Interferon-associated antigen binding proteins and uses thereof

Abstract

The invention relates to interferon-associated antigen binding proteins and uses thereof. In particular, the present invention relates to novel interferon-associated antigen binding proteins as well as nucleic acids, vectors and vector systems encoding these interferon-associated antigen binding proteins. The invention also relates to compositions comprising these interferon-associated antigen binding proteins, nucleic acids, vectors and vector systems. Novel interferon-associated antigen binding proteins provide a beneficial improvement over the current state in the art. Thus, the invention also provides these interferon-associated antigen binding proteins, nucleic acids, vectors, vector systems and compositions. The invention also provides host cells comprising these nucleic acids, vectors and vector systems as well as methods of making interferon-associated antigen binding proteins according to the invention using said host cells.

Description

[0001] This application is a divisional application of Chinese patent application No. 202080095487.X, entitled “Interferon-related antigen binding protein and its use”, with a filing date of November 27, 2020. Technical Field

[0002] The present invention relates to new interferon-related antigen binding proteins based on agonistic anti-CD40 antibodies CP870,893 and nucleic acids, vectors and vector systems encoding these interferon-related antigen binding proteins. The present invention also relates to compositions comprising these interferon-related antigen binding proteins, nucleic acids, vectors and vector systems. The new interferon-related antigen binding proteins provide beneficial improvements over the current state of the art, for example, where they effectively destroy viral replication and thereby reduce HBV viral load. Therefore, the present invention also provides these interferon-related antigen binding proteins, nucleic acids, vectors, vector systems and compositions, for example, in the treatment of hepatitis B virus (HBV) infection in subjects and / or in reducing one or more HBV infection symptoms. The present invention also provides host cells comprising these nucleic acids, vectors and vector systems and methods for preparing interferon-related antigen binding proteins according to the present invention using the host cells. Background Art

[0003] HBV infects more than 300 million people worldwide and is a common cause of liver disease and liver cancer (Liang (2009) Hepatology 49: S13). HBV is a small DNA virus with unusual features similar to retroviruses, which replicates through RNA intermediates (pregenomic RNA, pgRNA) and can integrate into the host genome. The unique characteristics of the HBV replication cycle give the virus a unique ability to persist in infected cells. HBV infection leads to a wide range of liver diseases from acute hepatitis (including fulminant hepatic failure) to chronic hepatitis, cirrhosis and hepatocellular carcinoma. Acute HBV infection can be asymptomatic or present with symptomatic acute hepatitis. 90-95% of children infected with HBV and 5-10% of adults infected with HBV cannot clear the virus and become chronically infected. Many chronically infected people have mild liver disease with little long-term morbidity or mortality. Other individuals with chronic HBV infection develop active disease, which can develop into cirrhosis and liver cancer. These patients require careful monitoring and approved therapeutic interventions.

[0004] New methods for treating HBV infection by modulating HBV infection in cells are needed. Specifically, methods are needed that effectively disrupt viral replication, reduce the HBV viral load in HBV-infected cells, reduce the transcription of covalently closed circular HBV DNA in HBV-infected cells, and / or reduce the amount of pregenomic HBV RNA in HBV-infected cells. Summary of the invention

[0005] The present invention relates to an interferon-related antigen binding protein comprising (I) an agonistic anti-CD40 antibody or an agonistic antigen binding fragment thereof and (II) interferon (IFN) or a functional fragment thereof, wherein the agonistic anti-CD40 antibody or the agonistic antigen binding fragment thereof comprises

[0006] (a) three light chain complementary determining regions (CDRs) that are at least 90% identical to the CDRL1, CDRL2 and CDRL3 sequences in SEQ ID NO 3; and three heavy chain CDRs that are at least 90% identical to the CDRH1, CDRH2 and CDRH3 sequences in SEQ ID NO 6; wherein each CDR is defined according to the Kabat definition, the Chothia definition, the AbM definition or the contact definition of a CDR; preferably wherein each CDR is defined according to the Kabat definition of a CDR or the Chothia definition of a CDR;

[0007] (b) three light chain complementary determining regions (CDRs) identical to the CDRL1, CDRL2 and CDRL3 sequences in SEQ ID NO 3; and three heavy chain CDRs identical to the CDRH1, CDRH2 and CDRH3 sequences in SEQ ID NO 6; wherein each CDR is defined according to the Kabat definition, the Chothia definition, the AbM definition or the contact definition of a CDR; preferably wherein each CDR is defined according to the Kabat definition of a CDR or the Chothia definition of a CDR;

[0008] (c) a heavy chain or a fragment thereof comprising a complementarity determining region (CDR) CDRH1 having at least 90% identity to SEQ ID NO 56, a CDRH2 having at least 90% identity to SEQ ID NO 57, and a CDRH3 having at least 90% identity to SEQ ID NO 58; and a light chain or a fragment thereof comprising a CDRL1 having at least 90% identity to SEQ ID NO 52, a CDRL2 having at least 90% identity to SEQ ID NO 53, and a CDRL3 having at least 90% identity to SEQ ID NO 54;

[0009] (d) a heavy chain or a fragment thereof, which comprises a complementarity determining region (CDR) CDRH1 identical to SEQ ID NO 56, a CDRH2 identical to SEQ ID NO 57, and a CDRH3 identical to SEQ ID NO 58; and a light chain or a fragment thereof, which comprises a CDRL1 identical to SEQ ID NO 52, a CDRL2 identical to SEQ ID NO 53, and a CDRL3 identical to SEQ ID NO 54;

[0010] (e) a light chain variable region V comprising the sequence shown in SEQ ID NO 51 or a sequence having at least 90% identity thereto L and / or a heavy chain variable region V comprising the sequence shown in SEQ ID NO 55 or a sequence having at least 90% identity thereto H ;

[0011] (f) a Fab region heavy chain comprising the amino acid sequence shown in SEQ ID NO 12, or a sequence having at least 90% identity thereto; or

[0012] (g) a light chain (LC) comprising the sequence shown in SEQ ID NO 3, or a sequence having at least 90% identity thereto; and / or a heavy chain (HC) comprising a sequence selected from the group consisting of SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 49 and SEQ ID NO 48, or a sequence having at least 90% identity thereto.

[0013] According to this aspect of the invention, the IFN or functional fragment thereof is selected from the group consisting of type I IFN, type II IFN and type III IFN or functional fragments thereof. In a preferred embodiment, the type I IFN or functional fragment thereof is IFNα or IFNβ or functional fragments thereof.

[0014] According to one embodiment, the IFN or a functional fragment thereof is IFNα2a or a functional fragment thereof. Preferably, IFNα2a comprises the sequence shown in SEQ ID NO 17 or a sequence having at least 90% identity thereto.

[0015] According to another embodiment, the IFN or a functional fragment thereof is IFNβ or a functional fragment thereof. In a preferred embodiment, the IFNβ comprises the sequence shown in SEQ ID NO 14 or a sequence having at least 90% identity thereto.

[0016] According to other embodiments, IFN or a functional fragment thereof is fused to the light chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof. Preferably, IFN or a functional fragment thereof is fused to the C-terminus of the light chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof.

[0017] According to another embodiment, IFN or a functional fragment thereof is fused to the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof. In a preferred embodiment, IFN or a functional fragment thereof is fused to the C-terminus of the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof.

[0018] According to another embodiment, the agonist anti-CD40 antibody or its agonist antigen-binding fragment and the IFN or its functional fragment are fused to each other via a linker. In a preferred embodiment, the linker comprises the sequence shown in SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 24, SEQ ID NO 25 or SEQ ID NO 26.

[0019] According to another embodiment, the interferon-related antigen binding protein comprises a sequence selected from the group consisting of SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46 and SEQ ID NO 47.

[0020] According to other embodiments, the interferon-related antigen binding protein is an agonistic anti-CD40 antibody or an agonistic antigen binding fragment thereof fused to an interferon comprising one of the sequence combinations disclosed in Table 8.

[0021] According to another aspect, the present invention relates to a nucleic acid encoding an interferon-related antigen binding protein according to the present invention. In a preferred embodiment, the nucleic acid further encodes a secretory signal peptide.

[0022] According to a further aspect, the present invention relates to a vector comprising said nucleic acid.

[0023] According to another aspect, the present invention relates to a vector system comprising

[0024] (I) a first vector comprising a nucleic acid encoding an IFN or a functional fragment thereof fused to the light chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof of an interferon-related antigen-binding protein of the present invention; and a second vector comprising a nucleic acid encoding the heavy chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof of an interferon-related antigen-binding protein of the present invention; or

[0025] (II) a first vector comprising a nucleic acid encoding an IFN or a functional fragment thereof fused to the heavy chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof of an interferon-related antigen-binding protein of the present invention; and a second vector comprising a nucleic acid encoding the light chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof of an interferon-related antigen-binding protein of the present invention.

[0026] According to another aspect, the present invention relates to a composition, preferably a pharmaceutical composition, comprising the interferon-related antigen binding protein, nucleic acid, vector or vector system according to the present invention.

[0027] According to other aspects, the present invention relates to a host cell comprising a nucleic acid, a vector or a vector system according to the present invention. According to another aspect, the present invention relates to a method for preparing an interferon-related antigen binding protein according to the present invention, comprising culturing the host cell and recovering the interferon-related antigen binding protein.

[0028] According to another aspect, the present invention relates to an interferon-related antigen binding protein, a nucleic acid, a vector, a vector system or a composition for use as a medicament according to the present invention.

[0029] According to another aspect, the present invention relates to an interferon-related antigen binding protein, nucleic acid, vector, vector system or composition according to the present invention for treating hepatitis B virus (HBV) infection and / or reducing one or more symptoms of HBV infection in a subject.

[0030] also:

[0031] Table 9a-Table 9b: These tables summarize the data obtained after in vitro stimulation of whole blood cells (WBC) obtained from healthy volunteers. Each IFA was tested on WBC from 4 different donors. WBC remained untreated (NT), treated with LPS (10ng / mL) or with IFA (1μg / mL) for 24h. Supernatants were collected and cytokine release was quantified using the MSD u-Plex kit for human cytokines. The results represent the average of two independent stimulations from each donor and are expressed in pg / mL (nd: not detected).

[0032] Table 10A: Summary of PK reports: PK parameters of CP870,893, IFA27, IFA29 and IFA30 after a single intravenous administration of 0.5 mg / kg to male CD1 Swiss mice. The PK parameters of CP870,893 were studied in a 7-day experiment and those of IFA27, IFA29 and IFA30 were studied in a 10-day experiment (IFA27 quantification was performed using 2 different ELISA methods).

[0033] Table 10B: PK parameters of CP870,893, Pegasys and 3 different IFAs (IFA25, IFA26 and IFA28) after a single intravenous bolus administration of 0.5 mg / kg to male CD1 Swiss mice. The PK parameters of CP870,893 and IFA25, IFA26, IFA28 and Pegasys were studied in a 21-day experiment (IFA25 quantification was performed using 2 different ELISA methods). BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 : This schematic diagram shows an exemplary interferon-associated antigen binding protein format. Interferon-associated antigen binding proteins are agonistic anti-CD40 antibodies fused to interferon or agonistic antigen binding fragments thereof fused to interferon. IFN is bound to different positions on the antibody or its antigen binding fragment via a linker: the N-terminal or C-terminal portion of the light chain (LC) or heavy chain (HC). Specifically, IFN is selected from the interferon families of type I, type II, and type III.

[0035] Figure 2A An exemplary map of the pcDNA3.1 plasmid encoding SEQ ID NO 32 under the control of the pCMV promoter is shown. The nucleic acid sequence encoding SEQ ID NO 32 (SEQ ID NO 59) is also shown on the right. Italics: signal peptide sequence; black: CP870,893 heavy chain coding sequence; underline: HL linker coding sequence; bold: IFNβ coding sequence.

[0036] Figure 2B Examples of SDS PAGE of some IFAs under reducing conditions are shown, in which IFNα or IFNβ is fused to the heavy or light chain. The migration of the parent CP870,893 is also shown on the left.

[0037] Figure 3A-3B The diagram shows some IFA molecules with IFNβ fusion to HEK-Blue TM Dose-dependent effects of CD40L activation on CD40-mediated NFκB pathway reporter assay. Figure 3AExamples of anti-CD40 activity of IFA against IFNβ fused to the C-terminal part of the heavy chain (HC) are shown. Figure 3B Examples of anti-CD40 activity against IFAs with IFNβ fused to the N-terminal part of LC (IFA34) or HC (IFA36) and IFAs with corresponding fusions on the C-terminal part (IFA35 and IFA37) are shown. The purification yield of the latter group of IFAs was very low, so to test their activity, supernatants from HEK-transfected cells were used and serially diluted to evaluate the activity against HEK-Blue TM Anti-CD40 activity of CD40L cells.

[0038] Figure 3C-Figure 3D Graph showing the dose-dependent effect of several IFA molecules with IFNβ fusion on activation of the type I IFN-pathway in HEK-Blue-IFN-α / β reporter cells. Figure 3C Examples of IFN activity for IFA with IFNβ fused to the C-terminal part of HC are shown. Figure 3D Examples of IFN activity for IFA with the N-terminal part of IFNβ fused to the LC (IFA34) or HC (IFA36) and IFA with the corresponding fusion on the C-terminal part (IFA35 and IFA37) are shown. Figure 3B The same supernatant from HEK transfected cells was diluted in PBS and serially diluted to evaluate IFN activity. Parent antibody CP870,893 was used as negative control and recombinant human IFNβ was used as positive control. NS: unstimulated.

[0039] Figure 4A The diagram shows some IFA molecules with IFNα fusion to HEK-Blue TM Dose effects of reporter assays on activation of the CD40-mediated NFκB pathway in CD40L cells.

[0040] Figure 4B The diagram shows the dose effect of several IFA molecules with IFNα fusion on activation of type I IFN-mediated pathways in HEK-Blue-IFN-α / β reporter cells. Pegasys activity is shown in the inset at the bottom right.

[0041] Figure 4C Schematic representation of IFA molecules with IFNα fusion and HL linker on HC (IFA38) or LC (IFA39) for HEK-Blue TM Effects of activation of the CD40-mediated NFκB pathway in CD40L cells reporter assay.

[0042] Figure 4DSchematic representation of the effects of IFA38 and IFA39 on activation of the type I IFN-pathway in HEK-Blue-IFNα / β reporter cells.

[0043] Figure 5 The effect of IFNβbased IFA on HBeAg release from primary hepatocytes infected with HBV in a dose-dependent manner is shown. IFA1, IFA12: IFNβ fused to the C-terminus of LC via HL or RL linkers, respectively. IFA2 and IFA13: IFNβ_C17S fused to the C-terminus of LC via HL or RL linkers, respectively.

[0044] Fig. 6A The effects of IFA25, IFA26, and IFA27 on HBeAg release from primary human hepatocytes infected with HBV in a dose-dependent manner were shown.

[0045] Figure 6B The effects of IFA28, IFA29, and IFA30 on HBeAg release from primary human hepatocytes infected with HBV in a dose-dependent manner are shown.

[0046] Figure 6C The dose response anti-viral activity (HBeAg release) of IFAs with HL linkers (IFA38 and IFA39) against HBV-infected PHHs is shown.

[0047] Figure 6D-Figure 6H Dose-response anti-viral activity of four IFA molecules with fusion to IFNα via a peptide linker against primary human hepatocytes infected with HBV is shown. Fig.6D : Animation showing the study design. Fig. 6E : Effect of IFA on HBeAg release compared with Pegasys. Fig. 6F : Effect of IFA on HBsAg release compared with Pegasys. Figure 6G : Effects of IFA on pgRNA levels compared with Pegasys. Figure 6H : Effect of IFA on CXCL10 release compared with Pegasys.

[0048] Figure 7Results of in vitro cytokine release assays from human whole blood cells (WBC) are shown: Examples of data obtained after stimulation of WBC from 4 healthy volunteer donors. WBC remain unstimulated (NS) and are treated with LPS (10 ng / mL) or IFA1 (1 μg / mL) for 24 h. Supernatants are collected and cytokine release is quantified for human cytokines using the MSD u-Plex kit. Results represent the average of two independent stimulations from each donor. Spectra of CXCL10 (IP10), IL6, IL1β, and TNFα are shown.

[0049] Figure 8A-8D : Pharmacokinetic profiles of IFA25, IFA26, IFA27, IFA28, IFA29, and IFA30 after intravenous injection of 0.5 mg / kg (IFA) or 0.3 mg / kg (Pegasys) to mice. Data are expressed as mean + / - SD on semi-logarithmic coordinates. Samples up to 10 days after administration were collected. ELISA assays using anti-IFNα as the secondary antibody for quantitative methods were used for IFA27, IFA29, and IFA30 ( Fig. 8A ) and IFA25, IFA26 and IFA28 ( Figure 8B ). An ELISA assay using anti-IgG2 as the secondary antibody for the quantitative method was used for IFA25 and IFA27 ( Figure 8C ). Fig.8D : Pegasys quantification using matched antibody pairs for human IFNα. The marker line (LLOQ) indicates the limit of detection of the Pegasys assay.

[0050] Fig.9A Shown in HEK-Blue TM In CD40L reporter cells, IFA50 and IFA51 without the Fc region enhanced the CD40 agonistic activity in a dose-dependent manner compared with the parental anti-CD40 antibody. Fig. 9B Shown in HEK-Blue TM IFA50 and IFA51 in hIFN-α / β reporter cells IFNα activity in a dose-dependent manner. Fig. 9C : Effects of IFA50 and IFA51 on HBeAg release from HBV-infected PHHs.

[0051] Fig. 10A Shown in HEK-Blue TM In CD40L reporter cells, IFNε-based IFA49 enhanced the CD40 agonistic activity in a dose-dependent manner compared to the parental anti-CD40 antibody. IFA49 corresponds to the fusion of IFNε to HC via a peptide linker. Fig. 10BIFA49 showed the effect of type I interferon on HEK-Blue TM hIFN-α / β reported IFN activity of cells in a dose-dependent manner. Fig. 10C : Effect of IFA49 on HBeAg release from HBV-infected PHHs.

[0052] Fig.11A Shown in HEK-Blue TM In CD40L reporter cells, the IFNω-based IFA46 enhanced the CD40 agonistic activity in a dose-dependent manner compared to the parental anti-CD40 antibody. IFA46 corresponds to the fusion of IFNω to LC via a peptide linker. Fig. 11B IFA46 showed the effect of type I interferon on HEK-Blue TM hIFN-α / β reported IFN activity of cells in a dose-dependent manner. Fig. 11C : Effect of IFA46 on HBeAg release from HBV-infected PHHs.

[0053] Fig. 12A Shown in HEK-Blue TM In CD40L reporter cells, IFNγ-based IFAs (IFA42 and IFA43) enhanced CD40 agonistic activity in a dose-dependent manner compared to the parental anti-CD40 antibody. IFA42 corresponds to fusion of IFNγ to LC via a peptide linker, and IFA43 corresponds to fusion of IFNγ to HC via a peptide linker. Fig. 12B The IFN activity of IFA42 and IFA43 in HEK-Blue-hlFNγ cells in a dose-dependent manner is shown. Fig. 12C : Effects of IFA42 and IFA43 on HBeAg release from HBV-infected PHHs.

[0054] Fig.13A Shown in HEK-Blue TM In CD40L reporter cells, IFNλ-based IFAs (IFA44 and IFA45) enhanced CD40 agonistic activity in a dose-dependent manner compared to the parental anti-CD40 antibody. IFA44 corresponds to fusion of IFNλ to LC via a peptide linker, and IFA45 corresponds to fusion of IFNλ to HC via a peptide linker. Fig. 13B The IFN activity of IFA44 and IFA45 in HEK-Blue-hlFNλ reporter cells in a dose-dependent manner is shown. Fig. 13C : Effects of IFNλ-based IFAs (IFA44 and IFA45) on HBeAg release from HBV-infected PHHs.

[0055] The above and other features and advantages of the present invention will be more fully understood from the following detailed description of illustrative embodiments, taken in conjunction with the accompanying drawings. DETAILED DESCRIPTION

[0056] The present invention is based in part on the discovery of the following therapy, which is based on the use of "interferon-related antigen binding proteins", variants or derivatives thereof, comprising (I) agonistic anti-CD40 antibodies or agonistic antigen binding fragments thereof and (II) interferon (IFN) or functional fragments thereof in hepatitis B virus (HBV) therapy. The interferon-related antigen binding protein inhibits the transcription of hepatitis B virus covalently closed circular DNA (cccDNA) to pregenomic HBV RNA (pgRNA) in HBV-infected cells, inhibits the release of hepatitis B e-antigen (HBeAg) from HBV-infected cells, and enhances the IFN pathway in uninfected and HBV-infected hepatocytes, specifically uninfected and HBV-infected primary human hepatocytes and in a synergistic manner. HBV therapy is provided comprising administering an interferon-related antigen binding protein to HBV-infected cells or subjects infected with HBV.

[0057] The present invention may be more readily understood with reference to selected terms defined below.

[0058] As used herein, the term "CD40" refers to "cluster of differentiation 40", which is a member of the tumor necrosis factor receptor (TNFR) superfamily. CD40 is a co-stimulatory protein present on antigen presenting cells (e.g., B cells, dendritic cells, monocytes), hematopoietic precursors, endothelial cells, smooth muscle cells, epithelial cells, and most human tumors (Grewal & Flavell, Ann. Rev. Immunol., 1996, 16: 111-35; Toes & Schoenberger, Seminars in Immunology, 1998, 10 (6): 443-8). H Binding of the natural ligand CD154 (CD40L) on cells to CD40 activates antigen presenting cells and induces a variety of downstream effects. The TNF-receptor-associated factor adaptor proteins TRAF1, TRAF2, TRAF6, and TRAF5 interact with CD40 and serve as signal transduction mediators. Ultimately, CD40 signaling activates both the canonical and non-canonical NF-κB pathways.

[0059] Agonist anti-CD40 antibodies and antigen-binding fragments thereof

[0060] As used herein, the term "antibody" refers to immunoglobulin molecules and multimers thereof (e.g., IgM) comprising four polypeptide chains, two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain comprises a heavy chain variable region (abbreviated VH or VH ) and the heavy chain constant region (CH or C H The heavy chain constant region consists of three domains, CH1, CH2 and CH3. Each light chain contains a light chain variable region (abbreviated VL or V L ) and the light chain constant region (CL or C L ). The light chain constant region includes 1 domain (CL1). The VH and VL regions can be further subdivided into hypervariable regions, called "complementarity determining regions (CDRs)", which are interspersed with more conserved regions, called "framework regions" (FRs). Each VH and VL consists of 3 CDRs and 4 FRs, which are arranged in the following order from amino-terminus to carboxyl-terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The framework region can help maintain the correct conformation of the CDRs to promote binding between the antigen binding region and the antigen.

[0061] The immunoglobulin most commonly used for therapeutic applications is immunoglobulin G (or IgG), which is a tetrameric glycoprotein. In naturally occurring immunoglobulins, each tetramer consists of two identical pairs of polypeptide chains, each pair having a light chain (about 25 kDa) and a heavy chain (about 50-70 kDa). The amino-terminal portion of each chain includes a variable region of about 100 to 110 or more amino acids, which is primarily responsible for antigen recognition. The carboxyl-terminal portion of each chain defines a constant region primarily responsible for effector function. Based on the amino acid sequence of the constant domain of their heavy chain, immunoglobulins can be divided into different types.

[0062] Heavy chains are classified into mu (μ), delta (δ), gamma (γ), alpha (α) and epsilon (ε) and antibody isotypes are defined as IgM, IgD, IgG, IgA and IgE, respectively. Several of these can be further divided into subclasses or isotypes, for example, IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2. Different isotypes have different effector functions; for example, IgG1 and IgG3 isotypes have antibody-dependent cellular cytotoxicity (ADCC) activity. In a preferred embodiment, the agonist anti-CD40 antibody or its agonist antigen-binding fragment contained in the interferon-related antigen-binding protein according to the present invention belongs to the IgG class. In a more preferred embodiment, the agonist anti-CD40 antibody or its agonist antigen-binding fragment contained in the interferon-related antigen-binding protein according to the present invention belongs to the IgG1 or IgG3 subclass. In a particularly preferred embodiment, the agonist anti-CD40 antibody or its agonist antigen-binding fragment contained in the interferon-related antigen-binding protein according to the present invention belongs to the IgG1 subclass. In other more preferred embodiments, the agonist anti-CD40 antibody or agonist antigen-binding fragment thereof contained in the interferon-related antigen-binding protein according to the present invention belongs to the IgG2 or IgG4 subclass. In a particularly preferred embodiment, the agonist anti-CD40 antibody or agonist antigen-binding fragment thereof contained in the interferon-related antigen-binding protein according to the present invention belongs to the IgG2 subclass.

[0063] Human light chains are divided into kappa (κ) and lambda (λ) light chains. Therefore, in some embodiments, the agonist anti-CD40 antibody or its agonist antigen-binding fragment contained in the interferon-related antigen-binding protein according to the present invention comprises a κ class light chain. In other embodiments, the agonist anti-CD40 antibody or its agonist antigen-binding fragment contained in the interferon-related antigen-binding protein according to the present invention comprises a λ class light chain. Within the light chain and the heavy chain, the variable region and the constant region are connected by a "J" region of about 12 or more amino acids, wherein the heavy chain also includes a "D" region of about 10 or more amino acids. Generally, see Fundamental Immunology, Chapter 7 (Paul, W., ed., 2nd edition, Raven Press, NY (1989)).

[0064] The term "antibody" further includes, but is not limited to, monoclonal antibodies, bispecific antibodies, miniantibodies, domain antibodies, synthetic antibodies (sometimes also referred to as "antibody mimics"), chimeric antibodies, humanized antibodies, human antibodies, and their respective fragments. Unless otherwise indicated, the term "antibody" includes, in addition to antibodies comprising two full-length heavy chains and two full-length light chains, derivatives, variants, antigen-binding fragments, and mutant proteins thereof, examples of which are described below.

[0065] As used herein, the term "agonistic CD40 antibody" or "agonistic anti-CD40 antibody" refers to an antibody that binds to CD40 and mediates CD40 signaling. In a preferred embodiment, it binds to human CD40. As described below, surface plasmon resonance can be used, preferably using The binding to CD40 is determined by the system. When added to a cell, tissue or organism expressing CD40, the agonist anti-CD40 antibody can increase one or more CD40 activities by at least about 20%. In some embodiments, the antibody activates CD40 activity by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 85%. Whole blood surface molecule upregulation assays or in vitro reporter cell assays can be used, for example, using HEK-Blue TM CD40L cells (InvivoGen catalog #: hkb-cd40) measure the CD40 activity of agonistic anti-CD40 antibodies, as described in more detail in Example I. These reporter cells were generated by stably transfecting HEK293 cells with the human CD40 gene and a NFκB-inducible secretory embryonic alkaline phosphatase (SEAP) construct to measure the activity of CD40 agonists. Stimulation of CD40 results in NFκB activation and thus production of SEAP, which can be expressed using a chromogenic substrate such as QUANTI-Blue TM Detected in supernatant.

[0066] In the context of the present invention, the interferon-related antigen binding protein activates both the CD40 and IFN pathways. In certain embodiments, the interferon-related antigen binding protein is expressed at an EC of less than 400, 300, 200, 150, 100, 70, 60, 50, 40, 30, 25, 20, or 15 ng / mL. 50 Activate the CD40 pathway. In a more specific embodiment, the interferon-related antigen binding protein is expressed at an EC range of 10 to 200 ng / mL. 50 Activate the CD40 pathway. In a more specific embodiment, the interferon-related antigen binding protein is present at an EC range of 10 to 50 ng / mL, preferably 10 to 30 ng / mL. 50 Activates the CD40 pathway.

[0067] Exemplary light and heavy chain sequences of the agonist anti-CD40 antibody CP870,893 are shown in Table 7.

[0068] As used herein, the term "agonistic antigen-binding fragment" of an agonistic anti-CD40 antibody refers to a fragment of an agonistic anti-CD40 antibody that retains one or more functional activities of the original antibody, such as the ability to bind to and act as an agonist of CD40 signaling in a cell, e.g., it mediates CD40 pathway signaling. The fragment can compete with the full antibody for binding to CD40.

[0069] Agonistic antigen-binding fragments of agonistic anti-CD40 antibodies can be produced by recombinant DNA techniques or can be produced by enzymatic or chemical cleavage of anti-CD40 antibodies. Agonistic antigen-binding fragments include, but are not limited to, Fab fragments, diabodies (heavy chain variable domains on the same polypeptide as light chain variable domains, connected by a short peptide linker that is too short to allow pairing between the two domains on the same chain), Fab' fragments, F(ab')2 fragments, Fv fragments, domain antibodies, and single-chain antibodies and can be derived from any mammalian source, including, but not limited to, human, mouse, rat, camelid, or rabbit.

[0070] The term "variable region" or "variable domain" refers to the light chain and / or heavy chain portion of an antibody, generally including about the amino-terminal 120 to 130 amino acids in the heavy chain and about 100 to 110 amino-terminal amino acids in the light chain. The variable regions of different antibodies vary widely in amino acid sequence, even among antibodies derived from the same species or class. Exemplary V domains of the agonist anti-CD40 antibody CP870,893 are shown in Table 1. L and V H Because it contains the CDRs, the variable region of an antibody generally determines the specificity of a particular antibody for its target. Table 1 also shows an exemplary CDR sequence for the agonist anti-CD40 antibody CP870,893.

[0071] Table 1. Anti-CD40 antibody heavy / light chain variable regions and CDRs of agonistic anti-CD40 antibody CP870,893. Bold italic sequences correspond to CDR regions according to the Kabat definition.

[0072]

[0073]

[0074] The schematic diagram of the CDR and the identification of the residues comprising the antibody binding site can be completed by solving the antibody structure and / or solving the structure of the antibody-ligand complex. This can be achieved by any of a variety of techniques known to those skilled in the art, such as X-ray crystallography. A variety of analytical methods can be used to identify or approximate CDR regions. Examples of these methods include, but are not limited to, Kabat definition, Chothia definition, AbM definition, and contact definition.

[0075] The Kabat definition is a standard for numbering residues in antibodies and is often used to identify CDR regions. See, e.g., Johnson & Wu, Nucleic Acids Res., 28:214-8 (2000). The Chothia definition is similar to the Kabat definition, but the Chothia definition takes into account the location of certain structural loop regions. See, e.g., Chothia et al., J. Mol. Biol., 196:901-17 (1986); Chothia et al., Nature, 342:877-83 (1989). The AbM definition uses an integrated suite of computer programs for modeling antibody structures produced by the Oxford Molecular Group. See, e.g., Martin et al., Proc Natl Acad Sci (USA), 86:9268-9272 (1989); "AbM TM , A Computer Program for Modeling Variable Regions of Antibodies" Oxford, UK; Oxford Molecular, Ltd. AbM definitions model antibody tertiary structure from primary sequence using a combination of knowledge databases and ab initio approaches, such as those described by Samudrala et al., "Ab Initio Protein Structure Prediction Using a Combined Hierarchical Approach," PROTEINS, Structure, Function and Genetics Suppl., 3:194-198 (1999). Contact definitions are based on analysis of available complex crystal structures. See, e.g., MacCallum et al., J. Mol. Biol., 5:732-45 (1996).

[0076] In certain embodiments, the complementary determining regions (CDRs) of the light chain and heavy chain variable regions of the agonist anti-CD40 antibody or agonist antigen-binding fragment thereof can be grafted to framework regions (FRs) from the same or another species. In certain embodiments, the CDRs of the light chain and heavy chain variable regions of the agonist anti-CD40 antibody or agonist antigen-binding fragment thereof can be grafted to common human FRs. To generate common human FRs, in certain embodiments, FRs from several human heavy or light chain amino acid sequences are aligned to identify common amino acid sequences. In certain embodiments, FRs of the heavy or light chain of the agonist anti-CD40 antibody or agonist antigen-binding fragment thereof are replaced with FRs from different heavy or light chains. In certain embodiments, rare amino acids in the FRs of the heavy and light chains of the agonist anti-CD40 antibody or agonist antigen-binding fragment thereof are not replaced, while the remaining FR amino acids are replaced. Rare amino acids are specific amino acids at positions in the FRs where they are not normally found. In certain embodiments, a grafted variable region from an agonist anti-CD40 antibody or agonist antigen-binding fragment thereof can be used with a constant region that is different from the constant region of the agonist anti-CD40 antibody or agonist antigen-binding fragment thereof. In certain embodiments, the grafted variable region is part of a single-chain Fv antibody. CDR grafting is described in, e.g., U.S. Pat. Nos. 6,180,370, 6,054,297, 5,693,762, 5,859,205, 5,693,761, 5,565,332, 5,585,089, and 5,530,101 and Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988); Winter, FEBS Letts., 430:92-94 (1998), which are incorporated herein by reference for any purpose.

[0077] The "Fc" region generally comprises the C H 2 and C H Two heavy chain fragments of the 3 domain. H Hydrophobic interactions of the 3 domains hold the two heavy chain fragments together.

[0078] The "Fab fragment" contains a full-length light chain and a heavy chain C H 1 and variable region (V H and C H The combination of region 1 is referred to herein as the "fab region heavy chain").

[0079] The "Fab' fragment" contains a light chain and a VH domain and a CH 1 domain and C H 1 and C H The Fab' fragments are part of one heavy chain of the region between the two Fab' domains, thereby allowing the formation of an interchain disulfide bond between the two heavy chains of the two Fab' fragments to form a F(ab')2 molecule.

[0080] The "F(ab')2 fragment" contains two light chains and a C H 1 and C H The two heavy chains contain a portion of the constant region between the two heavy chains, thereby forming an interchain disulfide bond between the two heavy chains. Thus, the F(ab')2 fragment consists of two Fab' fragments held together by the disulfide bond between the two heavy chains.

[0081] The "Fv region" contains the variable regions from both the heavy and light chains, but lacks the constant regions.

[0082] "Single-chain antibodies" are Fv molecules in which the heavy and light chain variable regions have been connected by a flexible linker to form a single polypeptide chain, which forms an antigen binding region. Single-chain antibodies are discussed in detail in International Patent Application Publication No. WO 88 / 01649 and U.S. Patent No. 4,946,778 and U.S. Patent No. 5,260,203, the disclosures of which are incorporated by reference.

[0083] "Domain antibodies" are immunologically functional immunoglobulin fragments containing only the variable region of a heavy chain or a light chain. In some cases, two or more V domains are linked by a peptide linker. H The two V domains of the bivalent domain antibody are covalently linked together to produce a bivalent domain antibody. H The regions can target the same or different antigens.

[0084] The antibodies or antigen binding proteins according to the present invention, such as interferon-related antigen binding proteins, are preferably ≤10 -7 The dissociation constant (K d ) binds to its target antigen. d ≤5×10 -9 M, the antibody or antigen binding protein binds its antigen with "high affinity", and when K d ≤5×10 -10 M, binds its antigen with "very high affinity". More preferably, the antibody or antigen binding protein has a K d ≤10 -9 M. In some embodiments, the off-rate is <1×10 -5 In other embodiments, the antibody or antigen binding protein will be present in an amount of about 10 -9 M to 10 -13 K between M dBinds to human CD40, and in another embodiment, the antibody or antigen binding protein will be expressed as d ≤5×10 -10 As will be appreciated by those skilled in the art, in some embodiments, any or all of the antigen binding fragments may bind to CD40. Preferably, surface plasmon resonance is used, more preferably, The system determines the constant.

[0085] The term "surface plasmon resonance" refers to the use of, for example, The system (BIAcore International AB, GE Healthcare, Uppsala, Sweden and Piscataway, NJ) analyzes the optical phenomena of real-time biospecific interactions by detecting changes in protein concentration within a biosensor matrix. For further description, see et al. (1993) Ann. Biol. Clin. 51: 19-26. The term "K on " represents the on rate constant for binding of a binding protein (eg, an antibody or antigen binding protein) to an antigen to form, for example, an antigen binding protein / antigen complex. The term "K on " or "binding rate" also refers to the "association rate constant" or "ka", as used interchangeably herein. The value representing the binding rate of a binding protein to its target antigen or the rate of complex formation between a binding protein, e.g., an antibody or antigen binding protein, and an antigen is also shown by the following equation:

[0086] Antibody ("Ab") + Antigen ("Ag") → Ab-Ag

[0087] As is known in the art, the term "K off " or "off-rate" represents the off rate constant or "dissociation rate constant" of the dissociation of a binding protein (e.g., an antibody or antigen binding protein) from, for example, an antigen binding protein / antigen complex. This value represents the off rate of a binding protein, e.g., an antibody or antigen binding protein, from its target antigen or the off rate of an Ab-Ag complex separating into free antibody and antigen over time, as represented by the following equation:

[0088] Ab+Ag←Ab-Ag

[0089] The term "K d" and "equilibrium dissociation constant" refer to the values ​​obtained in equilibrium titration measurements or by using the dissociation rate constant (K off ) divided by the binding rate constant (K on ). The association rate constant, dissociation rate constant, and equilibrium dissociation constant are used to express the binding affinity of a binding protein (e.g., an antibody or antigen binding protein) to an antigen. Methods for determining association and dissociation rate constants are well known in the art. The use of fluorescence-based techniques provides high sensitivity and the ability to examine samples at equilibrium in physiological buffers. Other experimental methods and instruments may be used, such as (Biomolecular Interaction Analysis) assays (e.g., instruments available from BIAcore International AB, GE Healthcare, Uppsala, Sweden). Alternatively, instruments available from Sapidyne Instruments (Boise, Id.) (Kinetic Exclusion Assay) determination.

[0090] The antigen binding proteins according to the invention may bind to one target with an affinity that is at least one order of magnitude higher, preferably at least two orders of magnitude higher than for a second target.

[0091] The term "target" refers to a molecule or portion of a molecule that can be bound by an antigen binding protein. In certain embodiments, a target may have one or more epitopes. Thus, it will be understood that a target may be used as an "antigen" for an "antigen binding protein" of the present invention.

[0092] The term "epitope" includes any determinant that can be bound by antigen binding proteins, such as antibodies. An epitope is an antigenic region bound by an antigen binding protein of a targeted antigen, and when the antigen is a protein, the epitope includes specific amino acids that directly contact the antigen binding protein. Most commonly, the epitope is present on the protein, but may be present in another molecule, such as nucleic acids, in some cases. The epitope determinant may include a chemically active surface grouping of a molecule, such as an amino acid, a sugar side chain, a phosphoryl group, or a sulfonyl group, and may have specific three-dimensional structural features and / or specific charge characteristics. Typically, antibodies specific to a particular target antigen will preferentially / specifically identify an epitope on the target antigen in a complex mixture of proteins and / or macromolecules.

[0093] In an exemplary embodiment, the agonist anti-CD40 antibody or agonist antigen-binding fragment thereof forming part (I) of the interferon-related antigen-binding protein of the present invention comprises three light chain complementary determining regions (CDRs) having at least 90% identity to the CDRL1, CDRL2 and CDRL3 sequences within SEQ ID NO 3; and three heavy chain CDRs having at least 90% identity to the CDRH1, CDRH2 and CDRH3 sequences within SEQ ID NO 6. The agonist anti-CD40 antibody or agonist antigen-binding fragment thereof may also comprise three light chain complementary determining regions (CDRs) identical to the CDRL1, CDRL2 and CDRL3 sequences within SEQ ID NO 3; and three heavy chain CDRs identical to the CDRH1, CDRH2 and CDRH3 sequences within SEQ ID NO 6. In these embodiments, each CDR is defined according to the Kabat definition, Chothia definition, AbM definition or contact definition of CDR; preferably wherein each CDR is defined according to the CDR Kabat definition or the CDR Chothia definition. In a specific embodiment, each CDR is defined according to the Kabat definition. In other specific embodiments, each CDR is defined according to the Chothia definition.

[0094] Alternatively, the agonist anti-CD40 antibody or agonist antigen-binding fragment thereof forming part (I) of the interferon-related antigen-binding protein of the invention comprises (a) a heavy chain or fragment thereof comprising a complementarity determining region (CDR) CDRH1 having at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO 56, a CDRH2 having at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO 57, and a CDRH3 having at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO 58; and (b) a light chain or fragment thereof comprising a CDRL1 having at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO 52, a CDRL2 having at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO 53, and a CDRL4 having at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO 54. 54 has a CDRL3 that is at least 90%, at least 95%, at least 98% or at least 99% identical.

[0095] In some embodiments, the agonist anti-CD40 antibody or its agonist antigen-binding fragment comprises (a) a heavy chain or fragment thereof comprising a complementarity determining region (CDR) CDRH1 identical to SEQ ID NO 56, a CDRH2 identical to SEQ ID NO 57, and a CDRH3 identical to SEQ ID NO 58; and (b) a light chain or fragment thereof comprising a CDRL1 identical to SEQ ID NO 52, a CDRL2 identical to SEQ ID NO 53, and a CDRL3 identical to SEQ ID NO 54.

[0096] More specifically, the agonist anti-CD40 antibody or agonist antigen-binding fragment thereof comprises a light chain variable region V L , which comprises the sequence shown in SEQ ID NO 51, or a sequence having at least 90%, at least 95%, at least 98% or at least 99% identity thereto; and / or a heavy chain variable region V H , which comprises the sequence shown in SEQ ID NO 55, or a sequence having at least 90%, at least 95%, at least 98% or at least 99% identity thereto.

[0097] The interferon-related antigen-binding protein of the present invention may also comprise an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof, which comprises a Fab region heavy chain, wherein the Fab region heavy chain comprises the amino acid sequence shown in SEQ ID NO 12 or a sequence having at least 90%, at least 95%, at least 98% or at least 99% identity thereto.

[0098] In some embodiments, the agonist anti-CD40 antibody or its agonist antigen-binding fragment comprises a light chain (LC), which comprises the sequence shown in SEQ ID NO 3, or a sequence that is at least 90%, at least 95%, at least 98% or at least 99% identical thereto; and / or a heavy chain (HC), which comprises a sequence selected from the group consisting of SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 49, SEQ ID NO 12 and SEQ ID NO 50, or a sequence that is at least 90%, at least 95%, at least 98% or at least 99% identical thereto.

[0099] In a more specific embodiment, the agonist anti-CD40 antibody or its agonist antigen-binding fragment comprises a light chain (LC) comprising the sequence shown in SEQ ID NO 3, or a sequence having at least 90%, at least 95%, at least 98% or at least 99% identity thereto; and / or a heavy chain (HC) comprising the sequence shown in SEQ ID NO 6, or a sequence having at least 90%, at least 95%, at least 98% or at least 99% identity thereto.

[0100] In a more specific embodiment, the agonist anti-CD40 antibody or its agonist antigen-binding fragment comprises a light chain (LC) comprising the sequence shown in SEQ ID NO 3, or a sequence having at least 90%, at least 95%, at least 98% or at least 99% identity thereto; and / or a heavy chain (HC) comprising the sequence shown in SEQ ID NO 9, or a sequence having at least 90%, at least 95%, at least 98% or at least 99% identity thereto.

[0101] In other more specific embodiments, the agonist anti-CD40 antibody or its agonist antigen-binding fragment comprises a light chain (LC) comprising the sequence shown in SEQ ID NO 3, or a sequence having at least 90%, at least 95%, at least 98% or at least 99% identity thereto; and / or a heavy chain (HC) comprising the sequence shown in SEQ ID NO 49, or a sequence having at least 90%, at least 95%, at least 98% or at least 99% identity thereto.

[0102] In other more specific embodiments, the agonist anti-CD40 antibody or its agonist antigen-binding fragment comprises a light chain (LC) comprising the sequence shown in SEQ ID NO 3, or a sequence having at least 90%, at least 95%, at least 98% or at least 99% identity thereto; and / or a heavy chain (HC) comprising the sequence shown in SEQ ID NO 12, or a sequence having at least 90%, at least 95%, at least 98% or at least 99% identity thereto.

[0103] In other more specific embodiments, the agonist anti-CD40 antibody or agonist antigen-binding fragment thereof comprises a light chain (LC) comprising the sequence shown in SEQ ID NO 3, or a sequence having at least 90%, at least 95%, at least 98% or at least 99% identity thereto; and / or a heavy chain (HC) comprising the sequence shown in SEQ ID NO 50, or a sequence having at least 90%, at least 95%, at least 98% or at least 99% identity thereto.

[0104] Variants and derivatives of interferon-related antigen binding proteins or components thereof

[0105] A "variant" of a polypeptide (e.g., an interferon-related antigen binding protein, an interferon-fused agonist anti-CD40 antibody, or an interferon-fused agonist antigen binding fragment thereof, an antibody, an antigen binding protein, or an IFN, or a component thereof) comprises an amino acid sequence in which, relative to another polypeptide sequence, 1, 2, 3, 4, 5 or more amino acid residues are inserted into the amino acid sequence, deleted from the amino acid sequence, and / or substituted into the amino acid sequence. Preferably, the variant comprises up to 10 insertions, deletions, and / or substitutions, more preferably up to 8 insertions, deletions, and / or substitutions. More specifically, the variant may comprise up to 10, more preferably up to 8 insertions. The variant may also comprise up to 10, more preferably up to 8 deletions. In a more preferred embodiment, the variant comprises up to 10 substitutions, most preferably up to 8 substitutions. In some embodiments, these substitutions are conservative amino acid substitutions as described below.

[0106] A "variant" of a polynucleotide sequence (e.g., RNA or DNA) comprises one or more mutations in a polynucleotide sequence relative to another polynucleotide sequence, wherein 1, 2, 3, 4, 5 or more nucleic acid residues are inserted in the nucleic acid sequence, deleted from the nucleic acid sequence and / or replaced in the nucleic acid sequence. Preferably, the variant comprises up to 10 insertions, deletions and / or replacements, more preferably up to 8 insertions, deletions and / or replacements. More specifically, the variant may comprise up to 10, more preferably up to 8 insertions. The variant may also comprise up to 10, more preferably up to 8 deletions. In a more preferred embodiment, the variant comprises up to 10 replacements, most preferably up to 8 replacements. Compared to another amino acid sequence, the 1, 2, 3, 4, 5 or more mutations may cause 1, 2, 3, 4, 5 or more amino acid exchanges (i.e., "non-silent mutations") in the amino acid sequence encoded by the variant. Variants also include nucleic acid sequences in which 1, 2, 3, 4, 5 or more codons have been replaced by their synonymous codons, which do not cause an amino acid exchange and are therefore referred to as "silent mutations".

[0107] In the context of polypeptide or nucleotide sequence variants, the term "identity" or "homology" refers to the relationship between two or more polypeptide molecules or two or more nucleic acid molecule sequences, as determined by sequence alignment and comparison. "Percent identity" represents the percentage of identical residues between amino acids or nucleotides in the compared molecules, and is calculated based on the minimum molecular size compared. Preferably, identity is determined over the entire length of the sequence. It should be understood that the expression of "at least 80% identity" includes embodiments in which the claimed sequence has at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity with the reference sequence. The expression "at least 90% identity" includes embodiments in which the claimed sequence has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the reference sequence.

[0108] For the calculation of percent identity, gaps in the alignment, if any, are preferably resolved by a specific mathematical model or computer program (ie, an "algorithm"). Methods that can be used to calculate the identity of aligned nucleic acids or polypeptides include those described in Computational Molecular Biology, (Lesk AM, ed.), 1988, New York: Oxford University Press; Biocomputing Informatics and Genome Projects, (Smith, DW, ed.), 1993, New York: Academic Press; Computer Analysis of Sequence Data, Part I, (Griffin, AM, and Griffin, HG, eds.), 1994, New Jersey: Humana Press; von Heinje, G., 1987, Sequence Analysis in Molecular Biology, New York: Academic Press; Sequence Analysis Primer, (Gribskov, M. and Devereux, J., eds.), 1991, New York: M. Stockton Press; and Carillo et al., 1988, SIAM J. Applied Math. 48 :Those described in 1073.

[0109] When calculating the percent identity, the sequences to be compared are usually aligned in a manner that provides the largest match between the sequences. An example of a computer program that can be used to determine percent identity is the GCG program package, which includes GAP (Devereux et al., 1984, Nucl. Acid Res. 12 :387; Genetics Computer Group, University of Wisconsin, Madison, WI). The computer algorithm GAP is used to compare two polypeptides or polynucleotides that will determine their sequence identity percentage. For the best match of their respective amino acids or nucleotides ("matching coverage (matched span)", as determined by the algorithm) to compare sequences. Combined with the algorithm, gap opening penalty (calculated as 3x average diagonal, wherein "average diagonal" is the mean value of the diagonal of the comparison matrix being used; "diagonal" is the score or value assigned to each complete amino acid match by a specific comparison matrix) and gap extension penalty (it is generally 1 / 10 times of gap opening penalty) and a comparison matrix, such as PAM 250 or BLOSumm 62. In certain embodiments, a standard comparison matrix is ​​also used by the algorithm (for the PAM 250 comparison matrix, see Dayhoff et al., 1978, Atlas of Protein Sequence and Structure 5:345-352; for the BLOSumm 62 comparison matrix, see Henikoff et al., 1992, Proc. Natl. Acad. Sci. USA 89:10915-10919).

[0110] Examples of parameters that can be used to determine percent identity of polypeptide or nucleotide sequences using the GAP program are as follows:

[0111] ● Algorithm: Needleman et al., 1970, J. Mol. Biol. 48: 443-453

[0112] ● Comparison matrix: from Henikoff et al., 1992, BLOSumm 62 supra

[0113] Gap Penalty: 12 (but no penalty for end gaps)

[0114] ●Gap length penalty: 4

[0115] ●Similarity threshold: 0

[0116] Some alignment schemes used to align two amino acid sequences may only match a relatively short region of the two sequences, and this small aligned region may have a very high sequence identity, even if there is no obvious relationship between the two full-length sequences. Therefore, if it is necessary to generate an alignment covering at least 50 or at least 100, preferably the entire length of contiguous amino acids of the target polypeptide, the selected alignment method (GAP program) can be adjusted.

[0117] Conservative amino acid substitutions may encompass non-naturally occurring amino acid residues that are typically incorporated by chemical peptide synthesis rather than by synthesis in biological systems. These include peptidomimetics and other reverse or inverted forms of amino acid moieties.

[0118] Naturally occurring residues can be classified based on common side chain properties:

[0119] 1) Hydrophobicity: norleucine, Met, Ala, Val, Leu, Ile;

[0120] 2) Neutral hydrophilicity: Cys, Ser, Thr, Asn, Gln;

[0121] 3) Acidic: Asp, Glu;

[0122] 4) Basic: His, Lys, Arg;

[0123] 5) Residues that affect chain orientation: Gly, Pro; and

[0124] 6) Aromatic: Trp, Tyr, Phe.

[0125] For example, non-conservative substitutions can include exchanging a member of one of these classes for a member of another class. For example, these substituted residues can be introduced into regions of human antibodies homologous to non-human antibodies or into non-homologous regions of the molecule.

[0126] According to certain embodiments, when making changes to the interferon-related antigen binding protein, the hydropathic index of the amino acids can be considered. Each amino acid is assigned a hydropathic index based on its hydrophobicity and charge characteristics. They are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine / cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamic acid (-3.5); glutamine (-3.5); aspartic acid (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).

[0127] The importance of the hydropathic amino acid index in conferring interactive biological functions to proteins is understood in the art. Kyte et al., J. Mol. Biol., 157: 105-131 (1982). It is known that certain amino acids can be replaced with other amino acids with similar hydropathic indices or scores and still retain similar biological activity. In certain embodiments, when changes are made based on the hydropathic index, replacement of amino acids with a hydropathic index within ± 2 is included. In certain embodiments, those with a hydropathic index within ± 1 are included, and in certain embodiments, those with a hydropathic index within ± 0.5 are included.

[0128] It is also understood in the art that similar amino acid substitutions can be effectively made based on hydrophilicity. In certain embodiments, the greatest local average hydrophilicity of a protein, as controlled by the hydrophilicity of its neighboring amino acids, correlates with its immunogenicity and antigenicity, i.e., the biological properties of the protein.

[0129] The following hydrophilicity values ​​have been assigned to these amino acid residues: arginine (+3.0); lysine (+3.0); aspartic acid (+3.0 ± 1); glutamic acid (+3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 ± 1); alanine (-0.5); histidine (-0.5); cysteine ​​(-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5) and tryptophan (-3.4). When making changes based on similar hydrophilicity values, in certain embodiments, amino acid substitutions within ±2 of hydrophilicity values ​​are included, in certain embodiments, those within ±1 of hydrophilicity values ​​are included, and in certain embodiments, those within ±0.5 of hydrophilicity values ​​are included.

[0130] Table 2 shows exemplary amino acid substitutions.

[0131] Table 2. Amino acid substitutions.

[0132]

[0133] According to the present invention, the technical staff will be able to use well-known technology to determine the suitable variant of interferon-related antigen binding proteins as described herein. In some embodiments, those skilled in the art can identify that it is believed that the region that is not important for activity can be changed molecule by targeting and will not destroy the suitable region of activity. In some embodiments, the technical staff can identify the residue and part of the molecule that is conservative in similar polypeptides. In some embodiments, even if conservative amino acid replacement can be carried out for biological activity or for the region that is important for structure and will not destroy biological activity or will not adversely affect polypeptide structure.

[0134] In addition, one skilled in the art can review structure-function studies to identify residues in similar polypeptides that are important for activity or structure. With reference to such comparisons, one can predict the importance of amino acid residues in a protein that correspond to amino acid residues in similar proteins that are important for activity or structure. One skilled in the art can select chemically similar amino acid substitutions for these predicted important amino acid residues.

[0135] Those skilled in the art can also analyze three-dimensional structure and amino acid sequence relative to the structure in similar proteins or protein domains. With reference to this information, those skilled in the art can predict the arrangement of amino acid residues of interferon-related antigen-binding proteins, antibodies or their antigen-binding fragments or interferon or its functional fragments as described herein relative to its three-dimensional structure. In some embodiments, those skilled in the art can choose not to make radical changes to the amino acid residues predicted to be located on the protein surface, so these residues can participate in important interactions with other molecules. In addition, those skilled in the art can produce test variants comprising single amino acid replacements at each desired amino acid residue. Then, the variants can be screened using activity assays known to those skilled in the art. These variants can be used to collect information about suitable variants. For example, if the technician finds that the change of a specific amino acid residue causes activity destruction, undesirable reduction or unsuitable activity, variants with this change can be avoided. In other words, based on the information collected from these experiments, those skilled in the art can easily determine that other replaced amino acids that should be avoided alone or in combination with other mutations.

[0136] According to certain embodiments, amino acid substitutions are those that: (1) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter binding affinity, and / or (5) confer or alter other physicochemical or functional properties of these polypeptides. According to certain embodiments, single or multiple amino acid substitutions (in certain embodiments, conservative amino acid substitutions) may be made in the naturally occurring sequence (in certain embodiments, in the portion of the polypeptide outside the domain that forms intermolecular contacts). In certain embodiments, conservative amino acid substitutions generally may not significantly alter the structural properties of the parent sequence (e.g., the replacement amino acid should not tend to break helices present in the parent sequence or disrupt other types of secondary structures that characterize the parent sequence). Examples of art-recognized polypeptide secondary and tertiary structures are described in Proteins, Structures and Molecular Principles (Creighton, ed., WH Freeman and Company, New York (1984)); Introduction to Protein Structure (C. Branden & J. Tooze, eds., Garland Publishing, New York, NY (1991)); and Thornton et al., Nature, 354:105 (1991), each of which is incorporated herein by reference.

[0137] The term "derivative" refers to a molecule including chemical modifications other than the insertion, deletion or replacement of an amino acid (or nucleic acid). In some embodiments, the derivative comprises a covalent modification, which includes but is not limited to chemical bonding with a polymer, a lipid or other organic or inorganic part. In some embodiments, the chemically modified interferon-related antigen binding protein may have a longer circulation half-life than the unchemically modified interferon-related antigen binding protein. In some embodiments, the chemically modified interferon-related antigen binding protein may have improved targeting capabilities to the desired cells, tissues and / or organs. In some embodiments, the covalently modified derived interferon-related antigen binding protein is connected to include one or more water-soluble polymers, including but not limited to polyethylene glycol, polyoxyethylene glycol or polypropylene glycol. See, for example, U.S. Patent Nos.: 4,640,835, 4,496,689, 4,301,144, 4,670,417, 4,791,192 and 4,179,337. In certain embodiments, the derivatized interferon-related antigen binding protein comprises one or more polymers, including but not limited to monomethoxy-polyethylene glycol, dextran, cellulose or other carbohydrate-based polymers, poly-(N-vinyl pyrrolidone)-polyethylene glycol, propylene glycol homopolymers, polypropylene oxide / ethylene oxide copolymers, polyoxyethylene polyols (e.g., glycerol) and polyvinyl alcohol, and mixtures of these polymers.

[0138] In some embodiments, the derivative of the interferon-related antigen binding protein as described herein is covalently modified by polyethylene glycol (PEG) subunits. In some embodiments, one or more specific positions of the derivative can be, for example, bonded to one or more water-soluble polymers at the amino terminal. In some embodiments, one or more water-soluble polymers can be randomly connected to one or more side chains of the derivative. In some embodiments, PEG is used to improve the therapeutic ability of interferon-related antigen binding proteins. Some of these methods are discussed, for example, in U.S. Patent No. 6,133,426, which is incorporated herein by reference for any purpose.

[0139] In some embodiments, interferon-associated antigen-binding protein variants include glycosylation variants, wherein compared with the amino acid sequence of the parent polypeptide, the number and / or type of glycosylation sites have been changed. In some embodiments, protein variants include glycosylation sites that are connected with more N-than native proteins. In other embodiments, protein variants include glycosylation sites that are connected with less N-than native proteins. The glycosylation sites that N-is connected are characterized by sequences: Asn-X-Ser or Asn-X-Thr, wherein the amino acid residue represented by X can be any amino acid residue except proline. The replacement of the amino acid residues that produces this sequence provides possible new sites for adding carbohydrate chains that N-is connected. Alternatively, the replacement that eliminates this sequence will remove the carbohydrate chains that existing N-is connected. The rearrangement of the carbohydrate chains that N-is connected is also provided, wherein 1,2,3,4,5 or more glycosylation sites (usually naturally occurring ones) that N-is connected are eliminated and one or more new sites that N-is connected are produced. Other preferred variants include cysteine ​​variants, in which one or more cysteine ​​residues are deleted or replaced with another amino acid (e.g., serine) compared to the parent amino acid sequence. Cysteine ​​variants may be useful when the antibody must be folded into a biologically active conformation, such as after the separation of insoluble inclusion bodies. Cysteine ​​variants typically have fewer cysteine ​​residues than the native protein, and typically have an even number to minimize interactions resulting from unpaired cysteines.

[0140] HBV and HBV markers

[0141] As used herein, "hepatitis B virus" or "HBV" refers to a double-stranded DNA virus that causes hepatitis B, which belongs to a family of closely related DNA viruses known as hepadnaviruses. Hepadnaviruses have a strong preference for infecting liver cells, but small amounts of hepadnavirus DNA can be present in the kidneys, pancreas, and mononuclear cells. However, infection at these sites is not associated with other liver diseases.

[0142] HBV virus particles, i.e., Dane particles, consist of an outer lipid envelope and an icosahedral nucleocapsid core composed of proteins. The nucleocapsid encapsulates viral DNA and a DNA polymerase with reverse transcriptase activity similar to that of retroviruses. The outer envelope contains embedded proteins that participate in viral binding and entry into sensitive cells. The virus is one of the smallest enveloped animal viruses, with a virus particle diameter of 42nm, but there are polymorphic forms, including filaments and spherical bodies lacking a core. These particles are not infectious and are composed of lipids and proteins that constitute part of the surface of the virus particle, which are called surface antigens (HBsAg) and are overproduced during the viral life cycle. HBV contains HBsAg, HBcAg (and its splice variant HBeAg), DNA polymerase and Hbx. HBV is one of the few known non-retroviruses that use reverse transcription as part of its replication process.

[0143] HBV nucleocapsid contains relatively small and partially double-helical 3.2kb circular DNA, viral polymerase and core protein. Genome has only 4 long open reading frames. The pre-SS (front-surface-surface) region of the genome encodes 3 viral surface antigens by differential translation initiation at each of the 3 in-frame start codons.

[0144] The most abundant protein of HBV is 24kD S protein (which is called HBsAg). The pre-CC (pre-core-core) region encodes HBcAg (HBV core antigen) and HBeAg (HBV e antigen). Viral replication does not require HBeAg and HBeAg does not work in viral assembly, but despite this, HBeAg is a useful indicator of active viral replication. Since HBeAg is secreted by HBV-infected hepatocytes, HBeAg in blood can be detected by standard diagnostic tests (such as ELISA), and therefore HBeAg is used as a laboratory marker for viremia HBV infection (Testoni et al., Serum hepatitis B core-relatedantigen (HBcrAg) correlates with covalently closed circular DNA. J. Hepatol. 2019, 70, 615-625. http: / / dx.doi.org / 10.1016 / j.jhep.2018.11.030).

[0145] The P-coding region is specific for the viral polymerase, a multifunctional enzyme involved in DNA synthesis and RNA encapsidation. The X open reading frame encodes the viral X protein (HBx), which regulates host-cell signaling and can directly and indirectly affect host and viral gene expression.

[0146] It is believed that the life cycle of HBV begins when the virus is attached to the host cell membrane through its envelope protein. HBV has been shown to bind to receptors on the plasma membrane expressed on human hepatocytes, primarily through the pre-S1 domain of the large envelope protein, as in the initial steps of HBV infection. However, the nature of the receptor remains controversial. The viral membrane then fuses with the cell membrane and releases the viral genome into the cell.

[0147] HBV replication can be regulated by a variety of factors, including hormones, growth factors, and cytokines. After the viral genome reaches the nucleus, the cellular DNA repair machinery converts the partially double-stranded DNA (dsDNA; also known as relaxed circular HBV DNA (rcDNA)) genome into covalently closed circular DNA (cccDNA). The generated cccDNA is a template for host RNA Pol-II for further transcription of pregenomic and subgenomic RNAs (Allweiss L and Dandri M, The Role of cccDNA in HBV Maintenance. Viruses 2017, 9(6): 156; doi: 10.3390 / v9060156; Nur K. Mohd-Ismail, Zijie Lim, Jayantha Gunaratne and Yee-Joo Tan, Mapping the Interactions of HBV cccDNA with Host Factors. Int. J. Mol. Sci. 2019, 20(17): 4276; doi: 10.3390 / ijms20174276).

[0148] Pregenomic RNA is bifunctional, serving as a template for viral DNA synthesis and a messenger for pre-C, C and P translation. Subgenomic RNA only serves to translate the envelope and X proteins. All viral RNAs are transported to the cytoplasm, where they are translated to obtain viral envelope, core and polymerase proteins, as well as HBx and HBcAg.

[0149] HBV core particles are assembled in the cytosol, and during this process, a single molecule of pre-genomic RNA is introduced into the assembled viral core. Once the viral RNA is encapsidated, reverse transcription begins. The synthesis of the two viral DNA chains is sequential. The first DNA chain is made from the encapsidated RNA template; during or after the synthesis of this chain, the RNA template degrades and the synthesis of the second DNA chain continues by using the newly prepared first DNA chain as a template. Some cores with mature genomes are transported back to the nucleus, where their newly made DNA genomes can be converted into cccDNA to maintain a stable intranuclear mixed pool of transcription templates.

[0150] Initially, HBV surface antigen (HBsAg) proteins are synthesized and polymerized in the rough endoplasmic reticulum. These proteins are transported to the post-ER and pre-Golgi compartments, where nucleocapsid budding continues. Assembled HBV virions and subviral particles are transported to the Golgi apparatus for further modification of the glycans of the surface proteins and are then secreted from the host cell to complete the life cycle.

[0151] In a specific embodiment, the interferon-related antigen binding proteins, nucleic acids, vectors, vector systems, methods and compositions described herein can be used to treat HBV infection. As used herein, "treating HBV infection" and "treatment of HBV infection" refer to one or more of the following: (i) reducing HBV viral load / viral titer; (ii) reducing cccDNA transcription; (iii) reducing the level of pregenomic RNA in cells; (iv) reducing one or more HBV-related conditions; and (v) reducing one or more HBV-related symptoms in a subject.

[0152] The term "viral load" and "viral titer" represent the number of viral particles in cells, organs or body fluids, such as blood or serum. Based on the assay type, viral load or viral titer are usually expressed as viral particles or infectious particles / mL. At present, the viral load is usually measured using international units per milliliter (IU / mL). Alternatively, viral load or viral titer can be determined as so-called viral genome equivalents. Higher viral load, titer or viral load are usually related to the severity of active viral infection. Therefore, reducing viral load or viral titer is related to the reduction of the number of infectious viral particles in, for example, serum. Viral load is usually determined using nucleic acid amplification based tests (NATs or NAATss). NAT / NAAT tests use, for example, PCR (quantitative) reverse transcription polymerase chain reaction (RT-PCR or qRT-PCR), nucleic acid sequence based amplification (NASBA) or probe-based assays. Real-time PCR assays for quantification of hepatitis B virus DNA are described in, for example, Liu et al., Virol J 14, 94 (2017) doi: 10.1186 / s12985-017-0759-8. Due to the ease of viral DNA detection using PCR, viral load is useful in monitoring the success of treatment during clinical settings. Independent of HBeAg status, a viral load of >10.000 copies / mL (2.000 IU / mL) is a strong risk predictor for hepatocellular carcinoma.

[0153] The terms "patient" and "subject" are used interchangeably and include human and non-human animal subjects, preferably human subjects, as well as those formally diagnosed with a disorder, those for whom the disorder has not yet been formally recognized, those receiving medical attention, those at risk of developing the disorder, etc.

[0154] In a specific embodiment, the interferon-associated antigen binding proteins, nucleic acids, vectors, vector systems, methods and compositions described herein can be used to reduce HBV viral load / viral titer in HBV-infected cells (such as cell cultures, HBV-infected organs or HBV-infected patients). Compared with untreated HBV-infected cell cultures or the same patients before treatment, HBV viral load / viral titer can be reduced by about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%. In some embodiments, the HBV viral load / viral titer is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%. Preferably, the HBV viral load / viral titer is reduced by at least 35%, more preferably by at least 50%. In some embodiments, the viral load / viral titer is determined by PCR or qRT-PCR.

[0155] In a specific embodiment, the interferon-related antigen binding proteins, nucleic acids, vectors, vector systems, methods and compositions described herein can be used to reduce the transcription of HBV cccDNA in HBV-infected cells (such as cell cultures, HBV-infected organs or HBV-infected patients). Compared with untreated HBV-infected cell cultures or the same patients before treatment, cccDNA transcription can be reduced by about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%. In some embodiments, the transcription of HBV cccDNA is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%. Preferably, transcription of HBV cccDNA is reduced by at least 35%, more preferably by at least 50%.In some embodiments, transcription of HBV cccDNA is determined by PCR or qPCR.

[0156] In a specific embodiment, the interferon-related antigen binding proteins, nucleic acids, vectors, vector systems, methods and compositions described herein can be used to reduce the level of pregenomic HBV RNA in HBV-infected cells (such as cell cultures, HBV-infected organs or HBV-infected patients). Compared with untreated HBV-infected cell cultures or the same patients before treatment, the pregenomic HBV RNA level can be reduced by about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%. In some embodiments, the level of pregenomic HBV RNA is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%. Preferably, the level of pregenomic HBV RNA is reduced by at least 35%, more preferably by at least 50%.In some embodiments, the level of pregenomic HBV RNA is determined by qRT-PCR.

[0157] As used herein, "HBV-related disorders" refers to disorders resulting from HBV infection of a subject. HBV-related disorders include, but are not limited to, acute hepatitis, chronic hepatitis, icteric hepatitis, fulminant hepatitis, subfulminant hepatitis, and symptoms and / or complications caused by any of these disorders.

[0158] As used herein, "HBV-related symptoms", "symptoms of HBV infection" or "HBV-related complications" include one or more physical dysfunctions associated with HBV infection. HBV symptoms and complications include, but are not limited to, cirrhosis, hepatocellular carcinoma (HCC), membranous glomerulonephritis (MGN), death, acute necrotizing vasculitis (polyarteritis nodosa), membranous glomerulonephritis, papuloacrodermatitis in children (Chico syndrome), HBV-related nephropathy (e.g., membranous glomerulonephritis), immune-mediated hematological disorders (e.g., idiopathic mixed cryoglobulinemia, aplastic anemia), portal hypertension, ascites, encephalopathy, jaundice, itching, pale stools, steatorrhea, polyarteritis nodosa, glomerular disease, abnormal ALT levels, abnormal AST levels, abnormal alkaline phosphatase levels, elevated bilirubin levels, anorexia, malaise, fever, nausea, vomiting, etc.

[0159] Interferon

[0160] As used herein, "interferon" or "IFN" refers to a cytokine or a derivative thereof, which is usually produced and released by a cell in response to the presence of a pathogen or tumor cell. IFN includes type I IFN (e.g., IFNα, IFNβ, IFNε, IFNκ, IFNτ, IFNζ and IFNω), type II IFN (e.g., IFNγ) and type III IFN (e.g., IFNλ1, IFNλ2 and IFNλ3). The term "interferon" or "IFN" includes full-length IFN, its variant or derivative (e.g., a chemical (e.g., PEGylation) modified derivative or mutant protein) or its functionally active fragment without limitation, which retains one or more signal transduction activities of full-length IFN.

[0161] As used herein, the term "functional fragment" refers to a fragment of a substance that retains one or more functional activities of the original substance. For example, a functional fragment of interferon refers to an interferon fragment that retains the IFN function as described herein, for example, it mediates IFN pathway signal transduction.

[0162] When added to cells, tissues or organisms expressing homologous IFN receptors (IFNAR for IFNα, IFNBR for IFNβ, etc.), IFN can increase the activity of one or more IFN receptors by at least about 20%. In some embodiments, interferon activates IFN receptor activity by at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 85%. As described in more detail in Example 1, in vitro reporter cell assays can be used, for example, using HEK-Blue TM IFN-α / β cells (InvivoGen, catalog #: hkb-ifnαβ), HEK-Blue TM IFN-λ (InvivoGen, catalog #: hkb-ifnl) or HEK-Blue TM Dual IFN-γ cells (InvivoGen, catalog #: hkb-ifng) measure the activity of IFN (i.e., "IFN activity"). These reporter cells were generated by stably transfecting HEK293 cells with the human IFN receptor gene and an IFN-stimulated response element-controlled secreted embryonic alkaline phosphatase (SEAP) construct to measure IFN activity. Design HEK-Blue TM IFN- cells to monitor the activation of the JAK / STAT / ISGF3 pathway induced by type I, II or III interferons. Activation of these pathways induces the production and release of SEAP.

[0163] In the context of the present invention, the interferon-related antigen binding protein activates both the CD40 and IFN pathways. In certain embodiments, the interferon-related antigen binding protein is expressed at an EC of less than 100, 60, 50, 40, 30, 20, 10, or 1 ng / mL. 50 , preferably with an EC less than 11 ng / mL 50 , more preferably with an EC of less than 6 ng / mL 50 Activating an IFN pathway. In some of these embodiments, the IFN pathway is an IFNα (interferon alpha), IFNβ (interferon beta), IFNε (interferon epsilon), IFNω (interferon omega), IFNγ (interferon gamma), or IFNλ (interferon lambda) pathway.

[0164] According to certain exemplary embodiments, the interferon-related antigen binding proteins as described herein include full-length IFN, its variant or derivative (e.g., chemical (e.g., PEGylation) modified derivative or mutant protein) or its functionally active fragment, which retains one or more signal transduction activities of the full-length IFN. In certain embodiments, IFN is human IFN.

[0165] In certain embodiments, the interferon-related antigen binding protein as described herein comprises an IFN or a functional fragment thereof selected from the group consisting of type I IFN, type II IFN and type III IFN or a functional fragment thereof.

[0166] In a specific embodiment, IFN or a functional fragment thereof is a type I IFN or a functional fragment thereof. In a specific embodiment, type I IFN or a functional fragment thereof is IFNα, IFNβ, IFNω or IFNε or a functional fragment thereof. In a more specific embodiment, type I IFN or a functional fragment thereof is IFNα or IFNβ or a functional fragment thereof. In other more specific embodiments, type I IFN or a functional fragment thereof is IFNα or a functional fragment thereof. In other more specific embodiments, type I IFN or a functional fragment thereof is IFNβ or a functional fragment thereof. In other more specific embodiments, type I IFN or a functional fragment thereof is IFNω or a functional fragment thereof. In other more specific embodiments, type I IFN or a functional fragment thereof is IFNε or a functional fragment thereof.

[0167] In a specific embodiment, IFN or a functional fragment thereof is IFNα, IFNβ, IFNγ, IFNλ, IFNε or IFNω or a functional fragment thereof. In a specific embodiment, IFN or a functional fragment thereof is IFNα or IFNβ or a functional fragment thereof.

[0168] In some embodiments, IFN or a functional fragment thereof is IFNα or a functional fragment thereof. In a more specific embodiment, IFN or a functional fragment thereof is IFNα2a or a functional fragment thereof. IFNα2a may comprise the sequence shown in SEQ ID NO 17 or a sequence having at least 90% identity thereto.

[0169] In some embodiments, IFN or its functional fragment is IFNβ or its functional fragment. IFNβ may comprise the sequence shown in SEQ ID NO 14 or a sequence having at least 90% identity thereto. IFNβ or its functional fragment may comprise one or two amino acid substitutions selected from C17S and N80Q relative to SEQ ID NO 14. In some embodiments, IFNβ or its functional fragment comprises the amino acid substitution C17S relative to SEQ ID NO 14. In some embodiments, IFNβ comprises the amino acid sequence shown in SEQ ID NO 15. In other embodiments, IFNβ comprises the amino acid substitutions C17S and N80Q relative to SEQ ID NO 14. In other embodiments, IFNβ comprises the amino acid sequence shown in SEQ ID NO 16.

[0170] In some embodiments, IFN or a functional fragment thereof is IFNγ or IFNλ or a functional fragment thereof. In a specific embodiment, IFN or a functional fragment thereof is IFNγ or a functional fragment thereof. In a more specific embodiment, IFNγ comprises the sequence shown in SEQ ID NO 19 or a sequence having at least 90% identity thereto. In other specific embodiments, IFN or a functional fragment thereof is IFNλ or a functional fragment thereof. In a more specific embodiment, IFNλ or a functional fragment thereof is IFNλ2 or a functional fragment thereof. IFNλ2 may comprise the sequence shown in SEQ ID NO 18 or a sequence having at least 90% identity thereto.

[0171] In some embodiments, the IFN or a functional fragment thereof is IFNε or a functional fragment thereof. IFNε may comprise the sequence shown in SEQ ID NO 61 or a sequence having at least 90% identity thereto.

[0172] In some embodiments, the IFN or a functional fragment thereof is IFNω or a functional fragment thereof. IFNω may comprise the sequence shown in SEQ ID NO 60 or a sequence having at least 90% identity thereto.

[0173] In certain embodiments, the expression level of one or more IFN signaling pathway biomarkers is changed, i.e., upregulated or downregulated, in HBV-infected cells treated with interferon-related antigen binding proteins described herein. According to certain exemplary embodiments, the expression level of one or more IFN pathway biomarkers is upregulated in HBV-infected cells treated with interferon-related antigen binding proteins described herein. In this context, "biomarkers" will be understood as features that are objectively measured and evaluated as an indication of normal biological processes, pathogenic processes, or pharmacological responses to therapeutic interventions.

[0174] According to certain embodiments, the important suitable IFN pathway biomarkers herein are chemokines, for example, CXC chemokines, which are selected from the group consisting of CXCL9, CXCL10 and CXCL11. In certain exemplary embodiments, suitable biomarkers induced by the IFN pathway are CXCL9, CXCL10 and / or CXCL11, and interferon-stimulated gene ISG20. Techniques known in the art, such as ELISA quantitative cytokine induction or release can be used. Alternatively, RNA-based assays such as RNAseq or qRT-PCR can also be used to determine induction. In certain embodiments, upregulation can mean that the expression or secretion of these cytokines is increased by at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 4-fold, at least 5-fold or at least 10-fold.

[0175] In these or other exemplary embodiments, the expression levels of proinflammatory cytokines, e.g., IL10, IL1β, and / or IL2, in human whole blood cells are not significantly upregulated by treatment with the interferon-related antigen binding proteins of the present invention. In some embodiments, the expression level of IL10 in human whole blood cells is not significantly upregulated by treatment with the interferon-related antigen binding proteins of the present invention. In some embodiments, the expression level of IL1β in human whole blood cells is not significantly upregulated by treatment with the interferon-related antigen binding proteins of the present invention. In some embodiments, the expression level of IL2 in HBV-infected cells is not significantly upregulated by treatment with the interferon-related antigen binding proteins of the present invention. In some embodiments, the expression levels of IL10 and IL1β in HBV-infected cells are not significantly upregulated by treatment with the interferon-related antigen binding proteins of the present invention. In some embodiments, the expression levels of IL10 and IL2 in HBV-infected cells are not significantly upregulated by treatment with the interferon-related antigen binding proteins of the present invention. In some embodiments, the expression levels of IL1β and IL2 in HBV-infected cells are not significantly upregulated by treatment with the interferon-related antigen binding proteins of the present invention. In some embodiments, the expression levels of IL10, IL1β and IL2 in HBV-infected cells are not significantly upregulated by treatment with the interferon-related antigen binding proteins of the present invention.

[0176] Interferon-related antigen binding protein

[0177] As used herein, the term "combined" generally refers to the covalent or non-covalent bonding of two (or more) molecules.By connecting two or more different peptides or proteins, a combined protein is generated, thereby resulting in a protein with one or more functional properties from each original protein.In the context of the present invention, interferon-related antigen binding proteins activate both CD40 and IFN pathways.The combined protein covers monomers and polymers, for example, dimers, trimers, tetramers, etc., different combinations or fusion protein complexes.In this regard, by the strong interaction between the surface areas of the two proteins, non-covalent bonds are usually generated by ions, van der Waals forces and / or hydrogen bonds.On the other hand, covalent bonds require real chemical bonds, such as the presence of peptide bonds, disulfide bridges, etc.As used herein, the term "fused" generally refers to connecting two or more different peptides or proteins in a covalent form by peptide bonds.Therefore, "fusion protein" refers to a single protein produced by connecting two or more different peptides or proteins by peptide bonds with one or more functional properties derived from each original protein. In certain embodiments, two or more different peptides or proteins can be fused to each other via one or more peptide linkers ("L").

[0178] In all aspects of the invention, the interferon-related antigen binding protein is a protein comprising an agonistic anti-CD40 antibody or an agonistic antigen binding fragment thereof and IFN or a functional fragment thereof.

[0179] In some embodiments, IFN or a functional fragment thereof is non-covalently bound to an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof. In a more specific embodiment, IFN or a functional fragment thereof is non-covalently bound to an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof through ionic, van der Waals and / or hydrogen bonding interactions.

[0180] In other embodiments, IFN or a functional fragment thereof is covalently bound to an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof. In a preferred embodiment, IFN or a functional fragment thereof is fused to an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof. IFN or a functional fragment thereof can be fused to the light chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof. In some embodiments, IFN or a functional fragment thereof is fused to the N-terminus of the light chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof. In other embodiments, IFN or a functional fragment thereof is fused to the C-terminus of the light chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof. IFN or a functional fragment thereof can also be fused to the heavy chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof. In some embodiments, IFN or a functional fragment thereof is fused to the N-terminus of the heavy chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof. In other embodiments, IFN or a functional fragment thereof is fused to the C-terminus of the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof. In any of these embodiments, the agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof and IFN or a functional fragment thereof can be fused to each other via a linker.

[0181] As used herein, the term "linker" or "L" refers to any part that covalently links one or more agonistic anti-CD40 antibodies or agonistic antigen-binding fragments thereof to one or more interferons or functional fragments thereof. In an exemplary embodiment, the linker is a peptide linker. As used herein, the term "peptide linker" refers to a peptide suitable for connecting two or more parts. The peptide linkers mentioned in this article may have one or more properties listed below. The sequences of peptide linkers according to certain exemplary embodiments are shown in Table 7.

[0182] The peptide linker can have any length, i.e. contain any number of amino acid residues. In exemplary embodiments, the linker contains at least 1, at least 2, at least 3, at least 4, at least 5 amino acids. The linker can contain at least 4 amino acids. The linker can contain at least 11 amino acids. The linker can contain at least 12 amino acids. The linker can contain at least 13 amino acids. The linker can contain at least 15 amino acids. The linker can contain at least 20 amino acids. The linker can contain at least 21 amino acids. The linker can contain at least 24 amino acids.

[0183] The joint is usually long enough to provide enough flexibility to prevent the connected parts from interfering with each other's activity, for example, the ability of the part to bind to a receptor. In an exemplary embodiment, the joint comprises up to 10, up to 20, up to 30, up to 40, up to 50, up to 60, up to 70, up to 80, up to 90 or up to 100 amino acids. The joint can comprise up to 80 amino acids. The joint can comprise up to 40 amino acids. The joint can comprise up to 24 amino acids. The joint can comprise up to 21 amino acids. The joint can comprise up to 20 amino acids. The joint can comprise up to 15 amino acids. The joint can comprise up to 13 amino acids. The joint can comprise up to 12 amino acids. The joint can comprise up to 11 amino acids. The joint can comprise up to 4 amino acids.

[0184] In some embodiments, the linker is selected from the group including rigid, flexible and / or helix-forming linkers. It should be understood that a helix-forming linker can also be a rigid linker because an alpha-helix has a lower degree of freedom than a peptide that is considered to have a more random coil conformation. In some embodiments, the linker is a rigid linker. An exemplary rigid linker comprises the sequence shown in SEQ ID NO 20. Other exemplary rigid linkers comprise the sequence shown in SEQ ID NO 22 or SEQ ID NO 23. In related embodiments, the linker is a helix-forming linker. An exemplary helix-forming linker comprises the sequence shown in SEQ ID NO 22 or SEQ ID NO 23. In other embodiments, the linker is a flexible linker. An exemplary flexible linker comprises the sequence shown in SEQ ID NO 21, SEQ ID NO 24, SEQ ID NO 25, or SEQ ID NO 26.

[0185] The linker can also have different chemical properties. The linker can be selected from acidic, basic or neutral linkers. Typically, acidic linkers contain one or more acidic amino acids, such as Asp or Glu. Basic linkers typically contain one or more basic amino acids, such as Arg, His and Lys. Both types of amino acids are very hydrophilic. In some embodiments, the linker is an acidic linker. Exemplary acidic linkers include sequences shown in SEQ ID NO 22 or SEQ ID NO 23. In other embodiments, the linker is a basic linker. In other embodiments, the linker is a neutral linker. Exemplary neutral linkers include sequences shown in SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 24, SEQ ID NO 25 or SEQ ID NO 26.

[0186] In a preferred embodiment, the linker is a Gly-Ser or Gly-Ser-Thr linker consisting of a plurality of glycine, serine and, where applicable, threonine residues. In some of these embodiments, the linker comprises the amino acids glycine and serine. In a more specific embodiment, the linker comprises the sequence shown in SEQ ID NO 21, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26. In some embodiments, the linker further comprises the amino acid threonine. In a more specific embodiment, the linker comprises the sequence shown in SEQ ID NO 21.

[0187] In an exemplary embodiment of the present invention, the interferon-related antigen binding protein comprises a linker, wherein the linker comprises a sequence selected from the sequence shown in SEQ ID NO 20 to 26, preferably the sequence shown in SEQ ID NO 24, SEQ ID NO 25 or SEQ ID NO 26. In a preferred embodiment, the linker comprises the sequence shown in SEQ ID NO 24. In another preferred embodiment, the linker comprises the sequence shown in SEQ ID NO 25. In another preferred embodiment, the linker comprises the sequence shown in SEQ ID NO 26.

[0188] In various embodiments according to any one of the aspects of the invention, the interferon-related antigen binding protein does not comprise amino acids other than those forming (I) the agonist anti-CD40 antibody or agonist antigen-binding fragment thereof and (II) the IFN or a functional fragment thereof. In related embodiments, the interferon-related antigen binding protein does not comprise amino acids other than those forming (I) the agonist anti-CD40 antibody or agonist antigen-binding fragment thereof, (II) the IFN or a functional fragment thereof and (III) the linker.

[0189] Listed below are exemplary embodiments representing various different configurations of (I) an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof, (II) an interferon (IFN) or a functional fragment thereof, and (III) a linker.

[0190] In certain preferred embodiments, IFN or a functional fragment thereof is fused to the C-terminus of the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof via a linker, as shown in Table 3A or Table 3B. In these embodiments, the heavy chain of the agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof may comprise a sequence as shown in SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 12, SEQ ID NO 48, or SEQ ID NO 49. IFNα2a may comprise a sequence as shown in SEQ ID NO 17. IFNβ may comprise a sequence as shown in SEQ ID NO 14, SEQ ID NO 15, or SEQ ID NO 16. IFNβ may comprise a sequence as shown in SEQ ID NO 14. IFNβ_C17S may comprise a sequence as shown in SEQ ID NO 15. IFNβ_C17S,N80Q may comprise a sequence as shown in SEQ ID NO 16. IFNγ may comprise a sequence as shown in SEQ ID NO 19. IFNλ2 may comprise a sequence as shown in SEQ ID NO 18. IFNε may comprise the sequence shown in SEQ ID NO 61. IFNω may comprise the sequence shown in SEQ ID NO 60. The linkers mentioned are those listed in Table 7.

[0191] In embodiments where IFN is fused to the C-terminus of the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof, the interferon-related antigen-binding protein further comprises a light chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof. In more specific embodiments, the heavy chain comprises the sequence shown in SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 12, SEQ ID NO 48 or SEQ ID NO 49 and the light chain comprises the sequence shown in SEQ ID NO 3. Table 3. Interferons or functional fragments thereof fused to the C-terminus of the heavy chain of an anti-CD40 antibody or an agonistic antigen-binding fragment thereof.

[0192]

[0193]

[0194]

[0195] In certain preferred embodiments, IFN or a functional fragment thereof is fused to the N-terminus of the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof via a linker, as shown in Table 4A or Table 4B. In these embodiments, the heavy chain of the agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof may comprise the sequence shown in SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 12, SEQ ID NO 48, SEQ ID NO 49 or SEQ ID NO 50. IFNα2a may comprise the sequence shown in SEQ ID NO 17. IFNβ may comprise the sequence shown in SEQ ID NO 14, SEQ ID NO 15 or SEQ ID NO 16. IFNβ may comprise the sequence shown in SEQ ID NO 14. IFNβ_C17S may comprise the sequence shown in SEQ ID NO 15. IFNβ_C17S,N80Q may comprise the sequence shown in SEQ ID NO 16. IFNγ may comprise the sequence shown in SEQ ID NO 19. IFNλ2 may comprise the sequence shown in SEQ ID NO 18. IFNε may comprise the sequence shown in SEQ ID NO 61. IFNω may comprise the sequence shown in SEQ ID NO 60. The linkers mentioned are those listed in Table 7.

[0196] In embodiments where IFN is fused to the N-terminus of the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof, the interferon-related antigen-binding protein further comprises a light chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof. In more specific embodiments, the heavy chain comprises the sequence shown in SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 12, SEQ ID NO 48, SEQ ID NO 49 or SEQ ID NO 50 and the light chain comprises the sequence shown in SEQ ID NO 3.

[0197] Table 4. Interferons or functional fragments thereof fused to the N-terminus of the heavy chain of an anti-CD40 antibody or agonistic antigen-binding fragment thereof.

[0198]

[0199]

[0200]

[0201] In certain preferred embodiments, IFN is fused to the C-terminus of the light chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof via a linker, as shown in Table 5A or Table 5B. In these embodiments, the light chain of the agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof may comprise the sequence shown in SEQ ID NO 3. IFNα2a may comprise the sequence shown in SEQ ID NO 17. IFNβ may comprise the sequence shown in SEQ ID NO 14, SEQ ID NO 15, or SEQ ID NO 16. IFNβ may comprise the sequence shown in SEQ ID NO 14. IFNβ_C17S may comprise the sequence shown in SEQ ID NO 15. IFNβ_C17S,N80Q may comprise the sequence shown in SEQ ID NO 16. IFNγ may comprise the sequence shown in SEQ ID NO 19. IFNλ2 may comprise the sequence shown in SEQ ID NO 18. IFNε may comprise the sequence shown in SEQ ID NO 61. IFNω may comprise the sequence shown in SEQ ID NO 60. The linkers mentioned are those listed in Table 7.

[0202] In embodiments where IFN is fused to the C-terminus of the light chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof, the interferon-related antigen-binding protein further comprises the heavy chain of the agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof. In more specific embodiments, the light chain comprises the sequence shown in SEQ ID NO 3 and the heavy chain comprises the sequence shown in SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 49, SEQ ID NO 48, SEQ ID NO 50 or SEQ ID NO 12.

[0203] Table 5. Interferons or functional fragments thereof fused to the C-terminus of the light chain of an anti-CD40 antibody or agonist antigen-binding fragment thereof.

[0204]

[0205]

[0206] In certain preferred embodiments, IFN is fused to the N-terminus of the light chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof via a linker, as shown in Table 6A or Table 6B. In these embodiments, the light chain of the agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof may comprise the sequence shown in SEQ ID NO 3. IFNα2a may comprise the sequence shown in SEQ ID NO 17. IFNβ may comprise the sequence shown in SEQ ID NO 14, SEQ ID NO 15, or SEQ ID NO 16. IFNβ may comprise the sequence shown in SEQ ID NO 14. IFNβ_C17S may comprise the sequence shown in SEQ ID NO 15. IFNβ_C17S,N80Q may comprise the sequence shown in SEQ ID NO 16. IFNγ may comprise the sequence shown in SEQ ID NO 19. IFNλ2 may comprise the sequence shown in SEQ ID NO 18. IFNε may comprise the sequence shown in SEQ ID NO 61. IFNω may comprise the sequence shown in SEQ ID NO 60. The linkers mentioned are those listed in Table 7.

[0207] In embodiments where IFN is fused to the N-terminus of the light chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof, the interferon-related antigen-binding protein further comprises the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof. In more specific embodiments, the light chain comprises the sequence shown in SEQ ID NO 3 and the heavy chain comprises the sequence shown in SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 49, SEQ ID NO 48, SEQ ID NO 12, or SEQ ID NO 50.

[0208] Table 6. Interferons or functional fragments thereof fused to the N-terminus of the light chain of an anti-CD40 antibody or agonist antigen-binding fragment thereof.

[0209]

[0210]

[0211]

[0212] Table 7 lists exemplary sequences contained in the interferon-related antigen binding proteins or their precursors of the present invention.

[0213] In an exemplary preferred embodiment, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist antigen binding fragment thereof fused to an interferon containing a sequence selected from SEQ ID NOs 28-47. In other exemplary embodiments, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist antigen binding fragment thereof fused to an interferon containing a sequence selected from SEQ ID NOs 62-69. In an exemplary preferred embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist antigen binding fragment thereof fused to an interferon containing a sequence selected from SEQ ID NOs 28-47. In other exemplary embodiments, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist antigen binding fragment thereof fused to an interferon containing a sequence selected from SEQ ID NOs 62-69.

[0214] In certain exemplary embodiments, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 62. In another exemplary embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 62.

[0215] In certain exemplary embodiments, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 63. In another exemplary embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 63.

[0216] In certain exemplary embodiments, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 64. In another exemplary embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 64.

[0217] In certain exemplary embodiments, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 65. In another exemplary embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 65.

[0218] In certain exemplary embodiments, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 66. In another exemplary embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 66.

[0219] In certain exemplary embodiments, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 67. In another exemplary embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 67.

[0220] In certain exemplary embodiments, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 68. In another exemplary embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 68.

[0221] In certain exemplary embodiments, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 69. In another exemplary embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 69.

[0222] In a more preferred embodiment, the interferon-related antigen binding protein comprises an interferon-fused agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof containing a sequence selected from SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, or SEQ ID NO 43. In a more preferred embodiment, the interferon-related antigen binding protein is an interferon-fused agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof containing a sequence selected from SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, or SEQ ID NO 43.

[0223] In a more preferred embodiment, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 38. In another more preferred embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 38.

[0224] In another more preferred embodiment, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 39. In another more preferred embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 39.

[0225] In another more preferred embodiment, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 40. In another more preferred embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 40.

[0226] In another more preferred embodiment, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 41. In another more preferred embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 41.

[0227] In another more preferred embodiment, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 42. In another more preferred embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 42.

[0228] In another more preferred embodiment, the interferon-related antigen binding protein comprises an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 43. In another more preferred embodiment, the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist binding fragment thereof fused to an interferon containing the sequence shown in SEQ ID NO 43.

[0229] Table 7. Sequences of exemplary interferon-related antigen binding proteins and components thereof based on anti-CD40 antibody CP870,893. Italic sequences correspond to signal peptides. Bold italic sequences in SEQ ID NOs 3 and 6 correspond to CDR regions. Bold non-italic sequences correspond to linkers. Mutated amino acids are underlined.

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240]

[0241]

[0242] In a preferred embodiment, the interferon-related antigen binding protein described herein is an interferon-fused antigen binding protein comprising a polypeptide derived from Table 8 below, specifically Table 8A or Table 8B, more specifically those specified in Table 8A, and specifically derived from the polypeptides shown in SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42 or SEQ ID NO 43 above. In a preferred embodiment, the interferon-related antigen binding protein described herein is an interferon-fused antigen binding protein consisting of a polypeptide derived from Table 8 below, specifically Table 8A or Table 8B, more specifically those specified in Table 8A, and specifically derived from the polypeptides shown in SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42 or SEQ ID NO 43 above. In a more preferred embodiment, the interferon-fused antibody comprises the sequences shown in SEQ ID NO 38 and SEQ ID NO 3. In other more preferred embodiments, the interferon-fused antibody comprises the sequence shown in SEQ ID NO 39 and SEQ ID NO 3. In other more preferred embodiments, the interferon-fused antibody comprises the sequence shown in SEQ ID NO 40 and SEQ ID NO 3. In other more preferred embodiments, the interferon-fused antibody comprises the sequence shown in SEQ ID NO 41 and SEQ ID NO 9. In other more preferred embodiments, the interferon-fused antibody comprises the sequence shown in SEQ ID NO 42 and SEQ ID NO 9. In other more preferred embodiments, the interferon-fused antibody comprises the sequence shown in SEQ ID NO 43 and SEQ ID NO 9.

[0243] Table 8. The average EC values ​​of the polypeptide combinations present in the preferred interferon-fused antigen binding proteins of the present invention with respect to the activation of CD40 and IFN-pathways 50 Values ​​and their productivity (ie yield per liter of culture). Each sequence combination as indicated was included twice in the respective IFA. SN: supernatant.

[0244] A

[0245]

[0246]

[0247] B

[0248]

[0249] Nucleic Acids and Expression Vectors

[0250] In one aspect, a combination of polynucleotides encoding interferon-related antigen binding proteins is provided. Also provided is a method of preparing an interferon-related antigen binding protein, which comprises expressing these polynucleotides.

[0251] In some embodiments, a nucleic acid encoding an IFN or a functional fragment thereof fused to an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof as disclosed herein is provided. In certain exemplary embodiments, the nucleic acid encodes an IFN or a functional fragment thereof fused to an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof according to any of the sequences shown in SEQ ID NOs 62 to 69, or a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity with a nucleic acid encoding any of these sequences. In certain exemplary embodiments, the nucleic acid has at least 95%, at least 98% or at least 99% identity with a nucleic acid encoding any of SEQ ID NOs 62 to 69. In a preferred embodiment, the nucleic acid encodes an IFN or a functional fragment thereof fused to an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof according to any of the sequences shown in SEQ ID NOs 28 to 47, or a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to a nucleic acid encoding any of these sequences. In a more specific embodiment, the nucleic acid has at least 95%, at least 98% or at least 99% identity to a nucleic acid encoding any of SEQ ID NOs 28 to 47.

[0252] In those embodiments in which the nucleic acid encodes an IFN or a functional fragment thereof fused to the light chain of an agonistic anti-CD40 antibody or agonistic antigen-binding fragment thereof, the nucleic acid may also encode the heavy chain of the agonistic anti-CD40 antibody or agonistic antigen-binding fragment thereof. In more specific embodiments, the heavy chain of the agonistic anti-CD40 antibody or agonistic antigen-binding fragment thereof comprises the sequence shown in SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 48, SEQ ID NO 49 or SEQ ID NO 50, or a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to a nucleic acid encoding any of these sequences. In a more specific embodiment, the nucleic acid is at least 95%, at least 98% or at least 99% identical to the nucleic acid encoding SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 48, SEQ ID NO 49 or SEQ ID NO 50.

[0253] In those embodiments in which the nucleic acid encodes an IFN or a functional fragment thereof fused to the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof, the nucleic acid may also encode the light chain of the agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof. In more specific embodiments, the light chain of the agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof comprises the sequence shown in SEQ ID NO 3, SEQ ID NO 4, or SEQ ID NO 5, or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to a nucleic acid encoding any of these sequences. In more specific embodiments, the nucleic acid is at least 95%, at least 98%, or at least 99% identical to a nucleic acid encoding SEQ ID NO 3, SEQ ID NO 4, or SEQ ID NO 5.

[0254] In certain embodiments, the nucleic acids described herein may comprise sequences encoding sequences that increase yield (e.g., solubility tags) or facilitate purification of the expressed protein (i.e., purification tags). Purification tags are known to those skilled in the art and may be selected from glutathione S-transferase (GST) tags, maltose binding protein (MBP) tags, calmodulin binding peptide (CBP) tags, intein-chitin binding domain (intein-CBD) tags, streptavidin / biotinyl tags (e.g., biotinylated signal peptide (BCCP) tags), streptavidin-binding peptide (SBP) tags, His-patch ThioFusion tags, tandem affinity purification (TAP) tags, small ubiquitin-like modulator (SUMO) tags, (Promega), Profinity eXact TM System (Bio-Rad). In some embodiments, the purification tag can be a polyhistidine tag (e.g., His6-, His7-, His8-, His9-, or His 10 - tag). In other embodiments, the purification tag can be a Strep-tag (e.g., Strep- or Strep-tag IBA LifeSciences). In other embodiments, the purification tag can be a maltose binding protein (MBP) tag.

[0255] In some embodiments, the nucleic acid sequence may also include a sequence encoding a cleavage site for removing a purification tag. These cleavage sequences are known to those skilled in the art and may be selected from sequences recognized and cleaved by endoproteases or exoproteases. In some embodiments, the endoprotease for removing the purification tag may be selected from: enteropeptidase, thrombin, factor Xa, TEV protease or rhinovirus 3C protease. In some embodiments, the exoprotease for removing the purification tag may be selected from: carboxypeptidase A, carboxypeptidase B or DAP enzyme. In a preferred embodiment, the protease for removing the purification tag is TEV protease. In a more specific preferred embodiment, the nucleic acid includes a sequence encoding a His6-tag and a TEV cleavage site. In a more specific preferred embodiment, the nucleic acid includes a sequence encoding the sequence shown in SEQ ID NO 27.

[0256] Nucleic acid molecules of the present invention can also include sequences encoding signal peptides. Technicians know that multiple signal peptides are available for directing the expressed protein to the desired folding site, assembly and / or maturation and causing secretion of the final protein into the culture medium to assist downstream processes. Therefore, in some embodiments, the signal peptide is a secretory signal peptide. The encoded signal peptide can include the sequence shown in SEQ ID NO:1 or SEQ ID NO:2. In some embodiments, the signal peptide includes the sequence shown in SEQ ID NO:1. In other embodiments, the signal peptide includes the sequence shown in SEQ ID NO:2.

[0257] Signal peptide 1 (SEQ ID NO 1) is used for the synthesis of polypeptide sequences as shown below: SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46, SEQ ID NO 47 or SEQ ID NO 50. These signal peptides, initially present at the N-terminus of the respective polypeptide sequence, are cleaved during the synthesis.

[0258] Signal peptide 2 (SEQ ID NO 2) was used for the synthesis of the polypeptide sequences shown in SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42 and SEQ ID NO 43. These signal peptides initially present at the N-terminus of the corresponding polypeptide sequence are cleaved during the synthesis.

[0259] For the synthesis of the polypeptide sequences shown in SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 65, SEQ ID NO 66, SEQ ID NO 67, SEQ ID NO 68 and SEQ ID NO 69, the signal peptide MGWSCIILFLVATATGVHS (SEQ ID NO 1) was used. These signal peptides, initially present at the N-terminus of the respective polypeptide sequence, are cleaved during the synthesis.

[0260] Typically, a polynucleotide encoding an IFN or a functional fragment thereof fused to an agonistic anti-CD40 antibody or agonistic antigen-binding fragment thereof as disclosed herein is inserted into an expression vector for introduction into a host cell that can be used to produce the desired amount of the claimed interferon-related antigen-binding protein. Therefore, in certain aspects, the present invention provides expression vectors comprising the polynucleotides disclosed herein and host cells comprising these vectors and polynucleotides.

[0261] In this article, the term "vector" or "expression vector" is used for the purpose of the specification and claims to refer to the vector used according to the present invention as a vehicle for introducing and expressing a desired gene in a cell. As known to those skilled in the art, these vectors can be easily selected from the group consisting of plasmids, phages, viruses and retroviruses. Generally, vectors compatible with the present invention will contain a selection marker, suitable restriction sites to facilitate cloning of the desired gene and the ability to enter and / or replicate in eukaryotic or prokaryotic cells.

[0262] A variety of expression vector systems can be used for purposes of the present invention. For example, a class of vectors utilize DNA elements derived from animal viruses, such as bovine papilloma virus, polyoma virus, adenovirus, vaccinia virus, baculovirus, retrovirus (RSV, MMTV or MOMLV) or SV40 virus. Others include the use of polycistronic systems with internal ribosome binding sites. In addition, the cells that have been integrated into their chromosomes by DNA can be selected by introducing one or more markers of the host cell that allows selection of transfection. Markers can provide prototrophy for auxotrophic hosts, provide biocide tolerance (for example, antibiotics) or to heavy metals, such as copper tolerance. Selectable marker genes can be directly connected to the DNA sequence to be expressed, or introduced into the same cell by co-transformation. For the optimal synthesis of mRNA, other elements can also be needed. These elements can include signal sequence, splicing signal and transcription promoter, enhancer and termination signal. In some embodiments, cloned variable region genes (one of which is fused to a gene encoding IFN or a functional fragment thereof) are inserted into an expression vector together with synthetic heavy and light chain constant region genes (eg, human genes) as discussed above.

[0263] In other embodiments, the vector system of the present invention may comprise more than one vector. In some embodiments, the vector system may comprise a first vector for the expression of an IFN or a functional fragment thereof fused to the light chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof and a second vector for the expression of a heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof. Alternatively, such a vector system may comprise a first vector for the expression of an IFN or a functional fragment thereof fused to the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof and a second vector for the expression of a light chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof.

[0264] In other embodiments, polycistronic constructs can be used to express interferon-related antigen-binding proteins as described herein. In these expression systems, multi-gene products of interest can be produced from a single polycistronic construct, such as those encoding IFN or its functional fragment fused to the heavy chain of an agonistic anti-CD40 antibody or its agonistic antigen-binding fragment and encoding the light chain of the antibody, or those encoding IFN or its functional fragment fused to the light chain of an agonistic anti-CD40 antibody or its agonistic antigen-binding fragment and encoding the heavy chain of the antibody or its agonistic antigen-binding fragment. These systems advantageously use an internal ribosome entry site (IRES) to provide relatively high levels of polypeptides in eukaryotic host cells. Compatible IRES sequences are disclosed in U.S. Patent No. 6,193,980, which is incorporated herein by reference. Those skilled in the art will appreciate that these expression systems can be used to effectively produce the complete range of polypeptides disclosed in this application.

[0265] More generally, once the vector or DNA sequence encoding the interferon-related antigen-binding protein of the present invention is prepared, the expression vector can be introduced into a suitable host cell. That is, the host cell can be transformed. The introduction of plasmids into host cells can be completed by a variety of techniques well known to those skilled in the art. These include but are not limited to transfection (including electrophoresis and electroporation), protoplast fusion, calcium phosphate precipitation, fusion of cells and envelope DNA, microinjection, and infection with complete viruses. See, for example, Ridgway, AAG "Mammalian Expression Vectors" Chapter 24.2, Pages 470-472, Vectors, Rodriguez and Denhardt (Butterworths, Boston, MA 1988). The transformed cells are grown under conditions suitable for producing light and heavy chains, and the heavy and / or light chain protein synthesis is measured. Exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) or fluorescence-activated cell sorting analysis (FACS), immunohistochemistry, etc.

[0266] As used herein, the term "transformation" should be used in a broad sense to refer to the introduction of DNA into a recipient host cell, which changes the genotype of the recipient cell and thereby results in a change in the recipient cell.

[0267] Along the same lines, "host cell" means a cell transformed with a vector constructed using recombinant DNA technology and encoding at least one heterologous gene. Unless explicitly stated, in the description of the method for isolating polypeptides from a recombinant host, the terms "cell" and "cell culture" are used interchangeably to represent the source of interferon-related antigen-binding proteins. In other words, recovering polypeptides from "cells" can mean recovering intact cells from a spun pellet or from a cell culture containing both culture medium and suspended cells.

[0268] In one embodiment, the host cell line for the expression of interferon-related antigen-binding proteins is of eukaryotic or prokaryotic origin. As used herein, the term "expression" may include transcription and translation of more than one polypeptide chain (such as the heavy chain and light chain of the antibody portion of the interferon-related antigen-binding proteins), which combine to form the final interferon-related antigen-binding proteins. In one embodiment, the host cell line for the expression of interferon-related antigen-binding proteins is of bacterial origin. In one embodiment, the host cell line for the expression of interferon-related antigen-binding proteins is of mammalian origin; those skilled in the art can determine the specific host cell line most suitable for expressing the desired gene product therein. Exemplary host cell lines include, but are not limited to, CHO K1 GS knockout cell lines from Horizon, DG44 and DUXB11 (Chinese hamster ovary cell lines, DHFR minus), HELA (human cervical carcinoma), CVI (monkey kidney cell line), COS (derivative of CVI with SV40 T antigen), R1610 (Chinese hamster fibroblasts), BALBC / 3T3 (mouse fibroblasts), HAK (hamster kidney cell line), SP2 / O (mouse myeloma), BFA-1c1BPT (bovine endothelial cells), RAJI (human lymphocytes), HEK 293 (human kidney). In a preferred embodiment, HEK FS S11 / 254 cells can be used. In another preferred embodiment, CHO K1 GS from Horizon can be used. In one embodiment, the cell line provides for altered glycosylation of the antibody expressed thereby, for example, fucosylation (e.g., (Crucell) or FUT8-knock-out CHO cell line (POTELLIGENT TM Cells) (Biowa, Princeton, NJ). In one embodiment, NSO cells can be used. Host cell lines are generally available from commercial services, the American Tissue Culture Collection, or published literature.

[0269] In one embodiment, the host for expression of the interferon-related antigen binding protein is a non-human transgenic animal or a transgenic plant.

[0270] The interferon-related antigen binding proteins of the present invention can also be produced by transgenic non-human animals (e.g., mammals) or plants that are transgenic for the sequence of interest and thereby produce interferon-related antigen binding proteins in a recyclable form. In conjunction with transgenic production in mammals, interferon-related antigen binding proteins can be produced and recovered in the milk of goats, cattle or other mammals. See, for example, U.S. Patent Nos. 5,827,690, 5,756,687, 5,750,172 and 5,741,957. Exemplary plant hosts are tobacco, Arabidopsis, duckweed, corn, wheat, potatoes, etc. For methods of expressing antibodies in plants, descriptions including promoters and vectors and plant transformation are known in the art. See, for example, U.S. Patent No. 6,517,529, which is incorporated herein by reference. In some embodiments, non-human transgenic animals or plants are produced by introducing one or more nucleic acid molecules encoding the interferon-related antigen binding proteins of the present invention into animals or plants using standard transgenic technology. See Hogan and U.S. Patent No. 6,417,429. Transgenic cells used to prepare transgenic animals can be embryonic stem cells or somatic cells. Transgenic non-human organisms can be chimeric, non-chimeric heterozygotes and non-chimeric homozygotes. See, for example, Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual 2nd Edition, Cold Spring Harbor Press (1999); Jackson et al., Mouse Genetics and Transgenics: A Practical Approach, Oxford University Press (2000); and Pinkert, Transgenic Animal Technology: A Laboratory Handbook, Academic Press (1999). In some embodiments, transgenic non-human animals have targeted disruption and replacement by targeting constructs encoding sequences of interest. Interferon-related antigen-binding proteins can be prepared in any transgenic animal. In a preferred embodiment, the non-human animal is a mouse, rat, sheep, pig, goat, cattle or horse. Non-human transgenic animals express the interferon-related antigen-binding proteins in blood, milk, urine, saliva, tears, mucus and other body fluids.

[0271] In vitro production allows amplification to provide a large amount of desired interferon-associated antigen-binding proteins. The technology used for mammalian cell culture under tissue culture conditions is known in the art and includes uniform suspension culture, for example, in an airlift reactor or in a continuous stirred reactor, or immobilized or embedded cell culture, for example, in hollow fibers, microcapsules, on agarose microbeads or ceramic columns. If necessary and / or if desired, conventional chromatographic methods can be used, for example, gel filtration, ion exchange chromatography, chromatography on DEAE-cellulose and / or (immunity) affinity chromatography to purify the solution of interferon-associated antigen-binding proteins.

[0272] One or more genes encoding interferon-related antigen binding proteins can also be expressed in non-mammalian cells, such as bacteria or yeast or plant cells. In this regard, it will be understood that a variety of unicellular non-mammalian microorganisms, such as bacteria, can also be transformed; that is, those that can grow in culture or fermentation. Bacteria susceptible to transformation include members of the Enterobacteriaceae family, such as strains of Escherichia coli or Salmonella; Bacillaceae, such as Bacillus subtilis; Pneumococcus; Streptococcus and Haemophilus influenzae. It will also be understood that when expressed in bacteria, the interferon-related antigen binding protein or its components according to the present invention (i.e., agonistic anti-CD40 antibodies or agonistic antigen binding fragments thereof and IFN or functional fragments of IFN) can become part of inclusion bodies. Then, it may be necessary to separate, optionally also refold and purify the desired interferon-related antigen binding protein.

[0273] In addition to prokaryotes, eukaryotic microorganisms can also be used. Saccharomyces cerevisiae or common baker's yeast is the most commonly used in eukaryotic microorganisms, although some other strains are generally available. For expression in yeast (Saccharomyces), for example, plasmid YRp7 (Stinchcomb et al., Nature, 282: 39 (1979); Kingsman et al., Gene, 7: 141 (1979); Tschemper et al., Gene, 10: 157 (1980)) is commonly used. This plasmid already contains the TRP1 gene, which provides a selection marker for yeast mutants lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4-1 (Jones, Genetics, 85: 12 (1977)). Then, the presence of the trp1 lesion, which is a characteristic of the yeast host cell genome, provides an effective environment for detecting transformation by growth in the absence of tryptophan.

[0274] Therapeutic vector

[0275] The nucleic acid sequence encoding the interferon-related antigen-binding protein can be inserted into a vector and used as a therapeutic vector, for example, a vector expressing the interferon-related antigen-binding protein of the present invention. The construction of suitable functional expression constructs and therapeutic expression vectors is known to those skilled in the art. Therefore, in some embodiments, the interferon-related antigen-binding protein can be administered to a subject by gene delivery using RNA or DNA sequences, vectors or vector systems encoding the interferon-related antigen-binding protein.

[0276] The therapeutic vector can be delivered to a subject by, for example, intravenous injection, topical administration (see U.S. Pat. No. 5,328,470), or by stereotactic injection (see, e.g., Chen et al., PNAS 91:3054-3057 (1994)). Pharmaceutical preparations of the therapeutic vector can include the vector in an acceptable diluent.

[0277] One or more interferon-related antigen binding protein encoding nucleic acids can be introduced into a genetic construct for use as part of a therapy regimen to deliver nucleic acids encoding interferon-related antigen binding proteins. Expression vectors for in vivo transfection and expression of interferon-related antigen binding proteins are provided.

[0278] As known to those skilled in the art, expression constructs of these components can be administered in any biologically effective vector, for example, any formulation or composition capable of effectively delivering the constituent nucleic acid sequences to cells in vivo. Methods include, but are not limited to, insertion of the subject nucleic acid sequence into a viral vector, including, but not limited to, recombinant retroviruses, adenoviruses, adeno-associated viruses, and herpes simplex virus-1, recombinant bacteria or eukaryotic plasmids, and the like.

[0279] Retroviral vectors and adeno-associated virus vectors can be used as recombinant delivery systems for in vivo transfer of exogenous nucleic acid sequences, particularly to humans. These vectors provide efficient delivery of genes to cells, and the transferred nucleic acids can be stably integrated into the host's chromosomal DNA.

[0280] The development of specialized cell lines (called "packaging cells") that produce only replication-defective retroviruses has increased the use of retroviruses for gene therapy, and defective retroviruses are characterized by use in gene transfer for gene therapy purposes (for review, see, e.g., Miller, Blood 76: 271-78 (1990)). Replication-defective retroviruses can be packaged into viral particles, which can infect target cells by standard techniques using helper viruses. Procedures for producing recombinant retroviruses and using these viruses to infect cells in vitro or in vivo can be found in Current Protocols in Molecular Biology, Ausubel et al. (eds.) Greene Publishing Associates, (1989), sections 9.10-9.14, and other standard laboratory manuals. Non-limiting examples of suitable retroviruses include pLJ, pZIP, pWE, and pEM, which are known to those skilled in the art. Examples of suitable packaging virus lines include *Crip, *Cre, *2, and *Am.(See, e.g., Eglitis et al., Science 230:1395-1398 (1985); Danos and Mulligan, Proc. Natl. Acad. Sci. USA 85:6460-6464 (1988); Wilson et al., Proc. Natl. Acad. Sci. USA 85:3014-3018 (1988); Armentano et al., Proc. Natl. Acad. Sci. USA 87:6141-6145 (1990); Huber et al., Proc. Natl. Acad. Sci. USA 88:8039-8043 (1991); Ferry et al., Proc. Natl. Acad. Sci. USA 88:8377-8381 (1991); Chowdhury et al., Science 231:1395-1398 (1985); Danos and Mulligan, Proc. Natl. Acad. Sci. USA 85:6460-6464 (1988); Wilson et al., Proc. Natl. Acad. Sci. USA 85:3014-3018 (1988); Armentano et al., Proc. Natl. Acad. Sci. USA 87:6141-6145 (1990); Huber et al., Proc. Natl. Acad. Sci. USA 88:8039-8043 (1991); Ferry et al., Proc. Natl. Acad. Sci. USA 88:8377-8381 (1991); Chowdhury et al., Science 232:1395-1398 (1985); 254:1802-1805 (1991); van Beusechem et al., Proc. Natl. Acad. Sci. USA 89:7640-7644 (1992); Kay et al., Human Gene Therapy 3:641-647 (1992); Dai et al., Proc. Natl. Acad. Sci. USA 89:10892-10895 (1992); Hwu et al., J. Immunol. 150:4104-4115 (1993); U.S. Pat. No. 4,868,116; U.S. Pat. No. 4,980,286; PCT Application WO 89 / 07136; PCT Application WO 89 / 02468; PCT Application WO 89 / 05345; and PCT Application WO 92 / 07573).

[0281] In another embodiment, a delivery vector of adenovirus origin is provided. The adenovirus genome can be manipulated so that it encodes and expresses the gene product of interest, but is inactivated with respect to its ability to replicate in the normal lytic virus life cycle. See, for example, Berkner et al., BioTechniques 6:616 (1988); Rosenfeld et al., Science 252:431-434 (1991); and Rosenfeld et al., Cell 68:143-155 (1992). Suitable adenovirus vectors derived from adenovirus strain Ad 5 type d1324 or other adenovirus strains (e.g., Ad2, Ad3, Ad7, etc.) are known to those skilled in the art. In some cases, recombinant adenoviruses can be advantageous in that they are unable to infect non-dividing cells and can be used to infect a variety of cell types, including epithelial cells (Rosenfeld et al., (1992), supra). In addition, viral particles are relatively stable and can be purified and concentrated, and as described above, can be altered to affect the infectivity spectrum. In addition, the introduced adenoviral DNA (and the foreign DNA contained therein) cannot be integrated into the host cell genome, but remains episomal, thereby avoiding potential problems caused by in situ insertional mutagenesis in which the introduced DNA is integrated into the host genome (e.g., retroviral DNA). In addition, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other delivery vectors (Berkner et al., (1998), supra; Haj-Ahmand and Graham, J. Virol. 57:267 (1986)).

[0282] Another viral vector system for the delivery of nucleic acid sequences encoding interferon-related antigen-binding proteins is adenovirus-associated virus (AAV). AAV is a naturally occurring defective virus that requires another virus, such as adenovirus or herpes virus, as a helper virus for effective replication and productive life cycle. (For review, see Muzyczka et al., Curr. Topics in Micro. and Immunol. 158: 97-129 (1992)). It is also one of the few viruses that can integrate its DNA into non-dividing cells, and shows a high stable integration frequency (see, for example, Flotte et al., Am. J. Respir. Cell. Mol. Biol. 7: 349-356 (1992); Samulski et al., J. Virol. 63: 3822-3828 (1989); and McLaughlin et al., J. Virol. 62: 1963-1973 (1989)). A vector containing as few as 300 base pairs of AAV can be packaged and it can be integrated. The space of exogenous DNA is limited to about 4.5 kb. AAV vectors, such as those described in Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985), can be used to introduce DNA into cells. AAV vectors have been used to introduce a variety of nucleic acids into different cell types (see, e.g., Hermonat et al., Proc. Natl. Acad. Sci. USA 81:6466-6470 (1984); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1985); Wondisford et al., Mol. Endocrinol. 2:32-39 (1988); Tratschin et al., J. Virol. 51:611-619 (1984); and Flotte et al., J. Biol. Chem. 268:3781-3790 (1993)).

[0283] In addition to viral transfer methods, non-viral methods can also be used to cause expression of nucleic acid sequences encoding interferon-related antigen binding proteins in subject tissues. Most non-viral methods of gene transfer rely on the normal mechanisms of mammalian cells for absorbing and intracellular transport of macromolecules. In some embodiments, non-viral delivery systems rely on the endocytic pathways of target cells to absorb the subject gene. Exemplary delivery systems of this type include liposome-derived systems, polylysine conjugates, and artificial viral envelopes. Other embodiments include plasmid injection systems, such as Meuli et al., J. Invest. Dermatol. 116 (1): 131-135 (2001); Cohen et al., Gene Ther 7 (22): 1896-905 (2000); or Tam et al., Gene Ther. 7 (21): 1867-74 (2000) described.

[0284] In clinical settings, delivery systems can be introduced into subjects by any of a number of methods, and each method is common in the art. For example, the whole body, for example, can be introduced into the pharmaceutical preparation of the delivery system by intravenous injection. The specific transduction of protein in target cells occurs mainly due to the transfection specificity provided by the delivery vehicle, the cell type or tissue type expression or their combination caused by the transcriptional regulatory sequence for controlling receptor gene expression. In other embodiments, due to the introduction into animals in a relatively small range, the initial delivery of recombinant genes is more limited. For example, delivery vehicles can be introduced by catheter (see, U.S. Patent number 5,328,470) or by stereotactic injection (e.g., Chen et al., PNAS 91:3054-3057 (1994)).

[0285] The pharmaceutical preparation of the therapeutic construct can consist essentially of the delivery system in an available diluent or can comprise a slow-release matrix in which the delivery vehicle is embedded. Alternatively, when the entire delivery system can be produced intact from recombinant cells, e.g., a retroviral vector, the pharmaceutical preparation can comprise one or more cells that produce the delivery system.

[0286] Treatment

[0287] In one aspect, as disclosed herein, the present invention provides a method for treating a patient in need thereof (e.g., a patient infected with HBV), comprising administering an effective amount of an interferon-associated antigen binding protein or a nucleic acid sequence (e.g., mRNA) encoding an interferon-associated antigen binding protein. As disclosed herein, the present invention also provides the use of interferon-associated antigen binding proteins or nucleic acid sequences (e.g., mRNA) encoding interferon-associated antigen binding proteins in drug preparation. More specifically, as disclosed herein, the present invention provides interferon-associated antigen binding proteins or nucleic acid sequences (e.g., mRNA) encoding interferon-associated antigen binding proteins for the preparation of drugs for treating illnesses and / or symptoms, e.g., HBV-associated illnesses and / or HBV-associated symptoms. In certain embodiments, the present invention provides kits and methods for treating illnesses and / or symptoms in mammalian subjects requiring such treatment, e.g., HBV-associated illnesses and / or HBV-associated symptoms. In certain exemplary embodiments, the subject is a human.

[0288] The interferon-related antigen binding proteins of the present invention or the nucleic acid sequences encoding them are useful in some different applications. For example, in one embodiment, the subject interferon-related antigen binding proteins or the nucleic acid sequences encoding them are useful in reducing the release of HBeAg from HBV-infected cells. In some embodiments, the interferon-related antigen binding proteins of the present invention reduce the in vitro HBeAg release of primary hepatocytes by at least 10% at 1 ng / mL, by at least 20% at 1 ng / mL, by at least 30% at 1 ng / mL, by at least 40% at 1 ng / mL, by at least 50% at 1 ng / mL, by at least 60% at 1 ng / mL, by at least 70% at 1 ng / mL, by at least 80% at 1 ng / mL, or by at least 85% at 1 ng / mL. In some embodiments, the interferon-related antigen binding proteins of the present invention reduce the in vitro HBeAg release of primary hepatocytes by at least 12% at 1 ng / mL. In some embodiments, the interferon-related antigen binding proteins of the present invention reduce the in vitro HBeAg release of primary hepatocytes by up to 90% at 1 ng / mL. In a related embodiment, the interferon-related antigen binding protein is present at an EC of less than 30 ng / mL. 50 , preferably with an EC of less than 10 ng / mL 50 , more preferably with an EC of less than 1 ng / mL 50 Reduce HBeAg release.

[0289] In another embodiment, the subject interferon-related antigen binding proteins or nucleic acid sequences encoding them are useful for reducing pgRNA transcription of cccDNA in HBV-infected cells.

[0290] In another embodiment, the subject interferon-related antigen binding proteins or nucleic acid sequences encoding them are useful for reducing one or more symptoms and / or complications associated with HBV infection, as described herein (below).

[0291] In certain embodiments, the subject interferon-related antigen binding proteins or nucleic acid sequences encoding them are useful for reducing one or more conditions, symptoms and / or complications associated with chronic HBV infection, for example, chronic inflammation of the liver (chronic hepatitis), which leads to cirrhosis within a few years; hepatocellular carcinoma (HCC); the emergence of membranous glomerulonephritis (MGN); risk of death; acute necrotizing vasculitis (polyarteritis nodosa), membranous glomerulonephritis and childhood papuloacrodermatitis (Chiko's syndrome); HBV-related renal disease (e.g., membranous glomerulonephritis); immune-mediated hematological disorders (e.g., idiopathic mixed cryoglobulinemia, aplastic anemia), etc.

[0292] In certain embodiments, the subject interferon-related antigen binding proteins or nucleic acid sequences encoding them are useful for reducing one or more symptoms and / or complications associated with acute HBV infection, for example, acute viral hepatitis (which begins with general discomfort, loss of appetite, nausea, vomiting, body pain, mild fever and dark yellow urine, and then develops jaundice, fulminant hepatic failure and / or serum-disease-like syndrome); loss of appetite; joint and muscle pain; mild fever; stomach pain; nausea; vomiting; jaundice; bloating, etc.

[0293] Therefore, the present invention also relates to a method for treating one or more conditions, symptoms and / or complications associated with HBV infection in humans or other animals by administering an effective, non-toxic amount of interferon-related antigen binding proteins or nucleic acid sequences encoding them to these humans or animals. Those skilled in the art will be able to determine the effective, non-toxic amount of interferon-related antigen binding proteins or nucleic acid sequences encoding them for the purpose of treating HBV infection by routine experiments.

[0294] For example, the "therapeutically active amount" of the interferon-related antigen binding protein of the present invention can be changed according to factors such as disease stage (e.g., acute vs. chronic), age, sex, medical complications (e.g., HIV co-infection, immunosuppressive conditions or diseases) and subject weight, as well as the ability of the interferon-related antigen binding protein to elicit the desired response in the subject. The dosage regimen can be adjusted to provide the optimal therapeutic response. For example, several divided doses can be administered daily, or the dosage can be proportionally reduced as indicated by the urgency of the treatment situation.

[0295] Generally, the compositions provided by the present invention can be used to prophylactically treat non-infected cells or therapeutically treat any HBV-infected cells containing antigenic markers that allow targeting of HBV-infected cells by interferon-related antigen binding proteins.

[0296] Pharmaceutical compositions and their administration

[0297] In certain embodiments, the interferon-related antigen binding proteins of the present invention or nucleic acid sequences encoding them (including vectors or vector systems) are included in the pharmaceutical composition. The method of preparing and administering the interferon-related antigen binding proteins of the present invention or nucleic acid sequences encoding them to the subject is well known to those skilled in the art or can be easily determined using this specification and the knowledge in the art as a guide. The route of administration of the interferon-related antigen binding proteins of the present invention or nucleic acid sequences encoding them can be oral, parenteral, by inhalation or topical administration. As used herein, the term "parenteral" includes intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal or vaginal administration. Although all these forms of administration are clearly considered to be within the scope of the present invention, the form for administration will be an injection solution, specifically a solution for intravenous or intraarterial injection or infusion. Generally, a pharmaceutical composition suitable for injection may include a buffer (e.g., acetate, phosphate or citrate buffer), a surfactant (e.g., polysorbate), optionally a stabilizer (e.g., human albumin), etc. In some embodiments, the buffer is acetate. In another embodiment, the buffer is formate. In another embodiment, the buffer is citrate. In a related embodiment, the surfactant can be selected from a list including pluronics, PEG, sorbitan esters, polysorbates, triton, tromethamine, lecithin, cholesterol and tyloxapal. In a preferred embodiment, the surfactant is polysorbate. In a more preferred embodiment, the surfactant is polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80 or polysorbate 100, preferably polysorbate 20 or polysorbate 80.

[0298] In some embodiments, interferon-related antigen binding proteins or nucleic acid sequences encoding them can be delivered directly to the site of an adverse cell population (eg, liver), thereby increasing exposure of the diseased tissue to the therapeutic agent.

[0299] Preparations for parenteral administration include sterile water or non-aqueous solutions, suspensions and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils, such as olive oil and injectable organic esters, such as ethyl oleate. Aqueous carriers include water, alcohol / aqueous solutions, emulsions or suspensions, including saline and buffered vehicles. In the compositions and methods of the present invention, pharmaceutically acceptable carriers include but are not limited to 0.01-0.1M, for example, 0.05M phosphate buffer, or 0.8% saline. Other common parenteral vehicles include sodium phosphate solution, Ringer's dextrose, glucose and sodium chloride, lactated Ringer's solution or fixed oils. Intravenous vehicles include fluid and nutrient supplements, electrolyte supplements, such as those based on Ringer's dextrose, etc. Preservatives and other additives may also be present, such as, for example, antimicrobial agents, antioxidants, chelating agents and inert gases, etc. More specifically, the pharmaceutical composition suitable for injection includes sterile aqueous solution (when water-soluble) or dispersion and sterile powder for the instant preparation of sterile injectable solution or dispersion. In these cases, the composition must be sterile and should be fluid to the extent that there is easy injectability. It should be stable under production and storage conditions, and usually will be preserved with resistance to microorganisms, such as the contamination of bacteria and fungi. Carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, etc.) and its applicable mixture. Can, for example, by using a coating, such as lecithin, by maintaining the required particle size and by using a surfactant to maintain suitable fluidity with respect to dispersion.

[0300] Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parahydroxybenzoic acid, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In most cases, isotonic agents, for example, sugars, polyols, such as mannitol, sorbitol, or sodium chloride, will be included in the composition. Prolonged absorption of injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0301] In any case, as needed, active compounds can be introduced in a suitable solvent with a component or combination of components listed herein, alone or in combination with other active agents, such as the interferon-related antigen binding protein of the present invention or the nucleic acid sequence encoding the interferon-related antigen binding protein, and then filtered and sterilized to prepare sterile injectable solutions. Typically, dispersions are prepared by incorporating active compounds into sterile vehicles, the vehicle comprising a basic dispersion medium and other required components from those listed above. In the case of sterile powders for preparing sterile injectable solutions, exemplary preparation methods include vacuum drying and freeze drying, which dry methods obtain powders of active ingredients plus any other desired ingredients from their previous sterile-filtered solutions. According to methods known in the art, preparations for injection are processed, filled into containers, such as ampoules, bags, bottles, syringes or vials, and sealed under aseptic conditions. In addition, the preparations can be packaged and sold in the form of kits. These products will generally have labels or package instructions indicating that the relevant compositions are useful for treating subjects with HBV infection.

[0302] Based on a variety of different factors, including mode of administration, target site, patient physiological state, whether the patient is human or animal, whether the other drug therapy and treatment administered are preventive or therapeutic, the composition of the present invention is changed for the treatment of the above-mentioned HBV infection-related conditions. Usually, the patient is a human, but non-human mammals, including transgenic mammals, specifically non-human primates, can also be treated. Conventional methods known to those skilled in the art can be used to titrate the therapeutic dose to optimize safety and efficacy.

[0303] For the treatment using interferon-related antigen binding proteins, dosage can be, for example, about 0.0001 to about 100 mg / kg, and more generally about 0.01 to about 5 mg / kg (for example, about 0.02 mg / kg, about 0.25 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, etc.) in the range of host body weight. For example, dosage can be about 1 mg / kg body weight or about 10 mg / kg body weight or in the range of about 1 to about 10 mg / kg, for example, at least about 1 mg / kg. The dosage median in the above range is also intended to be within the scope of the present invention. These dosages can be applied to the subject every day, every other day, every week or according to any other schedule determined by empirical analysis. Exemplary treatment results in, for example, at least 6 months of duration, being applied with multiple dosages. Other exemplary treatment regimens result in approximately being applied once every two weeks or approximately once every month or once every 3 to 6 months. Exemplary dosage schedules include about 1 to about 10 mg / kg or about 15 mg / kg on consecutive days, about 30 mg / kg every other day, or about 60 mg / kg weekly.

[0304] Interferon related antigen binding proteins or the nucleotide sequence expressing any of these can be used in many cases.The interval between single doses can be weekly, monthly or annual.As indicated by the blood level of interferon related antigen binding proteins or its component in measuring patients, the interval can also be irregular.As another option, interferon related antigen binding proteins or the nucleotide sequence expressing any of these can be used as sustained release formulations, in this case, less frequent use is needed.Dosage and frequency are changed based on the half-life of interferon related antigen binding proteins in patients.

[0305] As referred to herein, the term "half-life" or "t 1 / 2 " indicates the stability and / or excretion rate of a compound, such as an interferon-related antigen-binding protein of the present invention. In practice, the half-life of a compound in serum is usually measured and expressed as the time at which the serum concentration after administration is 50% of the serum concentration at the time of administration. The interferon-related antigen-binding protein of the present invention is characterized by a long serum half-life in mice. In some embodiments, the half-life of the interferon-related antigen-binding protein is at least 50 h, at least 60 h, at least 70 h, at least 80 h, at least 90 h, or at least 100 h. In some embodiments, the half-life of the interferon-related antigen-binding protein is at least 100 h. In a preferred embodiment, the half-life of the interferon-related antigen-binding protein in mice is in the range of 116 to 158 h.

[0306] The half-life of a protein is related to its removal. As used herein, the term "removal" or "clearance rate" refers to the plasma volume of the protein removed per unit time. The removal of the interferon-related antigen-binding protein of the present invention is relatively low. In some embodiments, the removal of the interferon-related antigen-binding protein is less than 10mL / h / kg, less than 5mL / h / kg, less than 2.5mL / h / kg, less than 1mL / h / kg or less than 0.5mL / h / kg. In some embodiments, the removal of the interferon-related antigen-binding protein is less than 5mL / h / kg. In some embodiments, the removal of the interferon-related antigen-binding protein is less than 1mL / h / kg. In some embodiments, the removal of the interferon-related antigen-binding protein in mice is in the range of 0.28 to 0.49mL / h / kg.

[0307] As used herein, the terms "volume of distribution", "V D ”, “V SS" or "apparent volume of distribution" refers to the theoretical volume required to contain the total amount of the administered compound, such as the interferon-related antigen binding protein of the present invention, at the same concentration observed in plasma, and represents the distribution of the compound between plasma and other parts of the body after oral or parenteral dose administration. In certain embodiments, the volume of distribution Vss of the interferon-related antigen binding protein is less than 500 mL / kg, less than 400 mL / kg, less than 300 mL / kg, less than 200 mL / kg or less than 100 mL / kg. In some embodiments, the volume of distribution Vss of the interferon-related antigen binding protein is less than 100 mL / kg. In some embodiments, the volume of distribution Vss of the interferon-related antigen binding protein in mice is in the range of 50 to 98 mL / kg.

[0308] Another relevant pharmacokinetic parameter is systemic exposure. As used herein, the term "systemic exposure", "AUC" or "area under the curve" represents the integral of the concentration-time curve. Systemic exposure can be represented by the plasma (serum or blood) concentration or AUC of the parent compound and / or metabolites. The interferon-related antigen-binding proteins of the present invention circulate in the blood with a systemic exposure (AUC (0-inf)) greater than their parent antibodies (CP870,893). In some embodiments, the systemic exposure of the interferon-related antigen-binding proteins is at least 600 μg*h / mL, at least 700 μg*h / mL, at least 800 μg*h / mL, at least 900 μg*h / mL or at least 1000 μg*h / mL, preferably at least 1000 μg*h / mL. In some embodiments, the systemic exposure of the interferon-related antigen-binding proteins in mice is in the range of 1033 μg*h / mL to 1793 μg*h / mL.

[0309] As previously discussed, the interferon-related antigen binding proteins of the present invention can be administered in a pharmaceutically effective amount for in vivo treatment of mammalian disorders. In this regard, it will be appreciated that the interferon-related antigen binding proteins are formulated to facilitate administration of the active agent and promote stability of the active agent as disclosed.

[0310] The pharmaceutical composition according to the present invention may comprise a pharmaceutically acceptable, non-toxic, sterile carrier, such as physiological saline, non-toxic buffer, preservative, etc. The pharmaceutically effective amount of the interferon-related antigen binding protein is generally an amount sufficient to mediate one or more of the following: reduction in HBeAg release from HBV-infected cells; reduction in pgRNA transcription in HBV-infected cells; and stimulation of the IFN signal transduction pathway in infected cells. Of course, the pharmaceutical composition of the present invention may be administered in a single or multiple doses to provide a pharmaceutically effective amount of the interferon-related antigen binding protein.

[0311] Consistent with the scope of the present invention, interferon-related antigen binding proteins or nucleic acid sequences expressing any of them can be applied to humans or other animals in an amount sufficient to produce a therapeutic effect according to the above-mentioned treatment methods. Interferon-related antigen binding proteins or nucleic acid sequences expressing any of them can be applied to these people or other animals in a conventional dosage form prepared by mixing interferon-related antigen binding proteins or nucleic acid sequences expressing any of them with conventional pharmaceutically acceptable carriers or diluents according to known techniques. Those skilled in the art will recognize that the form and characteristics of pharmaceutically acceptable carriers or diluents are determined by the amount of active ingredients to be mixed, route of administration, and other well-known variables. Those skilled in the art will further understand that a mixture of one or more substances contained in the interferon-related antigen binding proteins described in the present invention or nucleic acid sequences expressing any of them can be proven to be effective.

[0312] It should be understood that the methods described in the present invention are not limited to the specific methods and experimental conditions disclosed herein, as these methods and conditions may vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only, and is not intended to be limiting.

[0313] In addition, unless otherwise stated, the experiments described herein use conventional molecules and cell biology and immunological techniques within the technical scope of the art. These techniques are well known to technical workers and are fully explained in the literature. See, for example, Ausubel et al., ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, NY (1987-2008), including all supplements, MR Green and J. Sambrook and Harlow et al., Molecular cloning: Laboratory Manual (Molecular Cloning: A Laboratory Manual) (4th edition), antibodies: Laboratory Manual (Antibodies: A Laboratory Manual), Chapter 14, Cold Spring Harbor Laboratory (Cold Spring Harbor Laboratory), Cold Spring Harbor (Cold Spring Harbor) (2013, 2nd edition).

[0314] Unless otherwise defined, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. If there is any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. Unless the context otherwise requires, singular terms shall include plural terms and plural terms shall include singular terms. Unless otherwise stated, the use of "or" means "and / or". The use of the term "including" and other forms such as "includes" and "included" is not restrictive. Unless otherwise stated, the use of the term "comprising" shall include the term "consisting of...".

[0315] Generally, the terms used in conjunction with cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are well known and commonly used in the art. Unless otherwise stated, generally, according to conventional methods well known in the art and as described in a plurality of general and more specific references cited and discussed throughout this specification, the methods and techniques provided herein are implemented. As usually accomplished in the art and as described herein, enzymatic reactions and purification techniques are implemented according to the manufacturer's instructions. The terms used in conjunction with analytical chemistry, synthetic organic chemistry and pharmacy and medicinal chemistry described herein and the experimental techniques and techniques in these fields are well known and commonly used in the art. Standard techniques are used for chemical synthesis, chemical analysis, drug preparation, preparation and delivery and the treatment of patients.

[0316] The section headings used herein are for organizational purposes only and should not be construed as limitations of the subject matter described. The contents of the papers, patents, and patent applications and all other documents and electronically available information mentioned or cited herein are incorporated herein by reference in their entirety to the same extent as each individual publication is specifically and individually indicated to be incorporated by reference. Applicants reserve the right to physically incorporate into the present application any and all materials and information from any of these papers, patents, patent applications, or other physical and electronic documents.

[0317] Although the present invention has been described with reference to its specific embodiments, it will be appreciated by those skilled in the art that various changes may be made and equivalents may be substituted using the present disclosure as a guide without departing from the true spirit and scope of the present invention. By now describing certain embodiments in detail, the same will be more clearly understood by reference to the following examples, which are included for illustrative purposes only and are not intended to be limiting.

[0318] Example

[0319] Embodiment 1

[0320] Generation of interferon-fused antibodies (IFA) and identification of reporter cells

[0321] Ia-IFA Design

[0322] The sequence combinations of exemplary IFAs designed using CP870,893 agonistic anti-CD40 antibodies as the backbone antibodies with IFN positions and linker properties are listed in Tables 7 and 8. As shown in Table 7, IFN is fused to the N- or C-terminal portion of the light chain (LC) or heavy chain (HC) via a linker. Nucleic acids encoding HC, LC or fusions are synthesized by optimized mammalian expression codons and cloned into eukaryotic expression vectors such as pcDNA3.1 (Invitrogen). Figure 2A An exemplary map of the pcDNA3.1 plasmid encoding Seq ID NO 32 under the control of the pCMV promoter is shown.

[0323] Ib-IFA generation

[0324] Freestyle293-F cells (Invitrogen) were transiently co-transfected with plasmids encoding both HC and LC with a 4 / 6 HC / LC ratio. Six days after transfection, the supernatant was collected, centrifuged and filtered through a 0.22 μm filter. In two purification steps, on an AktaExpress chromatography system (GE Healthcare), a protein A MabSelect Sure 5mL 1.6 / 2.5cm column (GE Healthcare) was used to implement the purification method at a flow rate of 5mL / min. Sample binding was performed in D-PBS1X pH 7.5 buffer and eluted with glycine / HCl 0.1M pH 3.0 buffer. The elution peak was stored in a loop and then injected into a HiTrap desalting 26 / 10 column (GE Healthcare) in D-PBS1XpH 7.5 buffer at a flow rate of 10mL / min. The elution peak (2mL portion) was collected on a 96-well microplate. Mixing was performed according to the UV peak spectrogram. After filtration on a 0.22 μm filter (Sartorius MiniSart), quality control was performed, including the use of nexgen-PTS TM Bacterial endotoxin from (Charles River), size exclusion chromatography: using a SEC 200 Increase 10 / 300 column (GE Healthcare) to determine purity and oligomers, and SDS-PAGE performed in MESSDS running buffer on a NuPAGE gel system (Invitrogen) under reducing and non-reducing conditions. The product yields are shown in Table 8. For some IFAs, the product yields were very low. In that case, the supernatant containing the IFA was used directly to evaluate agonistic CD40 activity and IFN activity without any further purification.

[0325] Reducing SDS-PAGE analysis of purified IFA showed the presence of two major bands corresponding to HC and LC. When IFN (regardless of which IFN family member) was fused to HC, a change in its molecular weight was observed and the same phenomenon was observed for LC fused to any IFN ( Figure 2B ).

[0326] Ic-IFA identification of reporter cells

[0327] HEK-Blue TM CD40L cells (InvivoGen catalog #: hkb-cd40) or HEK-Blue TM IFN-α / β cells (InvivoGen, catalog #: hkb-ifnαβ) were used to monitor the activation of the NFκB pathway by CD40 agonists or the activation of the IFN pathway by type I-IFN induction, respectively.

[0328] HEK-Blue was produced by stably transfecting HEK293 cells with the human CD40 gene and a NFκB-inducible secreted embryonic alkaline phosphatase (SEAP) construct (Invivogen). TM CD40L cells to measure the biological activity of CD40 agonists. Stimulation of CD40 leads to NFκB induction and then SEAP production using QUANTI-Blue TM (Invivogen, catalog # rep-qbs2) SEAP was detected in the supernatant.

[0329] Design HEK-Blue TM IFN-cells were used to monitor the activation of the JAK / STAT / ISGF3 pathway induced by type I IFN. This pathway activation leads to the production and release of SEAP. SEAP levels were measured using QUANTI-Blue TM Easily assessable in the supernatant.

[0330] HEK-Blue TM IFN-α / β is used to monitor the activity of human IFNα or IFNβ.

[0331] Cells were seeded into 96-well plates (50,000 cells per well) and stimulated with the indicated concentrations of each IFA or control and incubated at 37°C for 24 h. The supernatants were then collected and mixed with QuantiBlue TMSEAP levels were quantified after approximately 30 min of incubation and the optical density (OD) was assessed at 620 nm on an Ensight microplate reader or PheraStar (Lab Biotech).

[0332] HEK-Blue TM Dual IFN-γ cells (InvivoGen, catalog #: hkb-ifng) or HEK-Blue TM IFN-λ (InvivoGen, catalog #: hkb-ifnl) can be used to monitor the activity of type II- and type III-IFNs, respectively. Design HEK-Blue TM IFN-λ cells to monitor IFNλ activity. HEK-Blue TM Dual IFN-γ cells allow the detection of biologically active human IFNγ.

[0333] Functional activity of Id-IFNα / β-based IFA on reporter cells

[0334] Figure 3 shows the IFA in HEK-Blue TM CD40L( Figure 3A-3B ) and HEK-Blue TM IFN-α / β cells ( Figure 3C-Figure 3D ) in which IFNβ or its mutant forms as indicated in Table 7 were fused to HC. The agonistic anti-CD40 activity of IFA is summarized in Table 8 and Figure 3A and Figure 3B Examples are shown in . The results showed that all IFAs tested were functional, activating both the CD40 pathway and the IFN-α / β pathway in a dose-dependent manner. For fusions to the C-terminus of HC or LC, the EC of agonistic CD40 50 The values ​​ranged from 11.1 ng / mL to 192 ng / mL (Table 8). FIG. 3A to FIG. 3D The mean EC values ​​of the parental antibodies for the experiments shown are 50 The values ​​were 48 ng / mL and 57 ng / mL. IFAs with IFN fused to the N-terminus of HC or LC were also able to activate the CD40 pathway, but the exact EC could not be determined for these IFAs. 50 values, because activity determined directly from supernatant is different from that determined using purified protein ( Figure 3B ).

[0335] The IFN activities of various IFAs are summarized in Table 8 and FIG. 3C to FIG. 3DFor fusion of IFNβ or mutant IFNβ (as indicated in Table 7) to the C-terminus of HC or LC, the IFN activity was variable based on the linker sequence, with an EC of 50 Values ​​ranged from 0.14 ng / mL to 4.5 ng / mL ( Figure 3C and Table 8). Figure 3D Shown that IFA with IFN β fused to N-terminal part shows high IFN activity. Parental antibody used as negative control does not show any activity, yet recombinant IFN β does show strong dose-dependent response. Overall, these results show that regardless of position, the fusion of IFN β or its mutant form as indicated in Table 7 with antibody maintains two biological functions, although with differences in terms of effectiveness.

[0336] Figure 4 shows the IFA in HEK-Blue TM CD40L( Figure 4A and Figure 4C ) and HEK-Blue TM IFN-α / β cells ( Figure 4B and Figure 4D ) in which IFNα was fused to HC or LC as shown in Table 7. The results show that all tested IFAs are functional, activating both the CD40 pathway and the IFNα / β pathway in a dose-dependent manner. Surprisingly, for all IFNα-based IFAs, the potency on the CD40 pathway was reproducibly higher than that of the parent antibody. The EC of IFNα-based IFA 50 The values ​​ranged from 11.1 ng / mL to 22.7 ng / mL, while the EC 50 In the range of 30 ng / mL to 80 ng / mL (mean EC 50 value: 48ng / mL).

[0337] The IFN activity of IFA is variable based on the linker sequence, and its EC 50 The values ​​ranged from 1.6 ng / mL to 5.1 ng / mL. In the same assay, PEGylated IFNα2a It was also active in a dose-dependent manner, with an EC 50 The value is about 1 ng / mL.

[0338] Generation and characterization of Ie-IFA without Fc region

[0339] Suitable constructs according to the present invention may also be interferon-associated antigen-binding proteins without Fc regions. A construct encoding the heavy chain of the fab fragment of CP870,893 fused to a TEV-His tag was designed (SEQ ID NO 50) and cloned into the expression plasmid pcDNA3.1. As previously described, the construct was co-transfected in HEK cells, wherein the LC was fused to different IFNs, such as SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 41, SEQ ID NO 42 or SEQ ID NO 43, via different linkers. Proteins and / or supernatants and / or their effects on HBV infection in PHH were evaluated in reporter cells. Those skilled in the art will appreciate that constructs for therapy will no longer contain TEV-His tags. These constructs are also embodiments of the present invention. Interferon-associated antigen-binding proteins without Fc portions will be active relative to HBV infection. Then, two IFAs were produced and in Example V Their functional identification is described in: IFA50: (SEQ ID NO 41) + (SEQ ID NO 50) and IFA51: (SEQ ID NO 42) + (SEQ ID NO 50).

[0340] Example II

[0341] Effects of IFA on primary hepatocytes infected with HBV

[0342] II. Effect of a-IFA on HBV infection in primary human hepatocytes

[0343] The effect of IFA on HBV infection in primary human hepatocytes (PHH) was studied. PHH cells were plated in 96-well plates (70,000 cells / well) in William's EGlutaMAX medium (32551-020, Gibco) supplemented with 10% fetal calf serum (FCS) (SH30066.02, Hyclone), insulin (19278-5ML, Sigma), hydrocortisone (H2270-100MG, Sigma) and penicillin / streptomycin (15140, Gibco). After 4 hours, the cells were rinsed and the medium was replaced. The next day, the medium was replaced with medium containing matrigel (0.25 mg / mL; 356231, Corning). After plating in InVitroGRO HI medium (Z99009, Bioreclamation IVT) supplemented with 5% FCS, 4% PEG 8000 (81268, Sigma), 2% DMSO (DMSO-100ML, Sigma) and 1% penicillin / streptomycin at an MOI (multiplicity of infection) of 500 to 1,000 vge / cell (viral genome equivalent), the cells were infected for 48 hours. 16 hours after infection, the cells were washed three times with PBS. 4 days after infection, the cells were kept untreated or treated with sequentially diluted IFA as shown. 3 days after treatment, the culture supernatant was collected and kept at -80°C for further protein detection.

[0344] II.b.- Evaluation of HBV e-antigen (HBeAg) release

[0345] HBV e-antigen (HBeAg) levels in cell culture supernatants were measured using ELISA as described by the manufacturer, and the results were expressed in PEI units (HBeAg CLIA 96T / K: CL0312-2; Autobio) or luminescence.

[0346] II.c.-HBV s-antigen (HBsAg) release evaluation

[0347] According to the protocol of the AutoBio HBsAg CLIA kit (#CL0310-2), quantification of HBsAg in the supernatant was performed, and the main steps were: first, the sample was diluted 1 / 5 in 1X PBS. Then, 50 μL of standard, control and diluted samples were placed in the wells. 50 μL of "enzyme conjugate" solution was added to each well and then incubated at 37°C for 1 hour. Subsequently, the plate was washed 6 times with 300 μL of the cleaning solution from the kit using a plate washer. Then, 50 μL of "substrate solution" (volume-to-volume mixture in reagents A and B) was added to each well and incubated for 10 minutes in the dark. Then, the plate was read in luminescence mode on a PHERASTAR microplate reader (BMGLabtech).

[0348] II.d.-pgRNA quantification

[0349] qPCR technology is used to compare the expression level of pgRNA from infected cells treated with test compounds. Using QuantStudio 12K Flex, pgRNA quantification from infected cells is performed in 96-well plates. cDNA is obtained by RT, and qPCR (ThermoFisher cat#4444434) is subsequently performed in one step with TaqMan fast virus assay. The results are processed by the ΔΔCt method and normalized with housekeeping gene GUSB, repeated twice. The following primers and probes are used: (forward: CCTCACCATACTGCACTCA, reverse: GAGGGAGTTCTTCTTCTAGG, AGTGTGGATTCGCACTCCTCCAGC as probes) pgRNA is amplified. The GUSB gene is amplified using TaqMan assay from Thermo Fisher (Hs99999908-m1).

[0350] II.e.-CXCL10 release

[0351] CXCL10 release was assessed using an ELISA kit (BioLegend 439904) according to the manufacturer's instructions. Samples were diluted 1 / 50 and luminescence was assessed at 450 nm on an EnSight microplate reader.

[0352] II. Effects of f-IFNα / β-based IFA on HBV infection

[0353] Several IFAs were tested for their ability to reduce HBeAg secretion after infection of PHH with HBV. Figure 5In, IFA with IFNβ or its mutant form fused at the C-terminus of LC was used. The results indicate that all tested IFA strongly reduce HBeAg release. Indeed, even at the lowest concentration tested (1ng / mL), 70% to 90% inhibition of HBeAg release was observed based on IFA, demonstrating that they have effective anti-viral effects. It is worth noting that 100% inhibition could not be achieved in this experiment because treatment was started 4 days after infection and at this time, the existing HBeAg mixed pool (mRNA and protein) was already present in the cells and continued to be produced thereafter.

[0354] The effect of IFA fused to IFNα was also tested in HBV-infected PHH. 6A to 6H These IFAs were shown to be highly effective against HBV infection, with the EC 50 The values ​​ranged from 0.06 ng / mL to 0.2 ng / mL (IFA25: 0.16 ng / mL; IFA26: 0.1 ng / mL; IFA27: 0.06 ng / mL; and IFA38: ∼0.2 ng / mL (∼2.2 pM); Fig. 6A and Figure 6C ) and for IFA with IFNα2a fused to the C-terminus of LC, EC 50 Values ​​ranged from 0.15 ng / mL to 0.36 ng / mL (IFA28: 0.36 ng / mL; IFA29: 0.15 ng / mL; IFA30: 0.31 ng / mL; and IFA39: ∼0.3 ng / mL (∼3 pM); Figure 6B and Figure 6C ). To compare the antiviral effect of Pegasys with IFA38 and IFA39, the results were expressed in pM and the results showed that the EC of Pegasys 50 The 5-mercaptoethanol-1-phosphate dehydrogenase (IFA) was ∼250 pM, compared to ∼2.2 pM for IFA38 and ∼3 pM for IFA39, indicating that IFA is more potent than Pegasys.

[0355] II.g-Short-term treatment is sufficient to induce effective anti-viral activity

[0356] To evaluate the effects of short-term IFA treatment of HBV-infected primary hepatocytes, cells were infected and cultured for 4 days, treated with IFA25, IFA27, IFA28, IFA30 or with Pegasys in a dose-dependent manner for 24 h, washed and then incubated with fresh medium without any treatment. After 3 days, supernatants were collected to evaluate HBeAG ( Fig. 6E )、HBsAG( Fig. 6F ) and CXCL10( Figure 6H ) release level and cells were lysed and RNA was extracted to quantify pgRNA ( Figure 6G ). The results showed that all tested IFAs were able to inhibit HbeAG and HBsAG release and pgRNA expression in a dose-dependent manner. Pegasys alone was only able to inhibit HBeAG release and reduce pgRNA levels. In this regard, IFA was at least 2 log higher than Pegasys in terms of activity on viral parameters. Unexpectedly, although all tested IFAs showed dose-dependent inhibition of HBsAg release, no reduction was observed using Pegasys even at the highest concentration. Analysis of CXCL10 (a biomarker for the IFN pathway) showed that IFA was also more effective than Pegasys.

[0357] Example III

[0358] Cytokine release

[0359] III.a-Cytokine Release Assessment (CRA) from Human Whole Blood Cells

[0360] Whole blood cell (WBC) ex vivo stimulation assay was used to study the release of cytokines after IFA stimulation. WBC was collected from 4 healthy donors, diluted 1 / 3 in RPMI1640 (72400-021, Gibco) and distributed in sterile reaction tubes (300 μl). The cells were kept unstimulated, and as positive controls, 10 ng / mL of LPS (lipopolysaccharide) K12 (tlrl-eklps, Invivogen) or 1 μg / ml of IFA were stimulated and cultivated at 37°C for 24h. The supernatant was then collected and frozen at -20°C until the day of analysis.

[0361] Human proinflammatory cytokines were analyzed using a multiplex MSD assay (K15067L-4) measuring tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-2, IL-6, IL-8, IL-10, IL-12 / IL-23p40, and IFNγ. MSD plates were analyzed on a 1300M ESO QuickPlex SQ120 instrument (MSD).

[0362] Figure 7 Shown are exemplary results of in vitro cytokine release evaluation from human WBCs that were unstimulated, treated with LPS, or with IFA1.

[0363] Other results of testing IFNβ- / mutated IFNβ- and IFNα-based IFA are summarized in Table 9a and Table 9b. The results show that for all donors, LPS induces extremely high inflammatory cytokines (IL-1β, TNF-α, IL-6, IL-12p40 and IFNγ) levels. It also induces IP10 (CXCL10) and medium levels of IL-10 as a biomarker of the IFN pathway. Two IFNβ- (Table 9a) and 6 IFNα- (Table 9b) based IFAs were tested. They all induce biomarker IP10. However, they do not induce IL-10, IL-1β and IL-2, and they only induce extremely low to medium levels of IFNγ, IL-6 and TNF-α, thus showing that the induction of inflammatory cytokines has a good safety profile.

[0364] Example IV

[0365] Pharmacokinetic studies

[0366] IV.a-ELISA assay development for IFA quantification

[0367] For ELISA quantification, 96-well plates (PLATES 96wells Maxisorp, THERMO Scientifique; 442404) were coated with 100 μl of a 0.5 μg / mL solution of recombinant human CD40 / TNFRSF5 Fc chimeric protein (composed of the extracellular domain of human CD40 fused to the Fc portion of human IgG1 (CD40-Fc; R&D Systems; 1493-CDB-050)) in sodium carbonate (0.05 M, pH 9.6, C-3041, Sigma) overnight at 4° C. After emptying by inversion, the plates were then incubated with PBS-0.05% Tween 20-1% milk (SIGMA; 70166-500g) at 37° C. for 1 hour and then washed with PBS-0.05% Tween 20. Then, the samples and controls (1 / 2 serial dilutions of 100 μl) were incubated at 37°C for 90 minutes, followed by washing 3 times (PBS-0.05% Tween 20) and incubated with a second anti-IgG2-conjugate HRP (1 / 5000, ab99779, Abcam) antibody or anti-IFNα conjugate HRP (1 / 1000, eBIOSCIENCE / Invitrogen; BMS216MST) in PBS-0.05% Tween20-1% milk. After washing 3 times with PBS, 0.05% Tween 2, TMB (tetramethylbenzidine, TebuBio; TMBW-1000-01) was added and the plate was incubated in the dark for 20 minutes. The reaction was terminated by adding 1M HCl. The plate was read at 450-650nm using an Ensight microplate reader (Perkin Elmer). Similar protocol steps were used, but the quantification of Pegasys was evaluated using human IFN-α matched antibodies from eBioscience / Invitrogen. Capture was performed using a solution of 100 μL, 1 μg / mL human anti-IFNα antibody (eBioscience / Invitrogen; BMS216MST) in sodium carbonate (0.05M, pH 9.6, C-3041, Sigma). For detection, a solution of a second anti-IFNα conjugate HRP antibody (1 / 1000, AffymetrixeBioscience / BMS216MST; 15501707) in PBS-0.05% Tween20-1% milk was applied.

[0368] IV.b-In vivo bioavailability in mice

[0369] To determine the PK parameters, CP870,893, IFA25, IFA26, IFA27, IFA28, IFA29 and IFA30 were administered at 0.5 mg / kg and Pegasys at 0.3 mg / kg as a bolus to male CD1-Swiss mice and blood samples were collected at different time points. Fig. 8A and 8B An example of quantification of circulating molecules using the ELISA method described above and visualized using anti-IFNα-conjugated HRP is shown in Figure 8C An example of quantification using anti-IgG2-conjugated HRP is shown in; Fig.8D Pegasys is shown to be quantitative. In one group of experiments summarized in Table 10A, the PK parameters of CP870,893 were studied in 7-day experiments and those PK parameters of IFA27, IFA29 and IFA30 were studied in 10-day experiments (using 2 different ELISA methods to carry out IFA27 quantitatively). In another group of experiments summarized in Table 10B, the PK parameters of CP870,893 and IFA25, IFA26, IFA28 and Pegasys were studied in 21-day experiments (using 2 different ELISA methods to carry out IFA25 quantitatively).

[0370] After the short distribution phase, the pharmacokinetic profile of IFA is characterized by a long serum half-life (table 10A and table 10B) in the range of 116 to 218h. Very similar PK profiles were obtained for 6 kinds of IFA tested, even if it still had high circulation levels 10 days after single dose administration. The pharmacokinetic parameters summarized in table 10A / table 10B show that these IFAs unexpectedly circulate in blood with higher systemic exposure (AUC (0-inf)) in the range of 1033 μ g.h / mL to 2552 μ g.h / mL, by contrast, parent antibody CP870,893 is respectively 590 or 797 μ g.h / mL (up to 3.2 times), which also reflects the lower clearance value of IFA. Volume of distribution Vss is relatively low and is arranged between 50 to 105mL / kg, slightly higher than the plasma vascular volume (50mL / kg) in the species. For all IFAs, clearance is arranged as low (0.28 to 0.49mL / h / kg). Interestingly, the clearance of Pegasys (1.4 mL / h / kg) was up to 7-fold higher than that of IFA (eg, 0.2 mL / h / kg for IFA27), demonstrating a higher systemic exposure of IFA.

[0371] Example V

[0372] Functional activity of Va-IFA without Fc region on reporter cells and HBV infection

[0373] To determine whether the Fc portion of IFA is required for activity, a fusion of IFNα to the C-terminal portion of LC bound to the Fab fragment of HC was designed and generated. IFNα was linked to the LC portion using either a (G4S)2(IFA50) or a (G4S)3(IFA51) linker.

[0374] HEK-Blue TM Evaluation of CD40L cells demonstrated that these IFAs still displayed agonistic CD40 activity ( Fig.9A ) and activate the CD40 pathway, its EC 50 The values ​​were approximately 128 ng / ml (IFA 50) and 123 ng / mL (IFA51), respectively.

[0375] HEK-Blue TM Evaluation of IFN activity in IFN-α / β cells showed that both IFAs tested exhibited IFN activity ( Fig. 9B ). The EC values ​​are reported in Table 8B. 50 Value and EC of IFA50 50 The value was about 1.36 ng / ml, while that of IFA51 was 1.43 ng / mL.

[0376] As previously described, both IFAs were tested against HBV infection and showed potent anti-viral activity with EC 50 The values ​​were approximately 4.1 pM (IFA50) and 2.7 pM (IFA51), respectively.

[0377] Functional activity of Vb-IFNε-based IFA on reporter cells and HBV infection

[0378] CP870,893 was also designed and produced to target the third type I interferon (IFN ipsilon; IFNε ) fusion. TM CD40L cells were tested with these IFAs and could be confirmed to maintain agonistic CD40 activity. Fig. 10A Results from one such IFA (IFA49) are shown in Figure 2. TM Evaluation of hIFN-α / β cells (which are activated by virtually any type I interferon) showed that IFA49 is also able to activate the IFN-I pathway ( Fig. 10B Table 8B reports the EC 50 In addition, IFA49 was also tested for HBV infection in primary hepatocytes and showed similar activity to Pegasys ( Fig. 10C ).

[0379] These results confirm that IFNεThe IFA maintains both IFN and agonistic CD40 activities (ie is bifunctional) and has antiviral activity.

[0380] Functional activity of Vc-IFNω-based IFA on reporter cells and HBV infection

[0381] We also designed and produced CP870,893 to target the fourth type I interferon (IFN omega; IFNω ) fusion. TM CD40L cells were tested with these IFAs and the results demonstrated that they maintained agonistic CD40 activity. Fig.11A Results from one such IFA (IFA46) are shown in Figure 2. TM Evaluation of hIFN-α / β cells (which are activated by virtually any type I interferon) showed that IFA46 is also able to activate the IFN-I pathway ( Fig. 11B Table 8B reports the EC 50 In addition, IFA46 was also tested for HBV infection in primary hepatocytes and showed similar activity to Pegasys ( Fig. 11C ).

[0382] These results confirm that IFNω The IFA maintains both IFN and agonistic CD40 activities (ie is bifunctional) and has antiviral activity.

[0383] Functional activity of Vd-IFNγ-based IFA on reporter cells and HBV infection

[0384] Fusions of CP870,893 to type II interferon (IFN gamma; IFNγ) were also designed and generated. These IFAs are effective against HEK-Blue TM Evaluation of CD40L cells demonstrated that they maintained agonistic CD40 activity regardless of whether IFNγ was linked to the C-terminal portion of the LC (IFA42) or HC (IFA43). Fig. 12A ). These IFAs are effective for HEK-Blue TM - Evaluation of IFNγ cells ( Fig. 12B ) showed that they are also able to activate the IFNγ-pathway. 50 :15ng / ml) and IFA43 (EC 50 : <0.01 ng / ml) were slightly different in IFNγ activity. Table 8B reports the EC 50 In addition, IFA42 and IFA43 were tested in a dose-dependent manner for HBV infection in primary hepatocytes as described previously. The results showed that both IFAs reduced HbeAg release in a dose-dependent manner ( Fig. 12C), which showed that IFA with type II-IFN was active against HBV infection.

[0385] Overall, these results suggest that IFNγ The IFA maintains both IFN and agonistic CD40 activities (ie is bifunctional) and has anti-viral activity.

[0386] Functional activity of Ve-IFNλ-based IFA on reporter cells and HBV infection

[0387] CP870,893 was also designed and produced to target type III interferon (IFN-lambda; IFNλ ) fusion. TM CD40L cells were tested with these IFAs and the results showed that they also maintained agonistic CD40 activity, regardless of IFNλ Whether it is linked to the C-terminal part of LC (IFA44) or HC (IFA45) Fig.13A ). These IFAs are effective for HEK-Blue TM - IFNλ Evaluation of cells showed that they were also able to activate IFNλ -path( Fig. 13B Table 8B reports the EC 50 These results also confirm that IFNλ The IFA maintains both IFN and agonistic CD40 activity (ie is bifunctional).

[0388] As previously described, IFA44 and IFA45 were tested at a single dose compared to Pegasys for HBV infection in primary hepatocytes. The results showed that the two types of IFA reduced HbeAg release by 65% ​​and 78%, respectively. Under these conditions, Pegasys inhibited HbeAg release by 81%. These results suggest that Type III IFN The IFAs were active against HBV infection. For both IFAs tested, EC 50 Value <10nM( Fig. 13C ).

[0389] Equivalent form

[0390] The present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. Therefore, the above embodiments are considered to be illustrative in all respects, rather than limiting the present invention. Therefore, the scope of the present invention is indicated by the appended claims, rather than by the above description, and therefore all changes within the meaning and scope of the equivalent forms of the claims are intended to be included herein.

[0391] project

[0392] In view of the above, it will be understood that the present invention also relates to the following items:

[0393] 1. An interferon-related antigen binding protein comprising

[0394] (I) an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof, and

[0395] (II) interferon (IFN) or a functional fragment thereof, wherein the agonist anti-CD40 antibody or agonist antigen-binding fragment thereof comprises

[0396] (a) three light chain complementary determining regions (CDRs) that are at least 90% identical to the CDRL1, CDRL2 and CDRL3 sequences within SEQ ID NO 3; and three heavy chain CDRs that are at least 90% identical to the CDRH1, CDRH2 and CDRH3 sequences within SEQ ID NO 6; wherein each CDR is defined according to the Kabat definition, the Chothia definition, the AbM definition or the contact definition of a CDR; preferably wherein each CDR is defined according to the Kabat definition of a CDR or the Chothia definition of a CDR;

[0397] (b) three light chain complementary determining regions (CDRs) identical to the CDRL1, CDRL2 and CDRL3 sequences in SEQ ID NO 3; and three heavy chain CDRs identical to the CDRH1, CDRH2 and CDRH3 sequences in SEQ ID NO 6; wherein each CDR is defined according to the Kabat definition, the Chothia definition, the AbM definition or the contact definition of a CDR; preferably wherein each CDR is defined according to the Kabat definition of a CDR or the Chothia definition of a CDR;

[0398] (c) a heavy chain or a fragment thereof comprising a complementarity determining region (CDR) CDRH1 having at least 90% identity to SEQ ID NO 56, a CDRH2 having at least 90% identity to SEQ ID NO 57, and a CDRH3 having at least 90% identity to SEQ ID NO 58; and a light chain or a fragment thereof comprising a CDRL1 having at least 90% identity to SEQ ID NO 52, a CDRL2 having at least 90% identity to SEQ ID NO 53, and a CDRL3 having at least 90% identity to SEQ ID NO 54;

[0399] (d) a heavy chain or a fragment thereof, which comprises a complementarity determining region (CDR) CDRH1 identical to SEQ ID NO 56, a CDRH2 identical to SEQ ID NO 57, and a CDRH3 identical to SEQ ID NO 58; and a light chain or a fragment thereof, which comprises a CDRL1 identical to SEQ ID NO 52, a CDRL2 identical to SEQ ID NO 53, and a CDRL3 identical to SEQ ID NO 54;

[0400] (e) a light chain variable region V comprising the sequence shown in SEQ ID NO 51 or a sequence having at least 90% identity thereto L and / or a heavy chain variable region V comprising the sequence shown in SEQ ID NO 55 or a sequence having at least 90% identity thereto H ;

[0401] (f) a Fab region heavy chain comprising the amino acid sequence shown in SEQ ID NO 12, or a sequence having at least 90% identity thereto; or

[0402] (g) a light chain (LC) comprising the sequence shown in SEQ ID NO 3, or a sequence having at least 90% identity thereto; and / or a heavy chain (HC) comprising a sequence selected from the group consisting of SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 49 and SEQ ID NO 48, or a sequence having at least 90% identity thereto.

[0403] 2. The interferon-related antigen binding protein according to item 1, wherein HC comprises the sequence shown in SEQ ID NO 6 or a sequence having at least 90% identity thereto.

[0404] 3. The interferon-related antigen binding protein according to item 1, wherein HC comprises the sequence shown in SEQ ID NO 9 or a sequence having at least 90% identity thereto.

[0405] 4. The interferon-related antigen binding protein according to item 1, wherein HC comprises the sequence shown in SEQ ID NO 49 or a sequence having at least 90% identity thereto.

[0406] 5. The interferon-related antigen binding protein according to item 1, wherein HC comprises the sequence shown in SEQ ID NO 48 or a sequence having at least 90% identity thereto.

[0407] 6. The interferon-related antigen binding protein according to any one of the above items, wherein the IFN or a functional fragment thereof is human interferon.

[0408] 7. The interferon-related antigen binding protein according to any one of the above items, wherein IFN or a functional fragment thereof is selected from the group consisting of type I IFN, type II IFN and type III IFN or a functional fragment thereof.

[0409] 8. The interferon-related antigen binding protein according to any one of the above items, wherein the IFN or a functional fragment thereof is a type I IFN or a functional fragment thereof.

[0410] 9. The interferon-related antigen binding protein according to item 8, wherein the type I IFN or a functional fragment thereof is IFNα, IFNβ, IFNω or IFNε or a functional fragment thereof.

[0411] 10. The interferon-related antigen binding protein according to item 8, wherein the type I IFN or a functional fragment thereof is IFNα or IFNβ or a functional fragment thereof.

[0412] 11. The interferon-related antigen binding protein according to item 8, wherein the type I IFN or a functional fragment thereof is IFNω or a functional fragment thereof.

[0413] 12. The interferon-related antigen binding protein according to item 8, wherein the type I IFN or a functional fragment thereof is IFNε or a functional fragment thereof.

[0414] 13. The interferon-related antigen binding protein according to any one of items 1 to 6, wherein the IFN or a functional fragment thereof is IFNα, IFNβ, IFNγ, IFNλ, IFNω or IFNε or a functional fragment thereof.

[0415] 14. The interferon-related antigen binding protein according to item 13, wherein the IFN or a functional fragment thereof is IFNα or IFNβ or a functional fragment thereof.

[0416] 15. The interferon-related antigen binding protein according to item 14, wherein the IFN or a functional fragment thereof is IFNα or a functional fragment thereof.

[0417] 16. The interferon-related antigen binding protein according to item 15, wherein the IFN or a functional fragment thereof is IFNα2a or a functional fragment thereof.

[0418] 17. The interferon-related antigen binding protein according to item 16, wherein IFNα2a comprises the sequence shown in SEQ ID NO 17 or a sequence having at least 90% identity thereto.

[0419] 18. The interferon-related antigen binding protein according to item 14, wherein the IFN or a functional fragment thereof is IFNβ or a functional fragment thereof.

[0420] 19. The interferon-related antigen binding protein according to item 18, wherein IFNβ comprises the sequence shown in SEQ ID NO 14 or a sequence having at least 90% identity thereto.

[0421] 20. The interferon-related antigen binding protein according to item 18, wherein IFNβ or a functional fragment thereof comprises one or two amino acid substitutions relative to SEQ ID NO 14, which are selected from C17S and N80Q.

[0422] 21. The interferon-related antigen binding protein according to item 20, wherein IFNβ or a functional fragment thereof comprises an amino acid substitution C17S relative to SEQ ID NO 14.

[0423] 22. The interferon-related antigen binding protein according to item 21, wherein IFNβ comprises the amino acid sequence shown in SEQ ID NO 15.

[0424] 23. The interferon-related antigen binding protein according to item 20, wherein IFNβ or a functional fragment thereof comprises amino acid substitutions C17S and N80Q relative to SEQ ID NO 14.

[0425] 24. The interferon-related antigen binding protein according to item 23, wherein IFNβ comprises the amino acid sequence shown in SEQ ID NO 16.

[0426] 25. The interferon-related antigen binding protein according to item 13, wherein the IFN or a functional fragment thereof is IFNγ or IFNλ or a functional fragment thereof.

[0427] 26. The interferon-related antigen binding protein according to item 25, wherein the IFN or a functional fragment thereof is IFNγ or a functional fragment thereof.

[0428] 27. The interferon-related antigen binding protein according to item 26, wherein IFNγ comprises the sequence shown in SEQ ID NO 19 or a sequence having at least 90% identity thereto.

[0429] 28. The interferon-related antigen binding protein according to item 25, wherein the IFN or a functional fragment thereof is IFNλ or a functional fragment thereof.

[0430] 29. The interferon-related antigen binding protein according to item 28, wherein IFNλ or a functional fragment thereof is IFNλ2 or a functional fragment thereof.

[0431] 30. The interferon-related antigen binding protein according to item 29, wherein IFNλ2 comprises the sequence shown in SEQ ID NO 18 or a sequence having at least 90% identity thereto.

[0432] 31. An interferon-related antigen binding protein according to any one of the above items, wherein IFN or a functional fragment thereof is non-covalently bound to an agonistic anti-CD40 antibody or an agonistic antigen binding fragment thereof.

[0433] 32. The interferon-related antigen binding protein according to item 31, wherein IFN or a functional fragment thereof is non-covalently bound to an agonistic anti-CD40 antibody or an agonistic antigen binding fragment thereof through ionic, van der Waals forces and / or hydrogen bonding interactions.

[0434] 33. The interferon-related antigen binding protein according to any one of items 1 to 30, wherein IFN or a functional fragment thereof is covalently bound to an agonistic anti-CD40 antibody or an agonistic antigen binding fragment thereof.

[0435] 34. The interferon-related antigen binding protein according to item 33, wherein IFN or a functional fragment thereof is fused to an agonistic anti-CD40 antibody or an agonistic antigen binding fragment thereof.

[0436] 35. The interferon-related antigen binding protein according to item 34, wherein IFN or a functional fragment thereof is fused to the light chain of an agonistic anti-CD40 antibody or an agonistic antigen binding fragment thereof.

[0437] 36. The interferon-related antigen binding protein according to item 35, wherein IFN or a functional fragment thereof is fused to the N-terminus of the light chain of an agonistic anti-CD40 antibody or an agonistic antigen binding fragment thereof.

[0438] 37. The interferon-related antigen binding protein according to item 35, wherein IFN or a functional fragment thereof is fused to the C-terminus of the light chain of an agonistic anti-CD40 antibody or an agonistic antigen binding fragment thereof.

[0439] 38. The interferon-related antigen binding protein according to item 34, wherein IFN or a functional fragment thereof is fused to the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen binding fragment thereof.

[0440] 39. The interferon-related antigen binding protein according to item 38, wherein IFN or a functional fragment thereof is fused to the N-terminus of the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen binding fragment thereof.

[0441] 40. The interferon-related antigen binding protein according to item 38, wherein IFN or a functional fragment thereof is fused to the C-terminus of the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen binding fragment thereof.

[0442] 41. The interferon-related antigen binding protein according to any one of items 34 to 40, wherein the agonistic anti-CD40 antibody or the agonistic antigen-binding fragment thereof and IFN or the functional fragment thereof are fused to each other via a linker.

[0443] 42. An interferon-related antigen binding protein according to item 41, wherein the interferon-related antigen binding protein does not contain amino acids other than those that form (I) the agonist anti-CD40 antibody or its agonist antigen binding fragment, (II) the IFN or its functional fragment and (III) the linker.

[0444] 43. An interferon-related antigen binding protein according to any one of items 1 to 41, wherein the interferon-related antigen binding protein does not contain amino acids other than those that form (I) the agonist anti-CD40 antibody or its agonist antigen binding fragment and (II) the IFN or its functional fragment.

[0445] 44. The interferon-related antigen binding protein according to any one of items 41 to 42, wherein the linker is a peptide linker.

[0446] 45. The interferon-related antigen binding protein according to item 44, wherein the linker comprises at least 1, at least 2, at least 3, at least 4 or at least 5 amino acids.

[0447] 46. ​​The interferon-related antigen binding protein according to item 45, wherein the linker comprises at least 4 amino acids.

[0448] 47. The interferon-related antigen binding protein according to item 45, wherein the linker comprises at least 11 amino acids.

[0449] 48. The interferon-related antigen binding protein according to item 45, wherein the linker comprises at least 12 amino acids.

[0450] 49. The interferon-related antigen binding protein according to item 45, wherein the linker comprises at least 13 amino acids.

[0451] 50. The interferon-related antigen binding protein according to item 45, wherein the linker comprises at least 15 amino acids.

[0452] 51. The interferon-related antigen binding protein according to item 45, wherein the linker comprises at least 20 amino acids.

[0453] 52. The interferon-related antigen binding protein according to item 45, wherein the linker comprises at least 21 amino acids.

[0454] 53. The interferon-related antigen binding protein according to item 45, wherein the linker comprises at least 24 amino acids.

[0455] 54. The interferon-related antigen binding protein according to item 44, wherein the linker comprises up to 10, up to 20, up to 30, up to 40, up to 50, up to 60, up to 70, up to 80, up to 90 or up to 100 amino acids.

[0456] 55. The interferon-related antigen binding protein according to item 54, wherein the linker comprises up to 80 amino acids.

[0457] 56. The interferon-related antigen binding protein according to item 54, wherein the linker comprises up to 40 amino acids.

[0458] 57. The interferon-related antigen binding protein according to item 54, wherein the linker comprises up to 24 amino acids.

[0459] 58. The interferon-related antigen binding protein according to item 54, wherein the linker comprises up to 21 amino acids.

[0460] 59. The interferon-related antigen binding protein according to item 54, wherein the linker comprises up to 20 amino acids.

[0461] 60. The interferon-related antigen binding protein according to item 54, wherein the linker comprises up to 15 amino acids.

[0462] 61. The interferon-related antigen binding protein according to item 54, wherein the linker comprises up to 13 amino acids.

[0463] 62. The interferon-related antigen binding protein according to item 54, wherein the linker comprises up to 12 amino acids.

[0464] 63. The interferon-related antigen binding protein according to item 54, wherein the linker comprises up to 11 amino acids.

[0465] 64. The interferon-related antigen binding protein according to item 54, wherein the linker comprises up to 4 amino acids.

[0466] 65. The interferon-related antigen binding protein according to any one of items 44 to 64, wherein the linker is selected from the group consisting of acidic, basic and neutral linkers.

[0467] 66. The interferon-related antigen binding protein according to item 65, wherein the linker is an acidic linker.

[0468] 67. The interferon-related antigen binding protein according to item 65 or 66, wherein the linker comprises the sequence shown in SEQ ID NO 22 or SEQ ID NO 23.

[0469] 68. The interferon-related antigen binding protein according to item 65, wherein the linker is a basic linker.

[0470] 69. The interferon-related antigen binding protein according to item 65, wherein the linker is a neutral linker.

[0471] 70. The interferon-related antigen binding protein according to item 65 or 69, wherein the linker comprises the sequence shown in SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 24, SEQ ID NO 25 or SEQ ID NO 26.

[0472] 71. The interferon-related antigen binding protein according to any one of items 44 to 70, wherein the linker is selected from a rigid, flexible and helix-forming linker.

[0473] 72. The interferon-related antigen binding protein according to item 71, wherein the linker is a rigid linker.

[0474] 73. The interferon-related antigen binding protein according to item 71 or 72, wherein the linker comprises the sequence shown in SEQ ID NO 20, SEQ ID NO 22 or SEQ ID NO 23.

[0475] 74. The interferon-related antigen binding protein according to item 71, wherein the linker is a flexible linker.

[0476] 75. The interferon-related antigen binding protein according to item 71 or 74, wherein the linker comprises the sequence shown in SEQ ID NO 21, SEQ ID NO 24, SEQ ID NO 25 or SEQ ID NO 26.

[0477] 76. The interferon-related antigen binding protein according to item 71, wherein the linker is a helix-forming linker.

[0478] 77. The interferon-related antigen binding protein according to item 71 or 76, wherein the linker comprises the sequence shown in SEQ ID NO 22 or SEQ ID NO 23.

[0479] 78. An interferon-related antigen binding protein according to any one of items 44 to 66, 68, 69, 71, 72, 74 or 76, wherein the linker comprises the amino acids glycine and serine.

[0480] 79. The interferon-related antigen binding protein according to item 78, wherein the linker comprises the sequence shown in SEQ ID NO 21, SEQ ID NO 24, SEQ ID NO 25 or SEQ ID NO 26.

[0481] 80. The interferon-related antigen binding protein according to item 78, wherein the linker further comprises the amino acid threonine.

[0482] 81. The interferon-related antigen binding protein according to item 80, wherein the linker comprises the sequence shown in SEQ ID NO 21.

[0483] 82. The interferon-related antigen binding protein according to item 44, wherein the linker comprises a sequence selected from the sequences shown in SEQ ID NOs 20 to 26.

[0484] 83. The interferon-related antigen binding protein according to item 82, wherein the linker comprises a sequence selected from the sequence shown in SEQ ID NO 24, SEQ ID NO 25 or SEQ ID NO 26.

[0485] 84. The interferon-related antigen binding protein according to item 83, wherein the linker comprises the sequence shown in SEQ ID NO 24.

[0486] 85. The interferon-related antigen binding protein according to item 83, wherein the linker comprises the sequence shown in SEQ ID NO 25.

[0487] 86. The interferon-related antigen binding protein according to item 83, wherein the linker comprises the sequence shown in SEQ ID NO 26.

[0488] 87. An interferon-related antigen-binding protein according to any one of items 41, 42 or 44 to 86, wherein IFN or a functional fragment thereof is fused to the C-terminus of the heavy chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof via a linker shown in Table 3, specifically Table 3A or Table 3B, more specifically Table 3A.

[0489] 88. The interferon-related antigen binding protein according to item 87, wherein the heavy chain of the agonist anti-CD40 antibody or its agonist antigen binding fragment comprises the sequence shown in SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 49, SEQ ID NO 48 or SEQ ID NO 12.

[0490] 89. The interferon-related antigen binding protein according to item 87 or 88, wherein IFNα2a comprises the sequence shown in SEQ ID NO 17.

[0491] 90. The interferon-related antigen binding protein according to item 87 or 88, wherein IFNβ comprises the sequence shown in SEQ ID NO 14, SEQ ID NO 15 or SEQ ID NO 16.

[0492] 91. The interferon-related antigen binding protein according to item 90, wherein IFNβ comprises the sequence shown in SEQ ID NO 14.

[0493] 92. The interferon-related antigen binding protein according to item 90, wherein IFNβ comprises the sequence shown in SEQ ID NO 15.

[0494] 93. The interferon-related antigen binding protein according to item 90, wherein IFNβ comprises the sequence shown in SEQ ID NO 16.

[0495] 94. The interferon-related antigen binding protein according to item 87 or 88, wherein IFNγ comprises the sequence shown in SEQ ID NO 19.

[0496] 95. The interferon-related antigen binding protein according to item 87 or 88, wherein IFNλ2 comprises the sequence shown in SEQ ID NO 18.

[0497] 96. The interferon-related antigen binding protein according to any one of items 87 to 95, wherein the interferon-related antigen binding protein further comprises a light chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof.

[0498] 97. The interferon-related antigen binding protein according to item 96, wherein the light chain comprises the sequence shown in SEQ ID NO 3.

[0499] 98. An interferon-related antigen-binding protein according to any one of items 41, 42 or 44 to 86, wherein IFN or a functional fragment thereof is fused to the N-terminus of the heavy chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof via a linker shown in Table 4, specifically Table 4A or Table 4B, more specifically Table 4A.

[0500] 99. The interferon-related antigen-binding protein according to item 98, wherein the heavy chain of the agonist anti-CD40 antibody or its agonist antigen-binding fragment comprises the sequence shown in SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 12, SEQ ID NO 48, SEQ ID NO 49 or SEQ ID NO 50, preferably the sequence shown in SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 12, SEQ ID NO 48 or SEQ ID NO 49.

[0501] 100. The interferon-related antigen binding protein according to item 98 or 99, wherein IFNα2a comprises the sequence shown in SEQ ID NO 17.

[0502] 101. The interferon-related antigen binding protein according to item 98 or 99, wherein IFNβ comprises the sequence shown in SEQ ID NO 14, SEQ ID NO 15 or SEQ ID NO 16.

[0503] 102. The interferon-related antigen binding protein according to item 101, wherein IFNβ comprises the sequence shown in SEQ ID NO 14.

[0504] 103. The interferon-related antigen binding protein according to item 101, wherein IFNβ comprises the sequence shown in SEQ ID NO 15.

[0505] 104. The interferon-related antigen binding protein according to item 101, wherein IFNβ comprises the sequence shown in SEQ ID NO 16.

[0506] 105. The interferon-related antigen binding protein according to item 98 or 99, wherein IFNγ comprises the sequence shown in SEQ ID NO 19.

[0507] 106. The interferon-related antigen binding protein according to item 98 or 99, wherein IFNλ2 comprises the sequence shown in SEQ ID NO 18.

[0508] 107. The interferon-related antigen binding protein according to any one of items 98 to 106, wherein the interferon-related antigen binding protein further comprises a light chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof.

[0509] 108. The interferon-related antigen binding protein according to item 107, wherein the light chain comprises the sequence shown in SEQ ID NO 3.

[0510] 109. An interferon-related antigen-binding protein according to any one of items 41, 42 or 44 to 86, wherein IFN or a functional fragment thereof is fused to the C-terminus of the light chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof via a linker shown in Table 5, specifically Table 5A or Table 5B, more specifically Table 5A.

[0511] 110. The interferon-related antigen binding protein according to item 109, wherein the light chain of the agonist anti-CD40 antibody or the agonist antigen binding fragment thereof comprises the sequence shown in SEQ ID NO 3.

[0512] 111. The interferon-related antigen binding protein according to item 109 or 110, wherein IFNα2a comprises the sequence shown in SEQ ID NO17.

[0513] 112. The interferon-related antigen binding protein according to item 109 or 110, wherein IFNβ comprises the sequence shown in SEQ ID NO 14, SEQ ID NO 15 or SEQ ID NO 16.

[0514] 113. The interferon-related antigen binding protein according to item 112, wherein IFNβ comprises the sequence shown in SEQ ID NO 14.

[0515] 114. The interferon-related antigen binding protein according to item 112, wherein IFNβ comprises the sequence shown in SEQ ID NO 15.

[0516] 115. The interferon-related antigen binding protein according to item 112, wherein IFNβ comprises the sequence shown in SEQ ID NO 16.

[0517] 116. The interferon-related antigen binding protein according to item 109 or 110, wherein IFNγ comprises the sequence shown in SEQ ID NO 19.

[0518] 117. The interferon-related antigen binding protein according to item 109 or 110, wherein IFNλ2 comprises the sequence shown in SEQ ID NO18.

[0519] 118. The interferon-related antigen binding protein according to any one of items 109 to 117, wherein the interferon-related antigen binding protein further comprises a heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof.

[0520] 119. The interferon-related antigen binding protein according to item 118, wherein the heavy chain of the agonist anti-CD40 antibody comprises the sequence shown in SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 12, SEQ ID NO 48, SEQ ID NO 49 or SEQ ID NO 50, preferably the sequence shown in SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 12, SEQ ID NO 48 or SEQ ID NO 49.

[0521] 120. An interferon-related antigen binding protein according to any one of items 41, 42 or 44 to 86, wherein IFN is fused to the N-terminus of the light chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof via a linker shown in Table 6, specifically Table 6A or Table 6B, more specifically Table 6A.

[0522] 121. The interferon-related antigen binding protein according to item 120, wherein the light chain of the agonist anti-CD40 antibody or the agonist antigen binding fragment thereof comprises the sequence shown in SEQ ID NO 3.

[0523] 122. The interferon-related antigen binding protein according to item 120 or 121, wherein IFNα2a comprises the sequence shown in SEQ ID NO17.

[0524] 123. The interferon-related antigen binding protein according to item 120 or 121, wherein IFNβ comprises the sequence shown in SEQ ID NO 14, SEQ ID NO 15 or SEQ ID NO 16.

[0525] 124. The interferon-related antigen binding protein according to item 123, wherein IFNβ comprises the sequence shown in SEQ ID NO 14.

[0526] 125. The interferon-related antigen binding protein according to item 123, wherein IFNβ comprises the sequence shown in SEQ ID NO 15.

[0527] 126. The interferon-related antigen binding protein according to item 123, wherein IFNβ comprises the sequence shown in SEQ ID NO 16.

[0528] 127. The interferon-related antigen binding protein according to item 120 or 121, wherein IFNγ comprises the sequence shown in SEQ ID NO19.

[0529] 128. The interferon-related antigen binding protein according to item 120 or 121, wherein IFNλ2 comprises the sequence shown in SEQ ID NO18.

[0530] 129. The interferon-related antigen binding protein according to any one of items 120 to 128, wherein the interferon-related antigen binding protein further comprises a heavy chain of an anti-CD40 antibody or an agonistic antigen-binding fragment thereof.

[0531] 130. The interferon-related antigen binding protein according to item 129, wherein the heavy chain of the agonist anti-CD40 antibody comprises the sequence shown in SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 12, SEQ ID NO 48, SEQ ID NO 49 or SEQ ID NO 50, preferably the sequence shown in SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 12, SEQ ID NO 48 or SEQ ID NO 49.

[0532] 131. An interferon-related antigen binding protein according to any one of items 1 to 130, wherein the interferon-related antigen binding protein comprises a sequence selected from the group consisting of SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46 and SEQ ID NO 47.

[0533] 132. The interferon-related antigen binding protein according to item 131, wherein the interferon-related antigen binding protein comprises a sequence selected from the following: SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42 or SEQ ID NO 43.

[0534] 133. An interferon-related antigen binding protein according to item 131 or 132, wherein the interferon-related antigen binding protein is an agonist anti-CD40 antibody or an agonist antigen binding fragment thereof fused with an interferon comprising one of the sequence combinations disclosed in Table 8, specifically Table 8A or Table 8B, more specifically Table 8A.

[0535] 134. The interferon-related antigen binding protein according to item 133, wherein the interferon-related antigen binding protein is an interferon-fused agonist anti-CD40 antibody or an interferon-fused agonist antigen binding fragment thereof comprising the sequences shown in SEQ ID NO 38 and SEQ ID NO 3.

[0536] 135. The interferon-related antigen binding protein according to item 133, wherein the interferon-related antigen binding protein is an interferon-fused agonist anti-CD40 antibody or an interferon-fused agonist antigen binding fragment thereof comprising the sequences shown in SEQ ID NO 39 and SEQ ID NO 3.

[0537] 136. The interferon-related antigen binding protein according to item 133, wherein the interferon-related antigen binding protein is an interferon-fused agonist anti-CD40 antibody or an interferon-fused agonist antigen binding fragment thereof comprising the sequences shown in SEQ ID NO 40 and SEQ ID NO 3.

[0538] 137. The interferon-related antigen binding protein according to item 133, wherein the interferon-related antigen binding protein is an interferon-fused agonist anti-CD40 antibody or an interferon-fused agonist antigen binding fragment thereof comprising the sequences shown in SEQ ID NO 41 and SEQ ID NO 9.

[0539] 138. The interferon-related antigen binding protein according to item 133, wherein the interferon-related antigen binding protein is an interferon-fused agonist anti-CD40 antibody or an interferon-fused agonist antigen binding fragment thereof comprising the sequences shown in SEQ ID NO 42 and SEQ ID NO 9.

[0540] 139. The interferon-related antigen binding protein according to item 133, wherein the interferon-related antigen binding protein is an interferon-fused agonist anti-CD40 antibody or an interferon-fused agonist antigen binding fragment thereof comprising the sequences shown in SEQ ID NO 43 and SEQ ID NO 9.

[0541] 140. The interferon-related antigen binding protein according to any one of items 1 to 139, wherein the interferon-related antigen binding protein activates both the CD40 and IFN pathways.

[0542] 141. An interferon-related antigen binding protein according to item 140, wherein CD40 activity is determined using a whole blood surface molecule upregulation assay or an in vitro reporter cell assay.

[0543] 142. An interferon-related antigen binding protein according to item 141, wherein an in vitro reporter cell assay is used, optionally using HEK-Blue TM CD40L cells determine CD40 activity.

[0544] 143. An interferon-related antigen binding protein according to any one of items 140 to 142, wherein the interferon-related antigen binding protein has an EC of less than 400, 300, 200, 150, 100, 70, 60, 50, 40, 30, 25, 20 or 15 ng / mL. 50 Activates the CD40 pathway.

[0545] 144. The interferon-related antigen binding protein according to item 143, wherein the interferon-related antigen binding protein has an EC in the range of 10 to 200 ng / mL. 50 Activates the CD40 pathway.

[0546] 145. The interferon-related antigen binding protein according to item 144, wherein the interferon-related antigen binding protein has an EC in the range of 10 to 50 ng / mL, preferably 10 to 30 ng / mL. 50 Activates the CD40 pathway.

[0547] 146. The interferon-related antigen binding protein according to any one of items 140 to 145, wherein the interferon-related antigen binding protein has an EC of less than 100, 60, 50, 40, 30, 20, 10 or 1 ng / mL. 50 Activate the IFN pathway.

[0548] 147. The interferon-related antigen binding protein according to any one of items 140 to 146, wherein the interferon-related antigen binding protein has an EC of less than 11 ng / mL, preferably less than 6 ng / mL. 50 Activate the IFN pathway.

[0549] 148. The interferon-related antigen binding protein according to any one of items 140 to 147, wherein the IFN pathway is the IFNα, IFNβ, IFNε, IFNγ, IFNω or IFNλ pathway.

[0550] 149. The interferon-related antigen binding protein according to item 148, wherein an in vitro reporter cell assay is used, optionally using HEK-Blue TM IFN-α / β cells determine IFNβ activity.

[0551] 150. The interferon-related antigen binding protein according to item 148, wherein an in vitro reporter cell assay is used, optionally using HEK-Blue TM IFN-α / β cells determine IFNα activity.

[0552] 151. An interferon-related antigen binding protein according to item 148, wherein an in vitro reporter cell assay is used, optionally using HEK-Blue TM Dual IFN-γ cells determine IFNγ activity.

[0553] 152. The interferon-related antigen binding protein according to item 148, wherein an in vitro reporter cell assay is used, optionally using HEK-Blue TM IFN-λ cells determine IFNλ activity.

[0554] 153. The interferon-related antigen binding protein according to any of the above items, wherein at 1 ng / mL, the interferon-related antigen binding protein reduces the in vitro HBeAg release of primary hepatocytes by at least 12%.

[0555] 154. The interferon-related antigen binding protein for use according to item 153, wherein at 1 ng / mL, the interferon-related antigen binding protein reduces the in vitro HBeAg release of primary hepatocytes by up to 90%.

[0556] 155. The interferon-related antigen binding protein according to item 153, wherein the interferon-related antigen binding protein has an EC of less than 30 ng / mL. 50 Reduce HBeAg release.

[0557] 156. The interferon-related antigen binding protein according to item 155, wherein the interferon-related antigen binding protein has an EC of less than 10 ng / mL. 50 Reduce HBeAg release.

[0558] 157. The interferon-related antigen binding protein according to item 156, wherein the interferon-related antigen binding protein has an EC of less than 1 ng / mL. 50 Reduce HBeAg release.

[0559] 158. The interferon-related antigen binding protein according to item 156, wherein the interferon-related antigen binding protein has an EC of less than 0.1 ng / mL. 50 Reduce HBeAg release.

[0560] 159. An interferon-related antigen binding protein according to any of the above items, wherein the interferon-related antigen binding protein is capable of upregulating the expression level of one or more IFN pathway biomarkers in HBV-infected cells, preferably by at least 1.5-fold, more preferably by at least 2-fold, and most preferably by at least 3-fold.

[0561] 160. The interferon-related antigen binding protein according to item 159, wherein the IFN pathway biomarker is a chemokine.

[0562] 161. The interferon-related antigen binding protein according to item 160, wherein the IFN pathway biomarker is the interferon-stimulated gene ISG20.

[0563] 162. The interferon-related antigen binding protein according to item 160, wherein the IFN pathway biomarker is a CXC chemokine selected from CXCL9, CXCL10 and CXCL11.

[0564] 163. The interferon-related antigen binding protein according to item 162, wherein the IFN pathway biomarker is CXCL10.

[0565] 164. The interferon-related antigen binding protein according to any of the above items, wherein the interferon-related antigen binding protein does not significantly upregulate the expression level of one or more of IL10, IL1β and IL2 in HBV-infected cells.

[0566] 165. An interferon-related antigen binding protein according to any of the above items, wherein the systemic exposure of the interferon-related antigen binding protein is increased compared to antibody CP870,893, preferably by at least 10%, more preferably by at least 15%, most preferably by at least 25%.

[0567] 166. The interferon-related antigen binding protein according to any of the above items, wherein the systemic exposure of the interferon-related antigen binding protein is at least 1000 μg*h / mL.

[0568] 167. The interferon-related antigen binding protein according to item 166, wherein the systemic exposure of the interferon-related antigen binding protein is in the range of 1033 μg*h / mL to 1793 μg*h / mL.

[0569] 168. The interferon-related antigen binding protein according to any of the above items, wherein the half-life of the interferon-related antigen binding protein is at least 100 h.

[0570] 169. The interferon-related antigen binding protein according to item 168, wherein the half-life of the interferon-related antigen binding protein is in the range of 116 to 158 hours.

[0571] 170. The interferon-related antigen binding protein according to any of the above items, wherein the clearance rate of the interferon-related antigen binding protein is less than 0.5 mL / h / kg.

[0572] 171. The interferon-related antigen binding protein according to item 170, wherein the clearance of the interferon-related antigen binding protein is in the range of 0.28 to 0.49 mL / h / kg.

[0573] 172. The interferon-related antigen binding protein according to any of the above items, wherein the distribution volume Vss of the interferon-related antigen binding protein is lower than 100 mL / kg.

[0574] 173. The interferon-related antigen binding protein according to item 172, wherein the distribution volume Vss of the interferon-related antigen binding protein is in the range of 50 to 98 mL / kg.

[0575] 174. An interferon-related antigen binding protein according to any one of the above items, wherein the interferon-related antigen binding protein is suitable for administration to a subject in need thereof by gene delivery using a nucleic acid sequence encoding the interferon-related antigen binding protein or a vector or vector system encoding the interferon-related antigen binding protein.

[0576] 175. A nucleic acid encoding an interferon-related antigen binding protein as listed in any one of the above items.

[0577] 176. A nucleic acid encoding an IFN or a functional fragment thereof as listed in any one of items 34 to 174 fused to an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof.

[0578] 177. A nucleic acid according to item 176, which encodes an IFN or a functional fragment thereof fused to the light chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof, and also encodes the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof.

[0579] 178. The nucleic acid according to item 177, wherein the heavy chain of the agonist anti-CD40 antibody or its agonist antigen-binding fragment comprises the sequence shown below: SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 48, SEQ ID NO 49 or SEQ ID NO 50, or a nucleic acid sequence that is at least 95% identical to a nucleic acid encoding any of these sequences.

[0580] 179. A nucleic acid according to item 176, which encodes an IFN or a functional fragment thereof fused to the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof, and also encodes the light chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof.

[0581] 180. The nucleic acid according to item 179, wherein the light chain of the agonist anti-CD40 antibody or its agonist antigen-binding fragment comprises the sequence shown in SEQ ID NO 3, SEQ ID NO 4 or SEQ ID NO 5, or a nucleic acid sequence that is at least 95% identical to a nucleic acid encoding any of these sequences.

[0582] 181. A nucleic acid encoding an IFN or a functional fragment thereof fused to an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof according to the sequence shown in any of SEQ ID NOs 28 to 47, or a nucleic acid sequence having at least 95% identity with a nucleic acid encoding any of these sequences.

[0583] 182. The nucleic acid according to items 175 to 181, wherein the nucleic acid further encodes a purification tag.

[0584] 183. The nucleic acid according to item 182, wherein the purification tag is a His-tag.

[0585] 184. A nucleic acid according to item 182 or 183, wherein the nucleic acid further encodes a cleavage site to cut off the purification tag.

[0586] 185. The nucleic acid according to item 184, wherein the nucleic acid comprises a sequence encoding the amino acid sequence shown in SEQ ID NO 27.

[0587] 186. The nucleic acid according to items 175 to 185, wherein the nucleic acid further encodes a signal peptide.

[0588] 187. The nucleic acid according to item 186, wherein the signal peptide is a secretory signal peptide.

[0589] 188. The nucleic acid according to item 186 or 187, wherein the signal peptide comprises the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0590] 189. The nucleic acid according to item 188, wherein the signal peptide comprises the sequence shown in SEQ ID NO: 1.

[0591] 190. The nucleic acid according to item 188, wherein the signal peptide comprises the sequence shown in SEQ ID NO:2.

[0592] 191. A vector or a vector system comprising a nucleic acid according to any of items 175 to 190.

[0593] 192. A vector system comprising

[0594] (I) a first vector comprising a nucleic acid encoding an IFN or a functional fragment thereof fused to the light chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof of an interferon-related antigen-binding protein according to any one of items 1 to 174, and a second vector comprising a nucleic acid encoding the heavy chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof of an interferon-related antigen-binding protein according to any one of items 1 to 174; or

[0595] (II) a first vector comprising a nucleic acid encoding an IFN or a functional fragment thereof fused to the heavy chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof of an interferon-related antigen-binding protein according to any one of items 1 to 174, and a second vector comprising a nucleic acid encoding the light chain of an agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof of an interferon-related antigen-binding protein according to any one of items 1 to 174.

[0596] 193. A vector system comprising

[0597] (I) a first vector according to item 191 for the expression of an IFN or a functional fragment thereof fused to the light chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof, and a second vector for the expression of the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof; or

[0598] (II) a first vector according to item 191 for the expression of IFN or a functional fragment thereof fused to the heavy chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof, and a second vector for the expression of the light chain of an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof.

[0599] 194. A composition comprising an interferon-related antigen binding protein according to any one of items 1 to 174, a nucleic acid according to any one of items 175 to 190, a vector according to item 191 or a vector system according to any one of items 191 to 193.

[0600] 195. The composition according to item 194, wherein the composition is a pharmaceutical composition.

[0601] 196. The composition according to item 195, wherein the pharmaceutical composition is suitable for oral, parenteral or topical administration or administration by inhalation.

[0602] 197. The composition according to item 196, wherein the pharmaceutical composition is suitable for oral administration.

[0603] 198. The composition according to item 196, wherein the pharmaceutical composition is suitable for topical administration.

[0604] 199. The composition according to item 196, wherein the pharmaceutical composition is suitable for administration by inhalation.

[0605] 200. The composition according to item 196, wherein the pharmaceutical composition is suitable for parenteral administration.

[0606] 201. The composition according to item 200, wherein the pharmaceutical composition is suitable for intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal or vaginal administration.

[0607] 202. The composition according to item 201, wherein the pharmaceutical composition is suitable for injection, preferably intravenous or intraarterial injection or infusion.

[0608] 203. A composition according to any one of items 195 to 202, comprising at least one buffer.

[0609] 204. The composition according to item 203, wherein the buffer is acetate, formate or citrate.

[0610] 205. A composition according to item 204, wherein the buffer is acetate.

[0611] 206. The composition according to item 204, wherein the buffer is a formate.

[0612] 207. The composition according to item 204, wherein the buffer is citrate.

[0613] 208. The composition according to any one of items 195 to 207, wherein the pharmaceutical formulation comprises a surfactant.

[0614] 209. The composition according to item 208, wherein the surfactant is selected from pluronics, PEG, sorbitan esters, polysorbates, triton, tromethamine, lecithin, cholesterol and tyloxapal.

[0615] 210. The composition according to item 209, wherein the surfactant is polysorbate.

[0616] 211. The composition according to item 210, wherein the surfactant is polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80 or polysorbate 100.

[0617] 212. The composition according to item 211, wherein the surfactant is polysorbate 20.

[0618] 213. The composition according to item 211, wherein the surfactant is polysorbate 80.

[0619] 214. The composition according to any one of items 195 to 213, comprising a stabilizer, optionally wherein the stabilizer is albumin.

[0620] 215. A host cell comprising a nucleic acid according to any of items 175 to 190, a vector according to item 191 or a vector system according to any of items 191 to 193.

[0621] 216. A method for preparing an interferon-related antigen binding protein according to any one of items 1 to 174, comprising culturing the host cell according to item 215 and recovering the interferon-related antigen binding protein.

[0622] 217. A non-human transgenic animal or transgenic plant comprising a nucleic acid according to any of items 175 to 190, a vector according to item 191 or a vector system according to any of items 191 to 193, wherein the non-human transgenic animal or transgenic plant expresses the nucleic acid.

[0623] 218. A method for preparing an interferon-related antigen binding protein according to any one of items 1 to 174, comprising the step of isolating the interferon-related antigen binding protein from a non-human transgenic animal or transgenic plant according to item 217.

[0624] 219. An interferon-related antigen binding protein according to any one of items 1 to 174, a nucleic acid according to any one of items 175 to 190, a vector according to item 191, a vector system according to any one of items 191 to 193 or a composition according to any one of items 195 to 214 for use as a medicament.

[0625] 220. An interferon-related antigen binding protein according to any one of items 1 to 174, a nucleic acid according to any one of items 175 to 190, a vector according to item 191, a vector system according to any one of items 191 to 193 or a composition according to any one of items 195 to 214 for treating hepatitis B virus (HBV) infection and / or reducing one or more symptoms of HBV infection in a patient.

[0626] 221. An interferon-related antigen binding protein, nucleic acid, vector, vector system or composition for use according to item 220, wherein treating hepatitis B virus (HBV) infection includes reducing one or more symptoms of HBV infection in a patient.

[0627] 222. An interferon-related antigen binding protein according to any one of items 1 to 174, a nucleic acid according to any one of items 175 to 190, a vector according to any one of items 191, a vector system according to any one of items 191 to 193 or a composition according to any one of items 195 to 214 for use in reducing HBV viral load in HBV-infected cell cultures or HBV-infected patients compared to untreated HBV-infected cell cultures or the same patients before treatment.

[0628] 223. An interferon-related antigen binding protein, nucleic acid, vector, vector system or composition for use according to item 222, wherein the HBV viral load is reduced by about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.

[0629] 224. An interferon-related antigen binding protein, nucleic acid, vector, vector system or composition for use according to item 222 or 223, wherein the HBV viral load is determined by PCR or qRT-PCR.

[0630] 225. An interferon-related antigen binding protein according to any one of items 1 to 174, a nucleic acid according to any one of items 175 to 190, a vector according to any one of items 191, a vector system according to any one of items 191 to 193 or a composition according to any one of items 195 to 214 for use in reducing HBV viral titers in HBV-infected cell cultures or HBV-infected patients compared to untreated HBV-infected cell cultures or the same patients before treatment.

[0631] 226. An interferon-related antigen binding protein, nucleic acid, vector, vector system or composition for use according to item 225, wherein the HBV viral titer is reduced by about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.

[0632] 227. An interferon-related antigen binding protein, nucleic acid, vector, vector system or composition for use according to item 225 or 226, wherein the HBV virus titer is determined by PCR or qRT-PCR.

[0633] 228. An interferon-related antigen binding protein according to any one of items 1 to 174, a nucleic acid according to any one of items 175 to 190, a vector according to any one of items 191, a vector system according to any one of items 191 to 193 or a composition according to any one of items 195 to 214 for use in reducing transcription of HBV cccDNA in HBV-infected cell cultures or HBV-infected patients, compared to untreated HBV-infected cell cultures or the same patients before treatment.

[0634] 229. An interferon-related antigen binding protein, nucleic acid, vector, vector system or composition for use according to item 228, wherein the transcription of cccDNA is reduced by about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.

[0635] 230. An interferon-related antigen binding protein, nucleic acid, vector, vector system or composition for use according to item 228 or 229, wherein cccDNA transcription is determined by qPCR.

[0636] 231. An interferon-related antigen binding protein according to any one of items 1 to 174, a nucleic acid according to any one of items 175 to 190, a vector according to any one of items 191, a vector system according to any one of items 191 to 193 or a composition according to any one of items 195 to 214 for use in reducing the level of pregenomic HBV RNA in HBV-infected cell cultures or HBV-infected patients compared to untreated HBV-infected cell cultures or the same patients before treatment.

[0637] 232. An interferon-related antigen binding protein, nucleic acid, vector, vector system or composition for use according to item 231, wherein the level of pregenomic HBV RNA is reduced by about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.

[0638] 233. An interferon-related antigen binding protein, nucleic acid, vector, vector system or composition for use according to item 231 or 232, wherein the level of pregenomic HBV RNA is determined by qRT-PCR.

[0639]

[0640] Table 10A

[0641]

[0642] Table 10B

[0643]

Claims

1. An interferon-related antigen binding protein, comprising (I) an agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof, and (II) interferon (IFN) or a functional fragment thereof, in, The agonistic anti-CD40 antibody or agonistic antigen-binding fragment thereof comprises (a) three light chain complementary determining regions (CDRs) that are at least 90% identical to the CDRL1, CDRL2 and CDRL3 sequences in SEQ ID NO 3; and three heavy chain CDRs that are at least 90% identical to the CDRH1, CDRH2 and CDRH3 sequences in SEQ ID NO 6; wherein each CDR is defined according to the Kabat definition, the Chothia definition, the AbM definition or the contact definition of a CDR; preferably wherein each CDR is defined according to the Kabat definition of a CDR or the Chothia definition of a CDR; (b) three light chain complementary determining regions (CDRs) identical to the CDRL1, CDRL2 and CDRL3 sequences in SEQ ID NO 3; and three heavy chain CDRs identical to the CDRH1, CDRH2 and CDRH3 sequences in SEQ ID NO 6; wherein each CDR is defined according to the Kabat definition, the Chothia definition, the AbM definition or the contact definition of a CDR; preferably wherein each CDR is defined according to the Kabat definition of a CDR or the Chothia definition of a CDR; (c) a heavy chain or fragment thereof, comprising a complementarity determining region (CDR) CDRH1 having at least 90% identity to SEQ ID NO 56, a CDRH2 having at least 90% identity to SEQ ID NO 57, and a CDRH3 having at least 90% identity to SEQ ID NO 58; and a light chain or fragment thereof, comprising a CDRL1 having at least 90% identity to SEQ ID NO 52, a CDRL2 having at least 90% identity to SEQ ID NO 53, and a CDRL3 having at least 90% identity to SEQ ID NO 54; (d) a heavy chain or a fragment thereof, comprising a complementarity determining region (CDR) CDRH1 identical to SEQ ID NO 56, a CDRH2 identical to SEQ ID NO 57, and a CDRH3 identical to SEQ ID NO 58; and a light chain or a fragment thereof, comprising a CDRL1 identical to SEQ ID NO 52, a CDRL2 identical to SEQ ID NO 53, and a CDRL3 identical to SEQ ID NO 54; (e) Light chain variable region V L , the light chain variable region V L comprising the sequence shown in SEQ ID NO 51 or a sequence having at least 90% identity thereto; and / or a heavy chain variable region V H , the heavy chain variable region V H A sequence comprising the sequence shown in SEQ ID NO 55 or a sequence having at least 90% identity thereto; (f) a Fab region heavy chain comprising the amino acid sequence shown in SEQ ID NO 12, or a sequence having at least 90% identity thereto; or (g) a light chain (LC), comprising the sequence shown in SEQ ID NO 3, or a sequence having at least 90% identity thereto; and / or a heavy chain (HC), comprising a sequence selected from the group consisting of SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 49 and SEQ ID NO 48, or a sequence having at least 90% identity thereto.

2. The interferon-related antigen binding protein according to claim 1, wherein The IFN or a functional fragment thereof is selected from the group consisting of type I IFN, type II IFN and type III IFN or a functional fragment thereof.

3. The interferon-related antigen binding protein according to claim 2, wherein The type I IFN or a functional fragment thereof is IFNα or IFNβ or a functional fragment thereof.

4. The interferon-related antigen binding protein according to any one of the preceding claims, wherein IFN or its functional fragment is IFNα2a or its functional fragment; preferably, The IFNα2a comprises the sequence shown in SEQ ID NO 17 or a sequence having at least 90% identity thereto.

5. The interferon-related antigen binding protein according to any one of claims 1 to 3, wherein IFN or its functional fragment is IFNβ or its functional fragment; preferably, The IFNβ comprises the sequence shown in SEQ ID NO 14 or a sequence having at least 90% identity thereto.

6. The interferon-related antigen binding protein according to any one of the preceding claims, wherein IFN or a functional fragment thereof is fused to the light chain of the agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof; preferably wherein, The IFN or a functional fragment thereof is fused to the C-terminus of the light chain of the agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof.

7. The interferon-related antigen binding protein according to any one of claims 1 to 5, wherein IFN or a functional fragment thereof is fused to the heavy chain of the agonistic anti-CD40 antibody or agonistic antigen-binding fragment thereof; preferably wherein, The IFN or a functional fragment thereof is fused to the C-terminus of the heavy chain of the agonistic anti-CD40 antibody or an agonistic antigen-binding fragment thereof.

8. The interferon-related antigen binding protein according to any one of the preceding claims, wherein The agonistic anti-CD40 antibody or its agonistic antigen-binding fragment and IFN or its functional fragment are fused to each other via a linker, and preferably wherein, The linker comprises the sequence shown in SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 24, SEQ ID NO 25 or SEQ ID NO 26.

9. The interferon-related antigen binding protein according to any one of the preceding claims, comprising a sequence selected from the group consisting of SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46 and SEQ ID NO 47.

10. The interferon-related antigen binding protein according to any one of the preceding claims, wherein The interferon-related antigen binding protein is an interferon-fused agonist anti-CD40 antibody or an agonist antigen-binding fragment of an interferon-fused agonist anti-CD40 antibody, wherein the interferon-fused agonist anti-CD40 antibody or the agonist antigen-binding fragment of an interferon-fused agonist anti-CD40 antibody comprises one of the sequence combinations disclosed in Table 8, particularly Table 8A or Table 8B, more particularly Table 8A.

11. A nucleic acid encoding the interferon-related antigen binding protein according to any one of claims 1 to 10, preferably wherein the nucleic acid also encodes a secretory signal peptide. A vector comprising the nucleic acid according to claim 11 .

13. A vector system comprising (I) a first vector comprising a nucleic acid encoding IFN or a functional fragment thereof, wherein the IFN or a functional fragment thereof is fused to the light chain of the agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof of the interferon-related antigen-binding protein according to any one of claims 1 to 10; and a second vector comprising a nucleic acid encoding the heavy chain of the agonist anti-CD40 antibody or an agonist antigen-binding fragment thereof of the interferon-related antigen-binding protein according to any one of claims 1 to 10; or (II) a first vector comprising a nucleic acid encoding IFN or a functional fragment thereof, wherein the IFN or a functional fragment thereof is fused to the heavy chain of the agonist anti-CD40 antibody or the agonist antigen-binding fragment thereof of the interferon-related antigen-binding protein according to any one of claims 1 to 10; and a second vector comprising a nucleic acid encoding the light chain of the agonist anti-CD40 antibody or the agonist antigen-binding fragment thereof of the interferon-related antigen-binding protein according to any one of claims 1 to 10.

14. A composition, preferably a pharmaceutical composition, comprising the interferon-related antigen binding protein according to any one of claims 1 to 10, the nucleic acid according to claim 11, the vector according to claim 12 or the vector system according to claim 13.

15. A host cell comprising the nucleic acid according to claim 11, the vector according to claim 12 or the vector system according to claim 13.

16. A method for preparing the interferon-related antigen binding protein according to any one of claims 1 to 10, comprising culturing the host cell according to claim 14 and recovering the interferon-related antigen binding protein.

17. The interferon-related antigen binding protein according to any one of claims 1 to 10, the nucleic acid according to claim 11, the vector according to claim 12, the vector system according to claim 13 or the composition according to claim 14 for use as a medicament.

18. The interferon-related antigen binding protein according to any one of claims 1 to 10, the nucleic acid according to claim 11, the vector according to claim 12, the vector system according to claim 13 or the composition according to claim 14 for treating hepatitis B virus (HBV) infection in a subject and / or for reducing one or more HBV infection symptoms in a subject.

Images