&Metabolism Journal 43.2 (2019): 192 - 205.

[0299] Qian, Jin et al. "Self-nanoemulsifying drug delivery systems of myricetin: formulation development, characterization, and in vitro and in ViVoevaluation." Colloids and Surfaces B: Biointerfaces 160 (2017): 101-109.

[0300] Zhu, Sifeng et al. "Development of M 10, myricetin-3-O-β-d-lactose sodiumsalt, a derivative of myricetin as a potent agent of anti-chronic colonicinflammation." European Journal of Medicinal Chemistry 174 (2019): 9-15.

[0301] Example 7

[0302] Naringenin and β-carotene convert human white adipocytes to a beige phenotype and increase hormone-stimulated adipose break down

[0303] summary

[0304] Naringenin, an activator of peroxisome proliferator-activated receptors (PPARs) present in citrus fruits, upregulates markers of thermogenesis and insulin sensitivity in human adipose tissue. Our pharmacokinetic clinical trials confirm that naringenin is safe and bioavailable, and our case reports suggest that naringenin causes weight loss and improves insulin sensitivity. PPARs form heterodimers with retinoic acid X receptors (RXRs) at the promoter elements of target genes. Retinoic acid is a ligand for RXRs that is metabolized from dietary carotenoids. In clinical trials, the carotenoid β-carotene attenuates adiposity and reduces insulin resistance. Our goal was to examine whether carotenoids could potentiate the beneficial effects of naringenin on human adipocyte metabolism. Human preadipocytes from obese donors were differentiated in culture and treated with 8 μM naringenin + 2 μM β-carotene (NRBC) for seven days. Candidate genes involved in lipolysis, thermogenesis, and glucose metabolism were measured using qRT-PCR and immunoblotting. We found that carotenoids acted synergistically with naringenin to increase UCP1 and glucose metabolism genes (including GLUT4) and adiponectin compared to naringenin alone. Protein levels of PPARα, PPARγ, and PPARγ coactivator-1a, key regulators of thermogenesis and insulin sensitivity, were also upregulated after treatment with NRBC. Transcriptome sequencing was performed, and bioinformatics analysis of the data revealed that NRBC induced enzymes of several non-UCP 1 pathways for energy expenditure, including triglyceride cycling, creatine kinase, and peptidase M20 domain 1 (PM20D 1). Comprehensive analysis of changes in receptor expression showed that NRBC upregulated eight receptors associated with lipolysis or thermogenesis, including β1-adrenergic receptors and parathyroid hormone receptors. Lipolysis triggers thermogenesis, and NRBC increases triglyceride lipase content and agonist-stimulated lipolysis levels in adipocytes. We observed that expression of the isoform RXRγ, whose function is unknown, was induced tenfold after treatment with NRBC. We show that RXRγ is a coactivator that binds to immunoprecipitated PPARγ protein complexes from white and beige human adipocytes. In conclusion, NRBCs upregulate the expression of key enzymatic pathways for lipolysis and thermogenesis in human adipocytes and have therapeutic potential.

[0305] introduce

[0306] Adipose tissue is a complex, adaptive organ composed of multiple types of functionally distinct adipocytes (1). White adipocytes store triglycerides and expand in number and size under conditions of excess energy intake. Brown and beige adipocytes are abundant in mitochondria and express uncoupling protein 1 (UCP1), a protein that shifts mitochondrial fat oxidation from ATP production to thermogenesis. Increased densities of beige adipocytes and UCP1 in fat depots are associated with increased energy expenditure and resistance to weight gain and type 2 diabetes (2, 3, 4). In rodents, white adipose tissue can adapt to long-term environmental stimuli, such as cold exposure, by generating beige adipocytes from precursor cells and by converting white adipocytes to beige cells (5). The adaptive response to cold exposure includes the release of norepinephrine from sympathetic nerve fibers to activate the β3-adrenergic receptors (β3AR) (6) that are abundantly expressed in adipocytes.

[0307] In contrast to rodents, human adipocytes express very low levels of βAR. Even when combined with cold exposure, humans lack a robust response to systemic infusion of β-adrenergic agonists (7, 8, 9). However, synthetic peroxisome proliferator-activated factor receptor (PPAR) αα and γ The ligand has potent activity in converting primary human white adipocytes into beige UCP1-expressing cells in vitro (10, 11). PPARs are ligand-activated nuclear receptors that are enriched in metabolic tissues, and they regulate UCP1 and many genes that control fat oxidation and insulin sensitivity by binding to upstream PPAR response elements (PPREs). PPARγ is subject to complex cell-specific post-translational regulatory mechanisms and has multiple ligand-binding domains (12). Depending on the binding characteristics of the ligand, PPARγ can stimulate lipogenesis, insulin sensitivity, fat oxidation, or thermogenesis in adipose tissue (13).

[0308] Thiazolidinediones (TZDs) are a class of potent PPARγ agonists that have been approved by the U.S. Food and Drug Administration (FDA) for the treatment of type 2 diabetes. However, TZDs have a variety of side effects, including weight gain, heart failure, and bladder cancer risk (14, 15). PPARa agonists primarily upregulate genes for lipolysis and mitochondrial β-oxidation of fatty acids in primary human adipocytes (16). The synthetic PPARα activator fenofibrate has been approved for the treatment of dyslipidemia (17, 18). At this time, there are no FDA-approved PPARγ or PPARα activators for the treatment of obesity (19, 20, 21).

[0309] Although the regulation of ligand binding to PPARγ is complex, there is growing evidence that selective modulators and partial agonists can direct activity toward thermogenesis and away from adipogenesis (12, 22, 23). Naringenin (NR), a polyphenol found in citrus fruits, activates the transcriptional activity of PPARγ and PPARα in an expression system with a PPRE linked to a reporter gene (24). In a previous study, we treated human subcutaneous adipocytes with NR and saw induction of UCP 1 mRNA and increases in basal and maximal oxygen consumption rates (OCR) (25). We used selective inhibitors to confirm that NR upregulation of thermogenic genes requires activation of both PPARγ and PPARα in adipocytes (26). Data from our clinical studies suggest that naringenin is bioavailable and has the potential to be a treatment for obesity and type 2 diabetes. Our pharmacokinetic clinical trials showed that naringenin is safe and well tolerated at doses ranging from 150 mg to 900 mg (27). In a case study of individuals with obesity and untreated type 2 diabetes, we found that after eight weeks of NR intake, body weight and fasting insulin concentrations decreased, and energy expenditure increased measurably (26).

[0310] Carotenoids are vitamin A precursors present in fruits and vegetables, and their consumption has been shown to reduce fat mass and insulin resistance in children. Baseline blood concentrations of β-carotene (BC) are negatively correlated with fat mass (28, 29). Most carotenoids are metabolized to retinoid ligands for retinoic acid receptors (RARs) and retinoic acid X receptors (RXRs), which act as transcriptional coactivators of PPARs. The aim of this study was to determine whether carotenoids could enhance the effects of NR on gene expression and function in converting primary human adipocytes to a beige phenotype. We observed that a subset of mRNAs including UCP 1, GLUT4, ATGL, and adiponectin were synergistically increased with the combination of NR and BC (NRBC). The protein levels of PPARa, PPARγ, PGC-1αα, and NAMPT were selectively upregulated, while the mRNA levels were not increased. Whole transcriptome sequencing was performed, and the results showed that NRBC induced genes for multiple non-UCP 1 energy dissipation futile cycles, beneficial secreted peptides, and adipokines. Importantly, NRBC increased the content of multiple thermogenic and lipolysis-related receptors, including β1-adrenergic receptor (β1AR), parathyroid hormone receptor (PTHR), and stimulatory ratio natriuretic peptide receptors (NPR1 / NPR3). A comprehensive analysis of lipolysis was performed, and the results showed that the lipolysis capacity stimulated by PTHR and βAR agonists in adipocytes treated with NRBC was significantly higher than that of untreated cells. After treatment, the expression of the unique isoform RXRγ associated with brown adipogenesis was upregulated tenfold. We observed that RXRγ was bound in the PPARγ transcription complex immunoprecipitated from human adipocytes. These results indicate that NRBC has the potential to be a treatment for obesity and type 2 diabetes, and is safe, mainly because it acts on peripheral tissues, unlike most obesity drugs that act on the central nervous system (CNS) (30).

[0311] result

[0312] Carotenoids synergize with NR to amplify UCP1 content in adipocytes

[0313] Metabolites of previtamin A carotenoids are ligands for the retinoid X receptor (RXR) family of nuclear receptors that can heterodimerize with PPARa and PPARγ and recruit coactivators to active transcriptional complexes (46). Our first aim was to assess whether treatment of adipocytes with carotenoids could increase UCP 1 content, a PPAR target gene known to be upregulated by NR and a marker of beige adipogenesis (25). Three of the most abundant carotenoids in food and human serum, BC, lycopene, and lutein (47), were tested. The steady-state plasma concentration in individuals consuming a carotenoid-rich diet is approximately 2 μM, and we used this concentration in our experiments (48). Because the average serum concentration of NR is 8 μM after ingestion of 150 mg (27), we used this concentration in all assays. Treatment of primary human adipocyte cultures with BC, lutein, or lycopene alone for seven days had no effect on gene expression ( Fig. 20 ). When BC or lutein was used in combination with NR for treatment, the increase in UCP1 gene expression was synergistic and greater than the sum of the individual effects of each compound (P < 0.001). In contrast, lycopene did not alter NR-stimulated UCP1 content. Unlike lycopene, BC and lutein are provitamin A carotenoids that are metabolized to retinoic acid (49). These data suggest that RXR ligands act synergistically with NR to enhance thermogenic gene expression.

[0314] BC enhances the effects of NR on a subset of genes involved in thermogenesis and insulin sensitivity

[0315] Next, we evaluated the effects of NR, BC, and NRBC on the expression of additional genes. BC was selected for the remainder of the study because it is safe, stable, bioavailable, and has a long half-life in the circulation (50). Adipocytes from five donors with a body mass index (BMI) ranging from 27 kg / m2 to 36 kg / m2 were treated with NRBC for seven days. NRBC synergistically increased the mRNA levels of UCP1 (p<0.005), GLUT4 (p<0.02), ATGL (p<0.04), and adiponectin (p<0.05) compared to either NR or BC alone ( Fig.21 a). Protein content showed a similar trend ( Fig.21 b and Fig.21 c) Uncropped Western blot is shown in Fig.29ATGL is the rate-limiting lipase for hydrolyzing fatty acids from triglycerides (TG) (51). GLUT4 is a transporter for glucose uptake, and its upregulation in adipocytes stimulates a series of events that reduce insulin resistance (52, 53). Adiponectin is a key circulating factor that acts on muscle and other tissues and improves systemic glucose homeostasis (54). In a previous study, we reported CPT1β mRNA induction in adipocytes after NR treatment (25). We did not see an increase in CPT 1β levels with NRBC treatment compared to levels induced by NR alone.

[0316] NRBC upregulated the protein levels of PPARα, PPARγ, PGC-1α, and NAMPT by three- to six-fold ( Fig. 22 , p<0.001), while mRNA levels did not show a corresponding increase. Uncropped protein blots are shown in Fig.30 PPARα, PPARγ, and PGC-1α proteins have short half-lives and are rapidly degraded by the ubiquitin-proteasome system (55, 56, 57). Inhibition of degradation increases protein levels and target gene expression (58). Binding of ligands and coactivators may affect the turnover of PPARα and PPARγ (59, 60). Treatment with NR alone does not upregulate protein levels, suggesting that RXR ligands are required in addition to PPAR ligands for protein upregulation. The increase in these proteins without concurrent upregulation of their transcripts suggests that NR and BC act together through post-translational mechanisms to stabilize protein levels.

[0317] Whole-transcriptome sequencing for comprehensive analysis of metabolism

[0318] In order to expand our understanding of NRBC to human adipocyte reprogramming, we performed full transcriptome sequencing. Adipocyte cultures from two overweight and obese female donors were treated with cell culture medium (vehicle control) or NRBC for seven days, and RNA samples were processed for library construction. The differential gene expression results of 17525 genes were calculated, of which 3881 genes were significantly regulated under the adjusted p value of <0.05. Pathway enrichment analysis identified that PPAR signaling, adipocyte signaling and insulin signaling pathways increased most significantly after treatment ( Fig.23 ). In addition, data analysis showed that genes for pyruvate, fatty acid, glucose, and amino acid metabolism increased. These changes in mRNA content of selected genes were verified by qRT-PCR ( Fig.24 , p<0001).

[0319] I PPARg and PPARα target genes

[0320] NRBC robustly upregulated many classic brown and beige genes that have been previously identified as targets for the synthesis of PPARα and PPARγ ligands (10), including CIDEA, CITED, perilipin 2, perilipin 4, perilipin 5, PDK4, GK, AQP7, fatty acid elongase ELOVL 3, ELOVL-5, ELOVL-6, ACSL5, and fatty acid binding proteins FABP3, FABP4, and FABP7 (Table 2). In addition, FABP5, which delivers retinoic acid to nuclear receptors, was significantly upregulated.

[0321] Table 2. NRBC-induced genes associated with brown / beige phenotype, previously shown to be synthesized by PPARγ and PPARα Activator upregulation

[0322]

[0323]

[0324] *Adjusted p-value

[0325] 2. Upregulation of secreted peptides and adipokines

[0326] Adipose tissue is an endocrine organ that secretes proteins, hormones, and bioactive lipids that have beneficial paracrine effects on systemic fat and glucose metabolism. NRBC treatment significantly upregulated the expression of many of these genes, including ANGPTL4, FNDC4, and GDF11 (Table 3). ANGPTL4 is produced by adipocytes and promotes lipolysis (Table 3) (61). Both the full-length protein and the truncated form of ANGPTL4 are secreted, and their overexpression in mice stimulates energy expenditure, reduces adipose growth, and converts white fat to a beige phenotype (62). FNDC4 induces UCP1 and beige genes in adipocytes and promotes insulin sensitivity (63, 64). GDF 11, a circulating cytokine in the transforming growth factor β superfamily, decreases with age and has been studied as an anti-aging therapeutic (65). Restoration of circulating levels in aged mice promotes adipose tissue secretion of adiponectin and reduces adipose growth (66).

[0327] Table 3. Genes encoding secreted lipid factors and peptides upregulated by NRBCs

[0328]

[0329]

[0330] *Adjusted p-value

[0331] Hydroxyeicosatetraenoic acid (HETE) and dihydroxyoctadecanoic acid (diHOME) are secreted bioactive lipids produced by cytochrome P450 metabolites in brown adipocytes after cold exposure and exercise (67, 68). CYP4F11, as a cytochrome that produces 20-HETE from arachidonic acid (69), is greatly increased by NRBC. In people with detectable BAT, the circulating content of 20-HETE is associated with increased energy expenditure after cold exposure (70), and 20-HETE is a PPARα activator (71). In addition, NRBC induces epoxide hydrolases EPHX1 and EPHX2, enzymes that utilize HETE to produce 12,13-diHOME (a lipid factor associated with increased insulin sensitivity and reduced triglycerides after exercise) (72, 73).

[0332] NRBC increases several circulating CNS action proteins. Neuromodulatory peptide B is a peptide that acts on hypothalamic neurons to enhance satiety, and in genetic studies, missense mutations are associated with bulimia and obesity (74, 75). Proopiomelanocortin (POMC), as a peptide prohormone that is cleaved into hormone α-MSH by PCSK1, participates in inhibiting food intake (76). NRBC increases both POMC and PCSK1 in adipocytes. The important role of POMC is shown in studies associating rare gene mutations in POMC or PCSK1 in severe obesity of people (77). S 100b, which has been characterized in brown fat cells of mice, stimulates the neurite growth of sympathetic nerve endings in adipose tissue after cold exposure (78). The upregulation of genes for CNS action circulating factors shows that appetite reduction may play a role in the physiological response to NRBC.

[0333] 3. Increased thermogenic genes for non-UCP1I uncoupling and substrate recycling pathways

[0334] Several mechanisms other than UCP1 uncoupling mitochondria can produce thermogenic energy expenditure. These mechanisms were initially identified in studies of brown adipose tissue (BAT) from cold-exposed Ucp1 knockout mice that can maintain their body temperature (79). We found that NRBC induces a significant increase in many new thermogenic genes in human adipocytes (Table 4). The retinoic acid receptor isoform RXRγ, whose function is unknown, is highly upregulated. This isoform is located in UCP1-positive cells in human adipose tissue and is expressed at high basal levels in adipose-derived stem cells, which subsequently differentiate into brown adipocytes expressing UCP1 (80). These observations indicate that RXRγ may be a key transcription factor in the differentiation of human brown and beige adipocytes.

[0335] Table 4. Thermogenic genes upregulated by NRBC

[0336]

[0337] *Adjusted p-value

[0338] PM20D 1 levels in NRBC-treated adipocytes were upregulated by approximately 15-fold, and human gene studies have shown that the PM20D1 gene promoter has a PPRE (Benson et al., 2019). PM20D 1 is a secreted enzyme that regulates the synthesis and degradation of N-acyl amino acids (NAA), a molecule that directly uncouples mitochondria and increases energy expenditure (81). High PM20D1 levels in white adipose tissue of mice are associated with increased respiration, reversal of obesity induced by a high-fat diet, and decreased blood sugar (81, 82, 83). The phosphocreatine cycle is an enzymatic pathway that contributes to thermogenesis in Ucp1 knockout mice (84). The synthesis and decomposition of phosphocreatine by mitochondrial creatine kinases CKMT1A, CKMT1B, and CKMT2 releases heat and consumes ATP. We found that after treating white adipocytes with NRBC, genes for three CKMT isozymes were strongly upregulated. In humans, CKMT protein was previously detected only in primary brown adipocytes (85).

[0339] Beige cells favor the use of fatty acids rather than glucose to stimulate thermogenesis and have high lipase activity (86). In addition to ATGL, NRBC treatment also upregulated hormone-sensitive lipase (HSL) and protein kinase A regulatory subunit 2A (PRKAR2B) (Table 4). PRKAR2B is a key PKA subunit that regulates lipolysis activation after ligand binding of Gs-coupled receptors (87). NRBC significantly upregulated the genes PDK4, GPD 1, GK and PCK1 for the ineffective cycle of triglycerides. The activity of these enzymes causes glycolytic intermediates to shuttle into pyruvate for the synthesis of glycerol and glycerol-3-phosphate, i.e., a precursor for re-esterification of fatty acids during TG synthesis (10). NRBC also stimulated an increase in AIFM2 and UCP2, which is an NADH oxidase (AIFM2) that supports glucose metabolism during thermogenesis in brown adipocytes (88). High UCP2 levels are associated with cells having high rates of fatty acid oxidation, and there is evidence that UCP2 promotes fatty acid oxidation to stimulate mitochondrial thermogenesis (89, 90, 91).

[0340] Nicotinamide phosphoribosyltransferase (NAMPT) and nicotinic acid phosphoribosyltransferase (NAPRT) encode enzymes that produce nicotinic adenine dinucleotide (NAD) and were upregulated more than twofold. NAD is a key cofactor for cellular metabolic enzymes. In mice, impaired NAD synthesis in adipocytes causes systemic insulin resistance and inhibits lipolysis and thermogenesis (92, 93). In human adipocytes, increasing intracellular NAD induces UCP 1 and mitochondrial biogenesis, which are markers of beige cells (94). In summary, these changes in thermogenic genes indicate that adipocytes treated with NRBCs have a higher capacity for uncoupled respiration and an inefficient cycle pathway for thermogenesis.

[0341] 4. NRBCs increase the expression of receptors that regulate lipolysis and thermogenesis

[0342] There is little comprehensive data available on relative receptor content or hormone-stimulated lipolysis in human adipocytes. Based on our RNA sequencing data, receptor abundance was estimated based on transcript reads / total kilobases sequenced ( Fig.25 a and Fig.25 b). NRBC treatment significantly increased the expression of eight receptors that may be able to drive lipolysis or thermogenesis through various mechanisms, including β1AR, bile acid receptor TGR5, cold receptor TRPM8, adenosine receptor ADORA1, NPR1, G protein-coupled estrogen receptor-1 (GPER1), growth hormone receptor (GHR) and PTHR1 (Padj<0.002). In addition, β2AR, β3AR and melanocortin-1 receptor (MC1R) increased, but due to the variability of the response, this did not achieve statistical significance. Compared with other receptors, β2AR and β3AR have the lowest expression levels in white adipocytes. The abundance of β1AR is approximately four times higher than that of β2AR and β3AR, and β1AR increased threefold after NRBC exposure ( Fig.25 a) TGR5, TRPM8, as well as ADORA1 and ADORA2, were also expressed at low levels in untreated white adipocytes.

[0343] The ratio of stimulatory NPR1 to scavenging receptor NPR3 determines the magnitude of the response to natriuretic peptides. NRBC treatment increased the NPR1 / NPR3 ratio in NRBC-treated adipocytes fourfold, indicating that adipocytes are more responsive to natriuretic peptides ( Fig.25 b). NRBC increased PTHR levels by more than 2-fold ( Fig.24b). GHR is the most abundant receptor upregulated by NRBCs, and studies have shown that in human adipocytes, GH triggers lipolysis through a unique mechanism that occurs downstream of receptor signaling (41, 95). GPER1 is abundantly expressed in adipocytes, and estradiol is an endogenous ligand. Little is known about the role of GPER1 in white adipocytes (96). Selective synthetic agonists of GPER stimulate weight loss and energy expenditure in mice (97).

[0344] NRBC-treated adipocytes have higher agonist-stimulated lipolysis than white adipocytes

[0345] Thermogenesis is stimulated by lipolysis, so we determined whether agonist-stimulated glycerol release (a measure of lipolysis) reflects an increase in receptors and lipolysis mechanisms in adipocytes treated with NRBC. First, adipocyte cultures from four donors with obesity were treated with cell culture medium (untreated control cells) or NRBC for seven days. On the day of acute lipolysis assay, cells were exposed to a single receptor agonist in buffer for four hours, and the glycerol released into the cell supernatant was measured. In each experiment, non-hydrolyzable 8-cpt-cAMP (a potent activator of PKA signaling) was also evaluated as a positive control because it bypassed a single receptor and measured the maximum capacity of lipolysis (36). βAR, PTHR, MC1R, GPER, and ADORA2B are all stimulatory G protein (Gs) coupled receptors, and conduct signals through the cAMP-PKA signal transduction mechanism. NPR1 is not a Gs coupled receptor, and conducts signals through the alternative mechanism of guanylate cyclase-cGMP-protein kinase G (PKG).

[0346] Of the hormones tested, PTH-stimulated lipolysis was highest in control white adipocytes and increased to the greatest extent in cultures exposed to NRBCs ( Fig.26 ). It has been previously shown that PTH treatment of human adipocytes stimulates UCP1 expression and oxygen consumption (98). We tested atrial natriuretic peptide (ANP), one of the key endogenous ligands of NPR1 released from atrial myocytes in response to elevated blood pressure and environmental stimuli such as exercise and cold exposure (99, 100). ANP-stimulated lipolysis was increased in cells treated with NRBCs, but the overall effect was not statistically significant in adipocytes from four donors.

[0347] The overall activity of βAR was measured using isoproterenol, a nonselective agonist of the three βARs, to assess the overall potential for increased sensitivity to sympathetic stimulation. Since the abundance of βAR is 5-fold higher than that of the other βARs, the βAR selective ligand dobutamine was also tested. In cells treated with NRBCs, isoproterenol-stimulated lipolysis and dobutamine-stimulated lipolysis were significantly enhanced, and dobutamine activity was comparable to isoproterenol activity ( Fig.26 ). In NRBC-treated adipocytes, 8-cpt-cAMP-stimulated lipolysis was significantly higher than that in control cells, indicating that the maximal capacity for lipolysis is increased while PKA regulatory subunits and lipase are upregulated.

[0348] Agonists for the receptors GHR, MC1R, ADORA1 / ADORA2B, TGR5, and TRPM8 did not stimulate a detectable increase in lipolysis. In mouse white and brown adipocytes, adrenocorticotropic hormone (ACTH) and adenosine, endogenous ligands for the melanocortin receptor and ADORA2B, respectively, stimulate lipolysis and OCR (42, 44, 101). Bile acids activate TGR5 and increase OCR in human brown adipocytes (43). Although estrogen activation of GPER stimulates cAMP production in cancer cells (36), our data suggest that lipolysis is slightly reduced.

[0349] RXRγ binds to the PPARγ complex before and after treatment

[0350] After treatment, NRBC induced a strong increase in RXRγ mRNA, while RXRα remained unchanged. RXRγ is a unique isoform associated with the differentiation of brown adipocytes in human adipose tissue (80). RXR can form homodimers or heterodimers with multiple nuclear receptors other than PPARγ, so we evaluated whether RXRγ binds to PPARγ after NRBC treatment. PPARγ was immunoprecipitated from protein lysates of untreated adipocytes and adipocytes treated with NRBC. Protein complexes reduced with PPARγ were analyzed on Western blots ( Fig. 27 ). RXRγ protein expression was too low to be detected on conventional Western blots of whole-cell proteins, consistent with our transcriptome sequencing data indicating low copy number. However, we observed that RXRγ was visible in the immunoprecipitated PPARγ protein complex in both control cells (white adipocytes) and beige adipocytes treated with NRBCs ( Fig. 27). RXRα was expressed in greater amounts and was readily detected in Western blots and PPARγ immunoprecipitates. These results suggest that both isoforms are constitutively bound and that RXRy binding is independent of the addition of exogenous ligand. RXR isoforms stabilize the PPARγ complex at the PPRE promoter element and direct the expression of specific target genes upon ligand binding (46). Therefore, after the addition of BC, high levels of RXRγ can direct expression to beige genes.

[0351] discuss

[0352] Thermogenesis is an essential component of energy balance. Many studies have demonstrated that human adipocytes have functional plasticity to convert into thermogenic cells by non-adrenergic stimulation, making adipose tissue a relevant peripheral target tissue for obesity drugs (10, 37, 45)(98). In this report, we investigated the possibility that carotenoids enhance the thermogenic response of human adipocytes to NR, a natural activator of PPARα and PPARγ. Provitamin A carotenoids are converted into ligands for the RXR nuclear receptor, which form heterodimers with PPAR and coordinate the expression of metabolic genes. We evaluated adipocytes treated for seven days with NR and carotenoids at concentrations achieved in serum after oral administration to humans. Compared with NR alone, the two provitamin A carotenoids BC and lutein synergistically enhanced UCP1 content. The third carotenoid we studied, lycopene, was not converted into a RXR ligand and did not alter the NR response. We performed additional experiments using BC and found that NRBC also enhanced the expression of ATGL, GLUT4, and adiponectin, drivers of lipolysis and insulin sensitivity. The effect of BC was selective. There was no increase in the expression of the PPARα target gene CPT1β and the PPARγ regulated gene PM20D1 compared to treatment with NR alone.

[0353] NRBC upregulated the protein content of PGC-1α, PPARγ and PPARα, while the mRNA content did not increase to a considerable extent, indicating that the mechanism does not include enhanced translation. Pgc-1α is a cold-induced coactivator of PPARγ and PPARα, with a short protein half-life and its transcriptional activity upregulated in mice by a mechanism that slows degradation (58). When its protein content increases, Pgc-1α protein associates with the PPARγ / RXR complex and selectively promotes the expression of UCP 1 and mitochondrial proteins (102). Increased PGC-1α protein drives the PPARα / RXR complex toward GK expression and TG cycle activity in human adipocytes (103). The half-life of PPARγ and PPARα proteins is regulated by controlling the degradation rate after ligand and cofactor binding (56, 57, 59). Since treatment with NR alone does not upregulate protein content, our data indicate that both NR and BC are necessary to stabilize PPAR protein content.

[0354] Brown and beige adipocytes release specialized bioactive lipid factors and proteins into the circulation, thereby activating systemic insulin sensitivity and fatty acid uptake. Transcriptome sequencing shows that NRBC treatment significantly up-regulated Cyp4f11, EPDX1 and EPDX2, i.e., the enzymes producing HETE and di-HOME (69, 72). Secreted HETE and di-HOME can conduct signals to tissues to increase fatty acid uptake, and these effects have a beneficial effect on reducing blood lipids (73). HETE is a strong PPAR activator (71), and can enhance PPAR target gene expression when combined with the PPAR protein of the increased content observed after NRBC treatment. NRBC also induced the secreted protein ANGPTL4 and the insulin sensitizer adiponectin FNDC4 and GDF 11 that stimulate adipocyte lipolysis.

[0355] ATGL is the rate-limiting lipase for releasing fatty acids from TG, and fatty acids are natural ligands of PPARα and PPARγ. In metabolically active beige cells, fatty acids shuttle into mitochondria to stimulate thermogenesis (86). In an ineffective cycle of energy consumption, fatty acids are also reesterified to the glycerol backbone of TG. Whole transcriptome sequencing shows that NRBC stimulates many genes for glyceroneogenesis and TG synthesis, including PDK4, PCK1, GK, and GPD 1. When thermogenesis is activated in adipocytes, PDK4 directs pyruvate produced by glycolysis to flow into glycerol production (104). The PCK1 gene encodes PEPCK, the rate-limiting enzyme for synthesizing glycerol from pyruvate. Studies using radiolabeled pyruvate in human adipocytes have shown that after inducing PCK1 or PDK4 in human adipocytes, the label is incorporated into the glycerol backbone and TG (10, 105). Additionally, GK and GPD1 encode enzymes that generate glycerol-3-phosphate as a substrate for fatty acid esterification (106, 107). The end result of the TG cycle is increased energy expenditure and decreased free fatty acids released into the circulation (104).

[0356] In addition to UCP 1 and TG circulation, we also found that NRBC stimulated a variety of other uncoupling and ATP consumption enzymatic pathways. The highest upregulated gene is PM20D 1, which encodes an enzyme that reversibly synthesizes NAA with potent mitochondrial uncoupling activity (108). In humans, the functional phenotype of PM20D1 is not fully defined. In clinical trials, the serum concentration of PM20D 1 is positively correlated with fat gain and glucose metabolism biomarkers such as glycosylated hemoglobin and fasting blood glucose (109). Both PM20D 1 and NAA are combined with serum proteins, and the regulation of people's NAA circulation content is complex (110). The relationship between people's adipose tissue PM20D 1 and body weight is unclear. The mutation in the upstream of PM20D 1 gene combined with PPARγ regulatory elements causes the basal expression level in adipocytes to vary widely. However, the basal content of PM20D 1 in human adipose tissue is unrelated to circulating NAA content (111). Currently, no clinical studies have been performed to determine whether a large increase in PM20D1 expression in beige adipose tissue is sufficient to cause an increase in circulating NAA levels and contribute to weight loss.

[0357] NRBCs largely induced mitochondrial creatine kinases CKMT1 A, CKMT1B, and CKMT2. Functional studies in mice showed that creatine kinase in brown adipocytes was upregulated and contributed to whole-body energy expenditure after cold exposure or in the absence of Ucp1 (84). Interestingly, in mice, abolition of creatine metabolism in white adipose tissue inhibited thermogenesis and led to obesity (112). In primary human brown adipocytes, proteomic analysis of the thermogenic pathway showed that ATP-coupled respiration was stimulated while uncoupled respiration was not present, and it accounted for half of the total oxygen consumption (85). The cycle of creatine phosphate supports ATP-coupled mitochondrial respiration by increasing the availability of ADP and phosphate to ATP-synthase. The strong induction of creatine kinase by NRBCs suggests that ATP-coupled respiration and the creatine phosphate cycle can contribute to thermogenesis in human beige adipocytes.

[0358] We show that enzymes involved in maintaining intracellular NAD levels, including AIFM2, NAMPT, and NAPRT, are increased following NRBC exposure. AIFM2 converts NADH to NAD to support the high levels required for glycolysis (88). Both NAMPT and NAPRT synthesize NAD from intracellular precursors to support cellular needs during conditions of increased metabolic rate and oxidative stress (113). In addition, NAD is a cofactor for silent information regulator enzymes (SIRTs), which are protein deacetylases that regulate the activity of PPARγ, PGC-1αα, and other transcriptional activators of mitochondrial biogenesis, as well as metabolic genes (114). Increasing NAD levels in human adipocytes can transform the phenotype from white to beige (94).

[0359] Our quantitative RNAseq analysis showed that in human white adipocytes, the abundance of RXRα transcripts was 300-fold higher than that of RXRγ, however, only the RXRγ isoform was robustly upregulated by NRBC treatment. We found that both RXRγ and RXRα proteins were bound in immunoprecipitated PPARγ complexes from untreated white adipocytes and beige cells treated with NRBC. These results suggest that the binding of both isoforms to the PPARγ complex is constitutive and ligand-independent. In human perirenal adipose tissue, RXRγ expression is enriched in brown adipocyte progenitors and is induced simultaneously with UCP1 during the transition from white to beige adipocytes (80). Possible mechanisms for targeting beige genes may be through the recruitment of specific coactivators by RXRγ or conformational changes stimulated by BC binding, which promote and stabilize the interaction of this isoform with specific promoter elements (115)(46). In addition, the increase in RXRγ, PGC1α, PPARα, and PPARγ proteins after NRBC treatment suggests the presence of a positive feedback loop that upregulates the genes identified in this study.

[0360] We use transcriptome sequencing data to estimate the relative expression levels of receptors known to activate lipolysis or thermogenesis in adipocytes. In cells treated with NRBC, eight receptors are upregulated, and several other receptors tend to be higher. We evaluated the stimulation of lipolysis by agonists of receptors changed by NRBC, and found that only a small group was lipolysis. ACTH and adenosine stimulated lipolysis in mouse white adipocytes, and we did not see the effect (44, 101). In our determination, TGR5 and TRPM8 agonists induced thermogenic genes in human adipocytes, but did not stimulate lipolysis. We and others have shown that mild cold exposure of subcutaneous human adipocytes activated UCP 1 expression through TRPM8, so a large increase in receptor content after NRBC treatment is likely to act locally to make adipocytes sensitive to cold and stimulate thermogenesis (45, 116). After NRBC exposure, GHR and GPER1 are induced to the highest content of receptors, but neither growth hormone nor estrogen stimulates lipolysis.

[0361] NRBCs upregulated PTHR content. In addition, PTH stimulated the lipolysis of the maximum value of the hormone tested in cells pretreated by NRBCs. PTH is released from the parathyroid glands for regulating systemic calcium homeostasis, and all tissues express PTHR (117). Increasing evidence shows that PTH plays an important role in adipose tissue metabolism. PTH stimulates lipolysis in mouse adipocytes and thermogenic gene expression in human adipocytes (98, 118). Cold-induced increases in circulating PTH shift the swimmer's systemic metabolism toward lipid utilization to stimulate energy expenditure (119).

[0362] NRBCs increase the stimulatory ratio of NPR1 / NPR3 receptors. ANP is released after cold exposure and exercise and acts additively with adrenergic agonists to stimulate lipolysis and brown adipocyte characteristics in human white adipocytes (37). Although the increase was not statistically significant, our data showed a trend toward increased lipolysis activated by ANP in cells treated with NRBCs.

[0363] We observed that β1AR expression levels in human adipocytes are generally higher than other β1ARs, and that β1AR was induced threefold by NRBCs. We tested glycerol release with the pan-βAR agonist isoproterenol and the β1AR selective agonist dobutamine and found that both stimulated similar increases in cells exposed to NRBCs compared to untreated cells. These results are consistent with other studies showing that β1AR is the predominant isoform in human white and brown adipocytes (39, 120).

[0364] NRBC significantly increased the expression of PRKAR2B, a key PKA regulatory subunit associated with insulin sensitivity and weight gain resistance in humans (87). We used 8-cpt-cAMP to activate PKA downstream of the receptor and observed a considerable increase in the maximal capacity for lipolysis in adipocytes pretreated with NRBC. Impaired cAMP-stimulated TG lipolysis in subcutaneous adipose tissue is a feature of obesity and insulin resistance (121). A comprehensive analysis of two female cohorts followed for ten years was performed to determine adipose tissue features that predict weight gain. Low levels of stimulated lipolysis and PRKAR2B expression predicted weight gain and impaired glucose metabolism (122). Interestingly, there was no correlation with basal lipolysis or fat oxidation.

[0365] Human responses to cold exposure and exercise include transient release of ANP and PTH into the circulation in adipose tissue and sympathetic release of catecholamines (99, 119) (37, 39, 98). Our data suggest that adipose tissue of individuals consuming NRBCs may be more responsive to circulating hormones released following these stimuli. In this report, we demonstrate that NRBCs reprogram adipocytes by upregulating multiple thermogenic pathways, beneficial secreted factors, receptors, and lipolysis, as summarized in Fig.28 NR and BC have a good safety profile and can potentially be administered long-term without adverse effects (27, 29). Randomized, double-blind, placebo-controlled clinical trials are needed to determine whether the effects of NRBC on adipocytes translate into weight loss and improved insulin sensitivity.

[0366] Materials and methods

[0367] Chemicals and antibodies

[0368] Naringin extract (NR) from whole sweet orange (purity ≥ 30%) was purchased from GE Nutrients, Inc. (Gencor, Irvine, CA). BC, lycopene, and lutein were from Cayman Chemical Co. Protease and phosphatase inhibitors were purchased from Cell Signaling Technology (Danvers, MA), and TGX protein gel was purchased from BIO-RAD (Hercules, CA). Collagenase type 1, glycerol standard solution, adenosine, estradiol, human pituitary growth hormone, dobutamine hydrochloride, human atrial natriuretic peptide, ACTH, menthol, 8-CPT-cAMP were purchased from Sigma-Aldrich. Isoproterenol, human parathyroid hormone (1-34), CDCA were purchased from Cayman Chemicals. Glycerol reagent A was from ZenBio (Durham, NC). All other chemicals were purchased from Sigma (St. Louis, MO) unless otherwise indicated.

[0369] The primary antibodies used were UCP1 (no. MAB6158, R&D Systems), GLUT4 (Ab654 Abeam), PGC-1α (ST1202, Sigma) and β-actin (A5316, Sigma) or monoclonal antibodies from Santa Cruz against ATGL (sc-365278), adiponectin (sc-136131), PPARα (398394), PPARγ (sc-7273), NAMPT (sc-393444), RXRγ (sc-514134), RXRa (sc-515929). Specific antibody-antigen complexes were detected using HRP-linked anti-rabbit (12-348, Sigma), anti-mouse (AP130P, Sigma) and anti-IgGκ light chain (sc-516102, Santa Cruz). Western Lightning Plus-ECL was from PerkinElmer (Waltham, MA).

[0370] Human adipocyte culture

[0371] Human adipose-derived stem cells from overweight and obese female donors were purchased from LaCell, LLC (New Orleans, Louisiana) or isolated from postoperative donated liposuction waste from obese women using methods as previously described (31). Cells were seeded, maintained until two days post-confluence, and differentiated into adipocytes in the presence of rosiglitazone and isobutylmethylxanthine for five days as previously described (25). Adipocytes were treated with 8 μM NR and 2 μM carotenoids dissolved in DMSO at 1000X starting five days after the differentiation period in adipocyte maintenance medium with heat-inactivated serum for seven days, after which RNA and protein were isolated from adipocyte cultures.

[0372] RNA extraction and transcriptome sequencing

[0373] Total RNA was extracted from cells using Tri-reagent and purified with RNeasy (Qiagen) into nuclease-free water with RNAsecure reagent (Thermo Fisher Scientific). RNA integrity was assessed using Agilent Bioanalyzer 2100. RNA samples were diluted to 50 ng / μL and the library was constructed using Lexogen Quant-Seq 3′mRNA-Seq library preparation kit (SKU015.96) with oligo (dT) priming. Double-stranded cDNA was purified with magnetic beads, the library was amplified using PCR, and transcripts were indexed, merged, and sequenced forward at 50 bp using NextSeq500 (Illumina). Alignment was analyzed using BlueBee software, and differential expression analysis was performed using the DESeq2 V1.32.0 package in R V4.1.0, Rstudio V1.4.1717, and biomaRt V2.48.2 after estimating the possible outlier counts for each gene via Cook distance and replacing all counts of the gene with the truncated mean. Differential gene expression results were calculated for 17,525 genes, of which 3,881 genes were differentially regulated at an adjusted p-value of <0.05. Pathway enrichment analysis was performed via the Gene Set Enrichment Analysis (GSF.A) tool (32) by estimating the enrichment of pathways present in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database (33) and additional custom pathways available from the Molecular Signatures Database repository (MSigDb, http: / / software.broadinstitute.org / gsea / msigdb) (34). Gene sets with FDR ≤ 5% were considered significantly enriched (35).

[0374] Quantitative real-time polymerase chain reaction (qRT-PCR)

[0375] Quantitative reverse transcriptase and real-time PCR were performed in one reaction, with gene-specific reverse PCR primers also priming cDNA synthesis, as described previously (25). Primer-probe sequences for UCP1, GLUT4, ATGL, adiponectin, PGC-1α, and ribosomal RPL13A used to adjust target gene values ​​for total RNA in each sample have been reported previously (25). Additional primer and probe oligonucleotide sets used in this study are shown in the 5' to 3' direction: PPARα forward GTCGATTTCACAAGTGCCTTTC reverse CAGGTAAGAATTTCTGCTTTCAGTT probe AACGAATCGCGTTGTGTGACATCC; PDK4 forward CTGAGAATTATTGACCGCCTCT reverse GAAATTGGCAAGCCGTAACC probe TACATACTCCACTGCACCAACGCC; PPAR γ Forward CCCAAGTTTGAGTTTGCTGTG Reverse GCGGTCTCCACTGAGAATAATG Probe TGGAATTAGATGACAGCGACTTGGCA; NAMPT Forward TGTTCCTTCAAGTGTAGCTATGT Reverse TGCTGGCGTCCTATGTAAAG Probe AACGTCTTTCAAGGACCCAGTTGCT; CKMT 1 Forward CTTGACCTGTCCATCTAACCTG Reverse ACTCCTCCAGTACCACGTT Probe AGATAGCCGCTTCCCAAAGATCCTG. Pre-designed human primer and probe sets from Thermofisher Scientific were PM20D1 Hs00399438m1; ANGPTL4 Hs00211522m1; GDF11 Hs00195156ml; S100B Hs00902901_m1.

[0376] Proline Extraction, PPAR γ Immunoprecipitation and western blotting

[0377] After seven days of treatment, whole-cell proteins were isolated from differentiated cell cultures, lysed with RIPA buffer containing protease and phosphatase inhibitors, and pushed four times through a 20-gauge needle to disrupt organelles. Fifty micrograms of total cellular protein were loaded per channel and resolved in a 7.5% SDS-PAGE gel, transferred to a nitrocellulose membrane, and probed with specific primary antibodies overnight at 4°C. Target proteins were detected using anti-rabbit or anti-mouse secondary antibodies conjugated to horseradish peroxidase. Protein bands on western blots were quantified using Image J. To adjust for variations in total protein loaded in each channel, β-actin was used.

[0378] PPARγ was immunoprecipitated from whole cell lysates using the Pierce MS compatible magnetic IP kit with protein A / G beads using SC-7273 antibody (Santa Cruz) according to the kit instructions (Pierce 90409, Thermofisher). Briefly, the primary anti-PPARγ antibody was incubated with 600 micrograms of adipocyte protein lysate for 4 hours on a tube invertor at 4°C. Then, the antibody-lysate mixture was incubated with protein A / G magnetic beads for one hour, and the complex of PPARγ protein attached to the beads was separated, washed and eluted using a magnetic tube stand. The sample was evaporated to dryness under vacuum, resuspended in RIPA buffer, and subjected to Western blot analysis. The primary antibody heavy chain band was eliminated using an HRP-conjugated anti-IgG K light chain secondary antibody to avoid interfering with the detection of the immunoprecipitated target protein. Proteins were visualized using Western Lightening (Amersham) by chemiluminescence.

[0379] Lipolysis assay :

[0380] Cells were differentiated in 96-well plates and treated with cell culture medium (untreated) or NRBC for seven days. On the day of the lipolysis assay, cells were exposed to buffer (KRB with 1% BSA) or receptor agonists dissolved in buffer for 4.5 hours. Agonists were used at the indicated concentrations to give maximal responses and were: 8-Cpt-cAMP 200 μM non-hydrolyzable PKA activator (cAMP) for maximal stimulation of lipolysis (36), 0.1 μM atrial natriuretic peptide for NPR1 and NPR3 (37), 1 μM parathyroid hormone (amino acids 1-34) for PTHR (38), 1 μM isoproterenol for all βARs and 1 μM dobutamine for β1AR (39), 1 μM estradiol for GPER (40), 250 ng / ml growth hormone for GHR (41), 1 μM adrenocorticotropic hormone for MC1R (42), 30 μM bile acid chenodeoxycholic acid for TGR5 (43), 1 μM adenosine for ADORA1 and ADORA2B (44), and 100 μM menthol for TRPM8 (45). The supernatant was removed to measure the released glycerol using Glycerol Reagent A and the concentration was determined using a standard curve. Data are from four or five experiments, each utilizing cells from a different donor with a BMI ranging from 27 to 36.

[0381] Statistical analysis :

[0382] Statistical analysis was performed using SAS 9.4 (SAS Institute, Cary, North Carolina). The synergistic effect of the combination of NR and BC was studied by implementing a linear mixed effects model including plates as random effects. The goal was to test whether the combination (NRBC) would induce a greater response compared to the sum of the effects of the individual components. Based on the mixed effects model, an F test was constructed to evaluate the additive effect of NR plus control, and the additive effect of BC plus control was no different from the additive effect of NRBC plus control. We also used a linear mixed effects model to test the following effects: 1) NR, BC and NRBC target variables for mRNA and protein compared to the control; 2) lipolysis stimulated by agonists in cells pretreated by NRBC relative to untreated cells. The experiment was repeated at least three times in primary adipocytes from different donors. Significance was set to p<0.05. Unless otherwise specified, data are reported as least squares mean ± standard error.

[0383] References cited in this example :

[0384] 1. Kajimura S, Spiegelman BM, Seale P. Brown and Beige Fat: Physiological Roles beyond Heat Generation. Cell Metab. 2015; 22(4):546-59.

[0385] 2. Guerra C, Koza RA, Yamashita H, Walsh K, Kozak LP. Emergence of brownadipocytes in white fat in mice is under genetic control. Effects on bodyweight and adiposity. J Clin Invest. 1998, 102(2): 412-20.

[0386] 3. Kopecky J, Clarke G, Enerback S, Spiegelman B, Kozak LP. Expression of the mitochondrial uncoupling protein gene from the aP2gene promoter prevents genetic obesity. J Clin Invest. 1995;96(6):2914-23.

[0387] 4. Vallerand AL, Perusse F, Bukowiecki LJ. Stimulatory effects of cold exposure and cold acclimation on glucose uptake in rat peripheral tissues. Am J Physiol. 1990;259(5 Pt 2):R1043-9。

[0388] 5. Barbatelli G, Murano I, Madsen L, Hao Q, Jimenez M, Kristiansen K, et al. The emergence of cold-induced brown adipocytes in mouse white fat depots is determined predominantly by white to brown adipocyte transdifferentiation. Am J Physiol Endocrinol Metab. 2010;298(6):E1244-53.

[0389] 6. Himms-Hagen J, Cui J, Danforth E, Jr., Taatjes DJ, Lang SS, Waters BL, et al. Effect of CL-316,243, a thermogenic beta 3-agonist, on energy balance and brown and white adipose tissues in rats. Am J Physiol. 1994;266(4 Pt 2):R1371-82。

[0390] 7. Cypess AM, Chen YC, Sze C, Wang K, English J, Chan O, et al. Cold but not sympathomimetics activates human brown adipose tissue in vivo. Proc Natl Acad Sci USA. 2012;109(25):10001-5。

[0391] 8. Finlin BS, Memetimin H, Zhu B, Confides AL, Vekaria HJ, El Khouli RH, et al. The beta3 - adrenergic receptor agonist mirabegron improves glucose homeostasis in obese humans. J Clin Invest. 2020;130(5):2319 - 31.

[0392] 9. Vosselman MJ, van der Lans AA, Brans B, Wierts R, van Baak MA, Schrauwen P, et al. Systemic beta - adrenergic stimulation of thermogenesis is not accompanied by brown adipose tissue activity in humans. Diabetes. 2012;61(12):3106 - 13.

[0393] 10. Barquissau V, Beuzelin D, Pisani DF, Beranger GE, Mairal A, Montagner A, et al. White - to - brite conversion in human adipocytes promotes metabolic reprogramming towards fatty acid anabolic and catabolic pathways. Mol Metab. 2016;5(5):352 - 65.

[0394] 11. Loft A, Forss I, Siersbaek MS, Schmidt SF, Larsen AS, Madsen JG, et al. Browning of human adipocytes requires KLF11 and reprogramming of PPARgamma superenhancers. Genes Dev. 2015;29(1):7 - 22.

[0395] 12. Kaupang A, Hansen TV. The PPAR Omega Pocket: Renewed Opportunities for Drug Development. PPAR Res. 2020; 2020: 9657380.

[0396] 13. Tan Y, Muise ES, Dai H, Raubertas R, Wong KK, Thompson GM, et al. Novel transcriptome profiling analyses demonstrate that selective peroxisome proliferator-activated receptor gamma (PPARgamma) modulators display attenuated and selective gene regulatory activity in comparison with PPARgamma full agonists. Mol Pharmacol. 2012; 82(1): 68-79.

[0397] 14. Benvenuti S, Cellai I, Luciani P, Deledda C, Baglioni S, Giuliani C, et al. Rosiglitazone stimulates adipogenesis and decreases osteoblastogenesis in human mesenchymal stem cells. J Endocrinol Invest. 2007; 30(9): RC26-30.

[0398] 15. Soccio RE, Chen ER, Lazar MA. Thiazolidinediones and the promise of insulin sensitization in type 2 diabetes. Cell Metab. 2014; 20(4): 573-91.

[0399] [ PubMed ] 16.Ribet C,Montastier E,Valle C,Bezaire V,Mazzucotelli A,Mairal A. Control of lipid and glucose metabolism in human white adipocytes by peroxisome proliferator-activated receptor-alpha.Endocrinology.2010:151(1):123-33.

[0400] Am J ClinNutr.2009:89(2):693S-6S.17.Allen LH.How common is vitamin B-12 deficiency?

[0401] 18.FDA.gov.Tricor Fenofibrate[Documentation:https: / / www.accessdata.fda.gov / drugsatfda_docs / label / 2010 / 021656s019lbl.pdf.

[0402] [ PubMed ] [ Cross Ref ] 19. Cheng HS, Tan WR, Low ZS, Marvalim C, Lee JYH, Tan NS.

[0403] 20.Boeckmans J,Natale A,Rombaut M,Buyl K,Rogiers V,De Kock J. Anti-NASH Drug Development Hitches a Lift on PPAR Agonism.Cells.2019:9(1).

[0404] 21. Steele H, Gomez-Duran A, Pyle A, Hopton S, Newman J, Stefanetti RJ, et al. Metabolic effects of bezafibrate in mitochondrial disease. EMBO Mol Med. 2020;12(3):e11589.

[0405] 22. Choi JH, Banks AS, Estall JL, Kajimura S, Bostrom P, Laznik D, et al. Anti-diabetic drugs inhibit obesity-linked phosphorylation of PPARgamma by Cdk5. Nature. 2010;466(7305):451-6.

[0406] 23. Zhang F, Lavan BE, Gregoire FM. Selective Modulators of PPAR-gamma Activity: Molecular Aspects Related to Obesity and Side-Effects. PPAR Res. 2007;2007:32696.

[0407] 24. Goldwasser J, Cohen PY, Yang E, Balaguer P, Yarmush ML, Nahmias Y. Transcriptional regulation of human and rat hepatic lipid metabolism by the grapefruit flavonoid naringenin: role of PPARalpha, PPARgamma and LXRalpha. PLoS One. 2010;5(8):e12399.

[0408] 25. Rebello CJ, Greenway FL, Lau FH, Lin Y, Stephens JM, Johnson WD, et al. Naringenin Promotes Thermogenic Gene Expression in Human White Adipose Tissue. Obesity (Silver Spring). 2019;27(1):103-11.

[0409] 26. Murugesan N, Woodard K, Ramaraju R, Greenway FL, Coulter AA, Rebello CJ. Naringenin Increases Insulin Sensitivity and Metabolic Rate: A Case Study. J Med Food. 2020;23(3):343 - 8.

[0410] 27. Rebello CJ, Beyl RA, Lertora JJL, Greenway FL, Ravussin E. Ribnicky DM et al. Safety and pharmacokinetics of naringenin: A randomized, controlled, single - ascending - dose clinical trial. Diabetes Obes Metab. 2020;22(1):91 - 8.

[0411] 28. Canas JA. Mixed carotenoid supplementation and dysmetabolic obesity: gaps in knowledge. Int J Food Sci Nutr. 2021;72(5):653 - 9.

[0412] 29. Canas JA, Lochrie A, McGowan AG, Hossain J, Schettino C, Balagopal PB. Effects of Mixed Carotenoids on Adipokines and Abdominal Adiposity in Children: A Pilot Study. J Clin Endocrinol Metab. 2017,102(6):1983 - 90.

[0413] 30. Coulter AA, Rebello CJ, Greenway FL. Centrally Acting Agents for Obesity: Past, Present, and Future. Drugs. 2018;78(11):1113 - 32.

[0414] 31. Li J, Curley JL, Floyd ZE, Wu X, Halvorsen YDC, Gimble JM. Isolation of Human Adipose-Derived Stem Cells from Lipoaspirates. Methods Mol Biol. 2018;1773:155-65.

[0415] 32. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci USA. 2005;102(43):15545-50.

[0416] 33. Ogata H, Goto S, Sato K, Fujibuchi W, Bono H, Kanehisa M. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 1999;27(1):29-34.

[0417] 34. Liberzon A, Birger C, Thorvaldsdottir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 2015;1(6):417-25.

[0418] 35. Reiner A, Yekutieli D, Benjamini Y. Identifying differentially expressed genes using false discovery rate controlling procedures. Bioinformatics. 2003;19(3):368-75.

[0419] 36. Gettys TW, Blackmore PF, Corbin JD. An assessment of phosphodiesterase activity in situ after treatment of hepatocytes with hormones. Am J Physiol. 1988;254(4 Pt 1):E449-53。

[0420] 37. Bordicchia M, Liu D, Amri EZ, Ailhaud G, Dessi-Fulgheri P, Zhang C et al. Cardiac natriuretic peptides act via p38 MAPK to induce the brown fat thermogenic program in mouse and human adipocytes. J Clin Invest. 2012;122(3):1022-36。

[0421] 38. Hoare SR, Gardella TJ, Usdin TB. Evaluating the signal transduction mechanism of the parathyroid hormone 1 receptor. Effect of receptor-G-protein interaction on the ligand binding mechanism and receptor conformation. J Biol Chem. 2001;276(11):7741-53。

[0422] 39. Riis-Vestergaard MJ, Richelsen B, Bruun JM, Li W, Hansen JB, Pedersen SB. Beta-1 and Not Beta-3 Adrenergic Receptors May Be the Primary Regulator of Human Brown Adipocyte Metabolism. J Clin Endocrinol Metab. 2020;105(4)。

[0423] 40. Filardo EJ, Quinn JA, Frackelton AR, Jr., Bland KI. Estrogen action via the G protein-coupled receptor, GPR30: stimulation of adenylyl cyclase and cAMP-mediated attenuation of the epidermal growth factor receptor-to-MAPK signaling axis. Mol Endocrinol. 2002;16(1)70-84.

[0424] 41. Sharma VM, Vestergaard ET, Jessen N, Kolind-Thomsen P, Nellemann B. Nielsen TS et al. Growth hormone acts along the PPARgamma-FSP27 axis to stimulate lipolysis in human adipocytes. Am J Physiol Endocrinol Metab. 2019.316(1):E34-E42.

[0425] 42. Schnabl K, Westermeier J, Li Y, Klingenspor M. Opposing Actions of Adrenocorticotropic Hormone and Glucocorticoids on UCP1-Mediated Respiration in Brown Adipocytes. Front Physiol. 2018;9:1931.

[0426] 43. Breeders EP, Nascimento EB, Havekes B, Brans B, Roumans KH, Tailleux A et al. The Bile Acid Chenodeoxycholic Acid Increases Human Brown Adipose Tissue Activity. Cell Metab. 2015;22(3):418-26.

[0427] 44.Gnad T,Scheibler S,von Kugelgen I,Scheele C,Kilic A,Glode AAdenosine activates brown adipose tissue and recruits beige adipocytes viaA2A receptors.Nature.2014:516(7531):395-9.

[0428] 45.Rossato M,Granzotto M,Macchi V,Porzionato A,Petrelli L,Calcagno AHuman white adipocytes express the cold receptor TRPM8 whose activationinduces UCP1 expression,mitochondrial activation and heat production.Mol CellEndocrinol.2014:383(1-2):137-46.

[0429] 46.AI,Tan NS,Gelman L,Kersten S,Seydoux J,Xu J.In vivo activationof PPAR target genes by RXR homodimers.EMBO J.2004&23(10)2083-91.

[0430] [ PubMed ] 47.Rao AV,Rao LG.Carotenoids and human health.Pharmacol Res.2007:55(3):207-16.

[0431] 48. Pierce JP, Natarajan L, Sun S, Al-Delaimy W, Flatt SW, Kealey S, et al. Increases in plasma carotenoid concentrations in response to a major dietary change in the Women's Healthy Eating and Living Study. Cancer Epidemiol Biomarkers Prev. 2006;15(10):1886 - 92. 49. Arballo J, Amengual J, Erdman JW, Jr. Lycopene: A Critical Review of Digestion, Absorption, Metabolism, and Excretion. Antioxidants (Basel). 2021;10(3).

[0432] 50. Unlu NZ, Bohn T, Francis D, Clinton SK, Schwartz SJ. Carotenoid absorption in humans consuming tomato sauces obtained from tangerine or high-beta-carotene varieties of tomatoes. J Agric Food Chem. 2007,55(4):1597 - 603.

[0433] 51. Bezaire V, Mairal A, Ribet C, Lefort C, Girousse A, Jocken J, et al. Contribution of adipose triglyceride lipase and hormone-sensitive lipase to lipolysis in hMADS adipocytes. J Biol Chem. 2009;284(27):18282 - 91.

[0434] 52.Moraes-VieiraΜM,Saghatelian A,Kahn BB.GLUT4 Expression inAdipocytes Regulates De Novo Lipogenesis and Levels of a Novel Class ofLipids With Antidiabetic and Anti-inflammatory Effects.Diabetes.2016;65(7):1808-15。

[0435] 53.Carvalho E,Kotani K,Peroni OD,Kahn BB.Adipose-specificoverexpression of GLUF4 reverses insulin resistance and diabetes in micelacking GLUT4 selectively in muscle.Am J Physiol Endocrinol Metab.2005;289(4):E551-61.

[0436] 54.Achari AE,Jain SK.Adiponectin,a Therapeutic Target for Obesity,Diabetes,and Endothelial Dysfunction.Int J Mol Sci.2017;18(6)。

[0437] 55.Miller KN,Clark JP,Anderson RM.Mitochondrial regulator PGC-1a-Modulating the modulator.Curr Opin Endocr Metab Res.2019;5:37-44。

[0438] 56.Kilroy GE,Zhang X,Floyd ZE.PPAR-gamma AF-2 domain functions as acomponent of a ubiquitin-dependent degradation signal.Obesity(Silver Spring).2009;17(4):665-73。

[0439] 57.Blanquart C,Baibier O,Fruchart JC,Staels B,Glineui C.Peroxisomeproliferator-activated receptor alpha(PPARalpha)turnover by the ubiquitin-proteasome system controls the ligand-induced expression level of its targetgenes.J Biol Chem.2002;277(40):37254-9。

[0440] 58.Wei P,Pan D,Mao C,Wang YX.RNF34 is a cold-regulated E3ubiquitinligase for PGC-1alpha and modulates brown fat cell metabolism.Mol CellBiol.2012;32(2):266-75。

[0441] 59.Blanquart C,Mansouri R,Fruchart JC,Staels B,Glineur C.Differentways to regulate the PPARalpha stability.Biochem Biophys Res Commun.2004;319(2):663-70。

[0442] 60.Hauser S,Adelmant G,Sarraf P,Wright HM,Mueller E,SpiegelmanBM.Degradation of the peroxisome proliferator-activated receptor gamma islinked to ligand-dependent activation.J Biol Chem.2000,275(24):18527-33。

[0443] [ PMC free article ] [ PubMed ] 61. Gray NE, Lam LN, Yang K, Zhou AY, Koliwad S. Wang JC.

[0444] 62.McQueen AE,Kanamaluru D,Yan K,Gray NE,Wu L,Li MLThe C-terminalfibrinogen-like domain of angiopoietin-like 4 stimulates adipose tissuelipolysis and promotes energy expenditure.J Biol Chem.2017:292(39):16122-34.

[0445] 63.Fruhbeck G,Fernandez-Quintana B,Paniagua M,Hernandez-Pardos AW,Valenti V,Moncada R.Inhibits FNDC4,a novel adipokine that reduces lipogenesis andpromotes fat browning in human visceral adipocytes.Metabolism.2020:108:154261.

[0446] 64.Georgiadi A,Lopez-Salazar V,Merahbi RE,Karikari RA,Ma X,Mourao A. Orphan GPR116 mediates the insulin sensitizing effects of the hepatokine FNDC4 in adipose tissue.Nat Commun.2021,12(1):2999.

[0447] 65. Fadini GP, Menegazzo L, Bonora BM, Mazzucato M, Persano S, Vigili de Kreutzenberg S, et al. Effects of Age, Diabetes, and Vascular Disease on Growth Differentiation Factor 11: First-in-Human Study. Diabetes Care. 2015;38(8):e118-9. 66. Katsimpardi L, Kuperwasser N, Camus C, Moigneu C, Chiche A, Tolle V, et al. Systemic GDF11 stimulates the secretion of adiponectin and induces a calorie restriction-like phenotype in aged mice. Aging Cell. 2020;19(1):e13038.

[0448] 67. Lynes MD, Leiria LO, Lundh M, Bartelt A, Shamsi F, Huang TL, et al. The cold-induced lipokine 12,13-diHOME promotes fatty acid transport into brown adipose tissue. Nat Med. 2017;23(5):631-7.

[0449] 68. Gollasch B, Dogan I, Rothe M, Gollasch M, Luft FC. Maximal exercise and plasma cytochrome P450 and lipoxygenase mediators: a lipidomics study. Physiol Rep. 2019;7(13):e14165.

[0450] 69. Yi M, Cho SA, Min J, Kim DH, Shin JG, Lee SJ. Functional characterization of a common CYP4F11 genetic variant and identification of functionally defective CYP4F11 variants in erythromycin metabolism and 20-HETE synthesis. Arch Biochem Biophys. 2017;620:43-51.

[0451] 70. Kulterer OC, Niederstaetter L, Herz CT, Haug AR, Bileck A, Pils D, et al. The Presence of Active Brown Adipose Tissue Determines Cold-Induced Energy Expenditure and Oxylipin Profiles in Humans. J Clin Endocrinol Metab. 2020;105(7).

[0452] 71. Ng VY, Huang Y, Reddy LM, Falck JR, Lin ET, Kroetz DL. Cytochrome P450 eicosanoids are activators of peroxisome proliferator-activated receptor alpha. Drug Metab Dispos. 2007;35(7):1126-34.

[0453] 72. Stanford KI, Lynes MD, Takahashi H, Baer LA, Arts PJ, May FJ, et al. 12,13-diHOME: An Exercise-Induced Lipokine that Increases Skeletal Muscle Fatty Acid Uptake. Cell Metab. 2018;27(6):1357.

[0454] 73. Vasan SK, Noordam R, Gowri MS, Neville MJ, Karpe F, Christodoulides C. The proposed systemic thermogenic metabolites succinate and 12,13-diHOME are inversely associated with adiposity and related metabolic traits: evidence from a large human cross-sectional study. Diabetologia. 2019;62(11):2079-87.

[0455] 74. Bouchard L, Drapeau V, Provencher V, Lemieux S, Chagnon Y, Rice T, et al. Neuromedin beta: a strong candidate gene linking eating behaviors and susceptibility to obesity. Am J Clin Nutr. 2004;80(6):1478-86.

[0456] 75. Blanchet R, Lemieux S, Couture P, Bouchard L, Vohl MC, Perusse L. Effects of neuromedin-beta on caloric compensation, eating behaviours and habitual food intake. Appetite. 2011;57(1):21-7.

[0457] 76. Schwartz MW, Woods SC, Porte D, Jr., Seeley R.I, Baskin DG. Central nervous system control of food intake. Nature. 2000;404(6778):661-71.

[0458] 77. Wabitsch M, Farooqi S, Fluck CE, Bratina N, Mallya UG, Stewart M et al. Natural History of Obesity Due to POMC, PCSK1, and LEPR Deficiency and the Impact of Setmelanotide. J Endocr Soc. 2022;6(6):bvac057.

[0459] 78. Zeng X, Ye M, Resch JM, Jedrychowski MP, Hu B, Lowell BB et al. Innervation of thermogenic adipose tissue via a calsyntenin 3beta-S100b axis. Nature. 2019;569(7755):229-35.

[0460] 79. Chang SH, Song NJ, Choi JH, Yun UJ, Park KW. Mechanisms underlying UCP1 dependent and independent adipocyte thermogenesis. Obes Rev. 2019;20(2):241-51.

[0461] 80. Svensson PA, Lindberg K, Hoffmann JM, Taube M, Pereira MJ, Mohsen-Kanson T et al. Characterization of brown adipose tissue in the human perirenal depot. Obesity (Silver Spring). 2014,22(8):1830-7.

[0462] 81. Long JZ, Svensson KJ, Bateman LA, Lin H, Kamenecka T, Lokurkar IA et al. The Secreted Enzyme PM20D1 Regulates Lipidated Amino Acid Uncouplers of Mitochondria. Cell. 2016;166(2):424-35.

[0463] 82. Long JZ, Roche AM, Berdan CA, Louie SM, Roberts AJ, Svensson KJ et al. Ablation of PM20D1 reveals N-acyl amino acid control of metabolism and nociception. Proc Natl Acad Sci U S A. 2018, 115(29): E6937-E45. 83. Li D, Liu Y, Gao W, Han J, Yuan R, Zhang M et al. Inhibition of miR-324-5p increases PM20D1-mediated white and brown adipose loss and reduces body weight in juvenile mice. Eur J Pharmacol. 2019; 863: 172708.

[0464] 84. Kazak L, Chouchani ET, Jedrychowski MP, Erickson BK, Shinoda K, Cohen P et al. A creatine-driven substrate cycle enhances energy expenditure and thermogenesis in beige fat. Cell. 2015; 163(3): 643-55.

[0465] 85. Muller S, Balaz M, Stefanicka P, Varga L, Amri F.Z, Ukropec J et al. Proteomic Analysis of Human Brown Adipose Tissue Reveals Utilization of Coupled and Uncoupled Energy Expenditure Pathways. Sci Rep. 2016; 6: 30030.

[0466] 86. Braun K, Oeckl J, Westermeier J, Li Y, Klingenspor M. Non-adrenergic control of lipolysis and thermogenesis in adipose tissues. J Exp Biol. 2018;221(Pt Suppl 1).

[0467] 87. Mantovani G, Bondioni S, Alberti L, Gilardini L, Invitti C, Corbetta S et al. Protein kinase A regulatory subunits in human adipose tissue: decreased R2B expression and activity in adipocytes from obese subjects. Diabetes. 2009;58(3):620 - 6.

[0468] 88. Nguyen HP, Yi D, Lin F, Viscarra JA, Tabuchi C, Ngo K et al. Aifm2, a NADH oxidase, Supports Robust Glycolysis and Is Required for Cold - and Diet - Induced Thermogenesis. Mol Cell. 2020,77(3):600 - 17 e4.

[0469] 89. Caron A, Labbe SM, Carter S, Roy MC, Lecomte R, Ricquier D et al. Loss of UCP2 impairs cold - induced non - shivering thermogenesis by promoting a shift toward glucose utilization in brown adipose tissue. Biochimie. 2017;134:118 - 26.

[0470] 90. Bouillaud F. UCP2, not a physiologically relevant uncoupler but a glucose sparing switch impacting ROS production and glucose sensing. Biochim Biophys Acta. 2009;1787(5):377-83.

[0471] 91. Jahansouz C, Xu H, Hertzel AV, Kizy S, Steen KA, Foncea R, et al. Partitioning of adipose lipid metabolism by altered expression and function of PPAR isoforms after bariatric surgery. Int J Obes (Lond). 2018;42(2):139-46.

[0472] 92. Yamaguchi S, Franczyk MP, Chondronikola M, Qi N, Gunawardana SC, Stromsdorfer KL, et al. Adipose tissue NAD(+) biosynthesis is required for regulating adaptive thermogenesis and whole-body energy homeostasis in mice. Proc Natl Acad Sci U S A. 2019;116(47):23822-8.

[0473] 93. Yamaguchi S, Yoshino J. Adipose tissue NAD(+) biology in obesity and insulin resistance: From mechanism to therapy. Bioessays. 2017;39(5).

[0474] 94. Nagy L, Rauch B, Szerafin T, Uray K, Toth A, Bai P. Nicotinamide-riboside shifts the differentiation of human primary white adipocytes to beige adipocytes impacting substrate preference and uncoupling respiration through SIRT1 activation and mitochondria-derived reactive species production. Front Cell Dev Biol. 2022;10:979330.

[0475] 95. Balaz M, Ukropcova B, Kurdiova T, Vlcek M, Surova M, Krumpolec P, et al. Improved adipose tissue metabolism after 5-year growth hormone replacement therapy in growth hormone deficient adults: The role of zinc-alpha2-glycoprotein. Adipocyte. 2015;4(2):113-22.

[0476] 96. Prossnitz ER, Barton M. Estrogen biology: new insights into GPER function and clinical opportunities. Mol Cell Endocrinol. 2014;389(1-2):71-83.

[0477] 97. Sharma G, Hu C, Staquicini DI, Brigman JL, Liu M, Mauvais-Jarvis F, et al. Preclinical efficacy of the GPER-selective agonist G-1 in mouse models of obesity and diabetes. Sci Transl Med. 2020;12(528).

[0478] 98. Hedesan OC, Fenzl A, Digruber A, Spirk K, Baumgartner-Parzer S, Bilban M, et al. Parathyroid hormone induces a browning program in human white adipocytes, Int. J Obes (Lond). 2019;43(6):1319 - 24.

[0479] 99. Carper D, Coue M, Nascimento EBM, Barquissau V, Lagarde D, Pestourie C, et al. Atrial Natriuretic Peptide Orchestrates a Coordinated Physiological Response to Fuel Non - shivering Thermogenesis. Cell Rep. 2020;32(8):108075.

[0480] 100. Moro C, Crampes F, Sengenes C, De Glisezinski I, Galitzky J, Thalamas C, et al. Atrial natriuretic peptide contributes to physiological control of lipid mobilization in humans. FASEB J. 2004;18(7):908 - 10.

[0481] 101. Cho KJ, Shim JH, Cho MC, Choe YK, Hong JT, Moon DC, et al. Signaling pathways implicated in alpha - melanocyte stimulating hormone - induced lipolysis in 3T3 - L1 adipocytes. J Cell Biochem. 2005;96(4):869 - 78.

[0482] 102. Puigserver P, Wu Z, Park CW, Graves R, Wright M, Spiegelman BM. A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell. 1998;92(6):829-39.

[0483] 103. Mazzucotelli A, Viguerie N, Tiraby C, Annicotte JS, Mairal A, Klimcakova E, et al. The transcriptional coactivator peroxisome proliferator-activated receptor (PPAR) gamma coactivator-1 alpha and the nuclear receptor PPAR alpha control the expression of glycerol kinase and metabolism genes independently of PPAR gamma activation in human white adipocytes. Diabetes. 2007;56(10):2467-75.

[0484] 104. Cadoudal T, Distel E, Durant S, Fouque F, Blouin JM, Collinet M, et al. Pyruvate dehydrogenase kinase 4: regulation by thiazolidinediones and implication in glyceroneogenesis in adipose tissue. Diabetes. 2008,57(9)2272-9.

[0485] [ PubMed ] 105.Cadoudal T,Blouin JM,Collinet M,Fouque F,Tan GD,Loizon E. Acuteand selective regulation of glyceroneogenesis and cytosolicphosphoenolpyruvate carboxykinase in adipose tissue by thiazolidinediones intype 2 diabetes.Diabetology.2007:50(3):666-75.

[0486] 106.Iwase M,Tokiwa S,Seno S,Mukai T,Yeh YS,Takahashi H. Individual glycerolkinase stimulates uncoupling protein 1 expression by regulating fatty acid metabolism in beige adipocytes.J Biol Chem.2020,295(20):7033-45.

[0487] [ PubMed ] [ Cross Ref ] 107. Ou X, Ji C, Han X, Zhao X, Li X, Mao Y. Crystal structures of humanglycerol 3-phosphate dehydrogenase 1 (GPD1).J Mol Biol.2006:357(3):858-69.

[0488] 108.Keipert S,Kutschke M,Ost M,Schwarzmayr T,van Schothorst EM,Lamp D Long-Term Cold Adaptation Does Not Require FGF21or UCP1.Cell Metab.2017:26(2):437-46 e5.

[0489] 109. Yang R, Hu Y, Lee CH, Liu Y, Diaz-Canestro C, Fong CHY et al. PM20D1 is a circulating biomarker closely associated with obesity, insulin resistance and metabolic syndrome. Eur J Endocrinol. 2021;186(2):151-61.

[0490] 110. Kim JT, Jedrychowski MP, Wei W, Fernandez D, Fischer CR, Banik SM et al. A Plasma Protein Network Regulates PM20D1 and N-Acyl Amino Acid Bioactivity. Cell Chem Biol. 2020;27(9):1130-9 e4.

[0491] 111. Benson KK, Hu W, Weller AH, Bennett AH, Chen ER, Khetarpal SA et al. Natural human genetic variation determines basal and inducible expression of PM20D1, an obesity-associated gene. Proc Natl Acad Sci USA. 2019,116(46):23232-42.

[0492] 112. Kazak L, Chouchani ET, Lu GZ. Jedrychowski MP, Bare CJ, Mina AI et al. Genetic Depletion of Adipocyte Creatine Metabolism Inhibits Diet-Induced Thermogenesis and Drives Obesity. Cell Metab. 2017;26(4):660-71 e3.

[0493] 113. Audrito V, Messana VG, Deaglio S. NAMPT and NAPRT: Two Metabolic Enzymes With Key Roles in Inflammation. Front Oncol. 2020, 10: 358。

[0494] 114. Qiang L, Wang L, Kon N, Zhao W, Lee S, Zhang Y et al. Brown remodeling of white adipose tissue by SirT1-dependent deacetylation of Ppargamma. Cell. 2012; 150(3): 620-32。

[0495] 115. DiRenzo J, Soderstroni M, Kurokawa R, Ogliastro MH, Ricote M, Ingrey S et al. Peroxisome proliferator-activated receptors and retinoic acid receptors differentially control the interactions of retinoid X receptor heterodimers with ligands, coactivators, and corepressors. Mol Cell Biol. 1997; 17(4); 2166-76。

[0496] 116. Rebello CJ, Coulter AA, Reaume AG, Cong W, Cusimano LA, Greenway FL. MLR-1023 Treatment in Mice and Humans Induces a Thermogenic Program, and Menthol Potentiates the Effect. Pharmaceuticals (Basel). 2021; 14(11)。

[0497] 117. WysolmersKi JJ, Stewart AF. The physiology of parathyroid hormone-related protein: an emerging role as a developmental factor. Annu Rev Physiol. 1998;60:431-60.

[0498] 118. Larsson S, Jones HA, Goransson O, Degerman E, Holm C. Parathyroid hormone induces adipocyte lipolysis via PKA-mediated phosphorylation of hormone-sensitive lipase. Cell Signal. 2016;28(3):204-13.

[0499] 119. Kovanicova Z, Kurdiova T, Balaz M, Stefanicka P, Varga L, Kulterer OC et al. Cold Exposure Distinctively Modulates Parathyroid and Thyroid Hormones in Cold-Acclimatized and Non-Acclimatized Humans. Endocrinology. 2020;161(7).

[0500] 120. Mattsson CL, Csikasz RI, Chernogubova E, Yamamoto DL, Hogberg HT, Amri F.Z et al. beta(1)-Adrenergic receptors increase UCP1 in human MADS brown adipocytes and rescue cold-acclimated beta(3)-adrenergic receptor-knockout mice via nonshivering thermogenesis. Am J Physiol Endocrinol Metab. 2011;301(6):E1108-18.

[0501] 121. Arner P, Bernard S, Salehpour M, Possnert G, Liebl J, SteierP et al. Dynamics of human adipose lipid turnover in health and metabolic disease. Nature. 2011; 478(7367): 110-3.

[0502] 122. Arner P, Andersson DP, Backdahl J. Dahlman I, Ryden M. Weight Gain and Impaired Glucose Metabolismin Women Are Predicted by Inefficient SubcutaneousFat Cell Lipolysis. Cell Metab. 2018; 28(1): 45-54e3.

[0503] ****

[0504] Equivalent

[0505] Those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are considered to be within the scope of the present invention and are covered by the appended claims.

Claims

1. A composition comprising a therapeutically effective amount of at least one flavanone and a therapeutically effective amount of at least one flavonol.

2. The composition of claim 1, further comprising a therapeutically effective amount of at least one carotenoid.

3. The composition according to claim 1, further comprising a sufficient amount of a pharmaceutically acceptable carrier.

4. The method of claim 1, wherein the composition comprises from about 150 mg to about 900 mg of at least one flavanone.

5. The method of claim 1, wherein the composition comprises from about 1 mg to about 100 mg of at least one flavonol.

6. The method of claim 1, wherein the composition comprises from about 1 mg to about 12 mg of at least one carotenoid.

7. The composition of claim 1, wherein the flavanone is naringenin.

8. The composition of claim 1, wherein the flavonol is myricetin.

9. The composition of claim 1, wherein the at least one carotenoid is selected from the group consisting of beta carotene, lycopene or lutein.

10. The composition of claim 1, wherein the at least one carotenoid is beta carotene.

11. The composition of claim 1, wherein the flavanone is naringenin, wherein the flavonol is myricetin, and wherein the carotenoid is beta carotene.

12. The composition of claim 1, wherein the composition further comprises one or more additional active agents.

13. The composition of claim 1, wherein the additional active agent comprises an anti-obesity agent.

14. The composition of claim 1 or claim 2, wherein the composition is provided in the form of an injectable solution, an oral dosage, a topical cream, a topical gel, or a medical food.

15. A method for localized fat reduction, the method comprising administering a therapeutically effective amount of the composition of claim 1 or claim 2 to a site of a subject.

16. A method for treating a subject suffering from a metabolic disorder, the method comprising administering to the subject a therapeutically effective amount of the composition of claim 1 or claim 2.

17. The method of claim 16, wherein the metabolic disorder comprises insulin resistance disease.

18. The method of claim 17, wherein the insulin resistance disease comprises type 2 diabetes, polycystic ovary syndrome, nonalcoholic steatohepatitis, or metabolic syndrome.

19. The method of claim 16, wherein the metabolic disorder comprises obesity.

Images