A method and application of detecting infectious salmon anemia virus in salmon based on RAA-CRISPRCas12a

Abstract

The present invention relates to the field of virus detection technology, and discloses a method and application of detecting infectious salmon anemia virus in salmon based on RAA-CRISPRCas12a, comprising the following steps: dispersing a solution of Cas12a protein, a solution of guide RNA, a solution of ssDNA reporter probe, a ribonuclease inhibitor, nuclease-free water and RAA reactants in a buffer, incubating, and performing fluorescence intensity detection; the amino acid sequence of the Cas12a protein is shown in SEQ ID NO.5. A novel Cas12a protease with better cleavage activity is used in the method of the present invention, which can be successfully applied to the detection of infectious salmon anemia virus in salmon.

Description

Technical Field

[0001] The present invention relates to the technical field of virus detection, and in particular to a method and application of detecting infectious salmon anemia virus in salmon based on RAA-CRISPRCas12a. Background Art

[0002] The CRISPR-Cas system was originally derived from a natural immune mechanism in bacteria and archaea to resist the invasion of foreign genetic material, such as plasmids and bacteriophages. In recent years, the CRISPR-Cas system has attracted widespread attention in the field of biological sciences as a revolutionary gene editing technology. With its simplicity and efficiency, this technology provides a powerful tool for gene editing, gene regulation, and nucleic acid detection. The system uses Cas nucleases and crRNA to guide the recognition and cutting of specific DNA sequences, and has extremely high target specificity. As an emerging detection method, CRISPR-Cas detection technology has shown great application potential in the fields of virus detection, disease diagnosis, metal ion detection, and mycotoxin detection.

[0003] Infectious salmon anaemia virus (ISAV) first appeared in Norway in 1984. It is a marine virus that mainly infects Atlantic salmon (Salmo salar). It can cause severe anemia, varying degrees of bleeding and multi-tissue necrosis. It is a systemic and fatal infectious disease of Atlantic salmon. Infectious salmon anaemia virus is an orthomyxovirus with a diameter of 100-130nm and consists of 8 genome segments. Infectious salmon anaemia is one of the important diseases in the list of aquatic animal diseases of the World Organization for Animal Health (OIE). It is widely prevalent in Europe and North America and is listed as one of the important diseases controlled by the European Community Fish Health Directive. Therefore, the establishment of a rapid and accurate ISAV detection method is of great significance to protecting my country's aquaculture industry.

[0004] At present, CRISPR-Cas detection technology is used to detect viruses. However, since the principle of CRISPR-Cas detection technology is mainly to specifically recognize DNA chains, the existing technology needs to convert RNA into DNA before detecting viruses. After the viral RNA is converted into DNA, it is amplified to improve the accuracy of detection. The results show that although the accuracy of detection can be improved by amplification, the Cas12a variants in the existing technology still face insufficient cutting activity, which limits its accurate detection of infectious salmon anemia virus in practical applications, and ultimately affects the development of aquaculture. Therefore, it is necessary to discover or improve the existing Cas12a protein, and find a new Cas12a protease with better cutting activity and more convenient use, so as to facilitate CRISPR-Cas detection technology to more accurately detect infectious salmon anemia virus. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a method and application for detecting infectious salmon anemia virus in salmon based on RAA-CRISPRCas12a. The method of the present invention uses a new Cas12a protease with better cleavage activity, which can be successfully used to detect infectious salmon anemia virus in salmon.

[0006] The present invention provides a method for detecting infectious salmon anemia virus in salmon based on RAA-CRISPRCas12a, comprising the following steps:

[0007] A solution of Cas12a protein, a solution of guide RNA (crRNA), a solution of ssDNA reporter probe, a ribonuclease inhibitor, nuclease-free water, and RAA reactants were dispersed in a buffer, incubated, and fluorescence intensity was detected;

[0008] The amino acid sequence of the Cas12a protein is shown in SEQ ID NO.5.

[0009] Furthermore, the sequence of the guide RNA is shown as SEQ ID NO.4.

[0010] Further, the nucleotide sequence of the ssDNA reporter probe is TTATT, wherein the N-terminus of the ssDNA reporter probe is modified with a fluorescent group, and the C-terminus of the ssDNA reporter probe is modified with a quenching group;

[0011] The fluorescent group is 5'-FAM;

[0012] The quenching group is 3'-BHQ1.

[0013] Furthermore, the incubation temperature is 36°C-38°C, and the incubation time is 25min-35min.

[0014] Furthermore, the buffer comprises 10 mM Tris-HCl (tris(hydroxymethyl)aminomethane hydrochloride), 10 mM magnesium chloride, 10 mM sodium chloride, and 100 g / mL bovine serum albumin solution (BSA).

[0015] Furthermore, the method for preparing the bovine serum albumin solution is specifically to disperse the bovine serum albumin solution in deionized water.

[0016] Further, by volume, the ratio of the solution of Cas12a protein, the solution of guide RNA, the solution of ssDNA reporter probe, ribonuclease inhibitor, nuclease-free water, RAA reactant and buffer is 2:2:1:1:22:10:2.

[0017] Further, the molar concentration of the solution of the Cas12a protein is 200nM.

[0018] Furthermore, the method for preparing the solution of the Cas12a protein is specifically to dissolve and disperse the Cas12a protein in nuclease-free water.

[0019] Furthermore, the molar concentration of the guide RNA solution is 200 nM.

[0020] Furthermore, the method for preparing the guide RNA solution is specifically to dissolve and disperse the guide RNA in nuclease-free water.

[0021] Furthermore, the molar concentration of the ssDNA reporter probe solution is 200 nM.

[0022] Furthermore, the method for preparing the solution of the ssDNA reporter probe is specifically to dissolve and disperse the ssDNA reporter probe in nuclease-free water.

[0023] Furthermore, the concentration of the ribonuclease inhibitor is 40 U / μL.

[0024] The ribonuclease inhibitor in the present invention was purchased from Sangon Biotech (Shanghai) Co., Ltd., and the CAS number of the product is B600478.

[0025] Furthermore, the fluorescence intensity is detected using an enzyme marker with an excitation wavelength of 480nm-500nm and an emission wavelength of 510nm-540nm.

[0026] Furthermore, the preparation method of the RAA reactant is specifically as follows:

[0027] Based on the cDNA sequence obtained by reverse transcription of the total RNA sequence of infectious salmon anemia virus,

[0028] A RAA primer pair designed based on a cDNA sequence obtained from infectious salmon anemia virus, the RAA primer pair comprising an upstream primer ISAV-RAA-F1 and a downstream primer ISAV-RAA-R1;

[0029] Upstream primer, concentration 10 μM, volume 2 μL; downstream primer, concentration 10 μM, volume 2 μL; buffer A, volume 25 μL; nuclease-free water, volume 13.5 μL; after mixing the above solutions in a tube of reaction dry powder, the above reaction system was divided into 5 parts, and cDNA sequence was added to each reaction system, volume 5 μL; buffer B, volume 2.5 μL.

[0030] Furthermore, the cDNA sequence is shown as SEQ ID NO.1.

[0031] Furthermore, the nucleotide sequence of the upstream primer ISAV-RAA-F1 is shown in SEQ ID No.2.

[0032] Furthermore, the nucleotide sequence of the downstream primer ISAV-RAA-R1 is shown in SEQ ID No.3.

[0033] Furthermore, the reaction temperature in the reaction system is 39° C. and the reaction time is 30 min.

[0034] The present invention also provides the application of the RAA-CRISPRCas12a-based method for detecting infectious salmon anemia virus in salmon in detecting infectious salmon anemia virus in salmon.

[0035] The embodiments of the present invention have the following technical effects:

[0036] 1. In the method of the present invention, when the RAA reactant, crRNA and Cas12a protein form a ternary complex, the cleavage activity of the Cas12a protein will be activated, and the fluorescent group on the ssDNA reporter probe will be cleaved by the Cas12a protein. The Cas12a protein obtained by the present invention has a high cleavage activity. Therefore, for targets with low content, the accuracy of detection can be improved. It can be seen that the Cas12a protein of the present invention can be used to detect infectious salmon anemia virus in salmon.

[0037] 2. The method of the present invention, first, has high sensitivity: due to the combination of the efficient amplification ability of the RAA technology and the high specificity of the Cas12a protein, the method has high detection sensitivity and specificity. Second, good specificity: the detection method of the present invention has good specificity for infectious salmon anemia virus, and has no cross-reaction with other common salmon viruses such as respiratory and enteric viruses, salmon alphavirus, infectious pancreatic necrosis virus, etc., avoiding the occurrence of false positive results. Third, it is simple and easy: the detection method of the present invention does not require the use of complex instruments and equipment, only a constant temperature water bath or metal bath is required, making on-site detection more convenient and easy. Fourth, low cost: the detection method of the present invention does not require the use of precision instruments such as real-time fluorescence PCR instruments, which reduces the detection cost, and can also avoid errors caused by instrument failure or operating errors. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0039] Figure 1 It is the comparative data of the cleavage activity of the Cas12a protein of the present invention provided by the present invention and other proteins.

[0040] Figure 2 It is the effect of the incubation temperature provided by the present invention on the activity of Cas12a protein, wherein the ordinate is the relative fluorescence intensity, the relative fluorescence intensity is to set the highest fluorescence value to 100%, and the rest is calculated according to the percentage of the highest fluorescence value; in addition, a, b, and c in the data graph represent the significance of the data.

[0041] Figure 3 It is the effect of the incubation time provided by the present invention on the activity of Cas12a protein. In the data graph, a, b, and c represent the significance of the data.

[0042] Figure 4 It is the effect of the ratio of crRNA to Cas12a protein provided by the present invention on the activity of Cas12a protein. In the data graph, a, b, and c represent the significance of the data.

[0043] Figure 5 It is the effect of the ssDNA reporter probe concentration provided by the present invention on the activity of Cas12a protein. In the data graph, a, b, and c represent the significance of the data.

[0044] Figure 6It is the specificity of the Cas12a protein provided by the present invention and the infectious salmon anemia virus.

[0045] Figure 7 It is the standard curve of the Cas12a protein provided by the present invention for detecting infectious salmon anemia virus. DETAILED DESCRIPTION

[0046] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0047] In a first aspect, some embodiments of the present invention provide a method for detecting infectious salmon anemia virus in salmon based on RAA-CRISPR Cas12a, comprising the following steps:

[0048] A solution of Cas12a protein, a solution of guide RNA (crRNA), a solution of ssDNA reporter probe, a ribonuclease inhibitor, nuclease-free water, and RAA reactants were dispersed in a buffer, incubated, and fluorescence intensity was detected;

[0049] The amino acid sequence of the Cas12a protein is shown in SEQ ID NO.5.

[0050] In some embodiments, the sequence of the guide RNA is shown as SEQ ID NO.4.

[0051] In some embodiments, the nucleotide sequence of the ssDNA reporter probe is TTATT, wherein the N-terminus of the ssDNA reporter probe is modified with a fluorescent group, and the C-terminus of the ssDNA reporter probe is modified with a quenching group;

[0052] The fluorescent group is 5'-FAM;

[0053] The quenching group is 3'-BHQ1.

[0054] In some embodiments, the incubation temperature is 36° C.-38° C., and the incubation time is 25 min-35 min.

[0055] In some embodiments, the buffer comprises 10 mM Tris-HCl (tris(hydroxymethyl)aminomethane hydrochloride), 10 mM magnesium chloride, 10 mM sodium chloride, and 100 g / mL bovine serum albumin solution (BSA).

[0056] In some embodiments, the method for preparing the bovine serum albumin solution is specifically to disperse the bovine serum albumin solution in deionized water.

[0057] In some embodiments, the ratio of the solution of Cas12a protein, the solution of guide RNA, the solution of ssDNA reporter probe, ribonuclease inhibitor, nuclease-free water, RAA reactant and buffer is 2:2:1:1:22:10:2 by volume.

[0058] In some embodiments, the molar concentration of the solution of the Cas12a protein is 200 nM.

[0059] In some embodiments, the method for preparing the solution of the Cas12a protein is specifically to dissolve and disperse the Cas12a protein in nuclease-free water.

[0060] In some embodiments, the molar concentration of the guide RNA solution is 200 nM.

[0061] In some embodiments, the method for preparing the guide RNA solution is specifically to dissolve and disperse the guide RNA in nuclease-free water.

[0062] In some embodiments, the molar concentration of the ssDNA reporter probe solution is 200 nM.

[0063] In some embodiments, the method for preparing the ssDNA reporter probe solution is specifically to dissolve and disperse the ssDNA reporter probe in nuclease-free water.

[0064] In some embodiments, the concentration of the ribonuclease inhibitor is 40 U / μL.

[0065] In some embodiments, the fluorescence intensity is detected using an enzyme reader with an excitation wavelength of 480nm-500nm and an emission wavelength of 510nm-540nm.

[0066] In some embodiments, the preparation method of the RAA reactant is specifically as follows:

[0067] Based on the cDNA sequence obtained by reverse transcription of the total RNA sequence of infectious salmon anemia virus,

[0068] A RAA primer pair designed based on a cDNA sequence obtained from infectious salmon anemia virus, the RAA primer pair comprising an upstream primer ISAV-RAA-F1 and a downstream primer ISAV-RAA-R1;

[0069] Upstream primer, concentration 10 μM, volume 2 μL; downstream primer, concentration 10 μM, volume 2 μL; buffer A, volume 25 μL; nuclease-free water, volume 13.5 μL; after mixing the above solutions in a tube of reaction dry powder, the above reaction system was divided into 5 parts, and cDNA sequence was added to each reaction system, volume 5 μL; buffer B, volume 2.5 μL.

[0070] In some embodiments, the cDNA sequence is shown as SEQ ID NO.1.

[0071] In some embodiments, the nucleotide sequence of the upstream primer ISAV-RAA-F1 is shown as SEQ ID No.2.

[0072] In some embodiments, the nucleotide sequence of the downstream primer ISAV-RAA-R1 is shown as SEQ ID No.3.

[0073] In some embodiments, the reaction temperature in the reaction system is 39° C. and the reaction time is 30 min.

[0074] In a second aspect, some embodiments of the present invention also provide the application of the RAA-CRISPRCas12a-based method for detecting infectious salmon anemia virus in salmon in detecting infectious salmon anemia virus in salmon.

[0075] The following is described in detail with reference to specific embodiments:

[0076] Embodiment 1:

[0077] (1) cDNA sequence design

[0078] The infectious salmon anemia virus gene with the ID number NO.DQ785286 in the GenBank database was selected as the target gene fragment for identification. The conservative segment was found through GenBank analysis and BLAST comparison, and primers were designed in the conservative segment.

[0079] The total RNA of infectious salmon anemia virus extracted from salmon was reverse transcribed into cDNA (cDNA is the conserved segment) by M-MLV ReverseTranscriptase, and the sequence of cDNA is shown in SEQ ID NO.1:

[0080] cDNA sequence (SEQ ID NO.1):

[0081] 5'-CCAGAAGGGAAAATGGTGAAAGTCAAAACCTTGAACCAATTGGTGAACGGAATGATCAGTCGAGCGACGATGACTCTCTACTGTGTGATGAAAGATCCACCGTCTGGAAGCATGGCGACACTGATGAG-3'.

[0082] (2) Primer design based on the conserved sequence of infectious salmon anemia virus:

[0083] In the RAA nucleic acid amplification system of the present invention, the nucleotide sequence of the upstream primer (ISAV-RAA-F1) is shown in SEQ ID NO.2, and the base sequence of the downstream primer (ISAV-RAA-R1) is shown in SEQ ID NO.3:

[0084] Upstream primer ISAV-RAA-F1 (SEQ ID NO.2):

[0085] 5'-CCAGAAGGGAAAATGGTGAAAGTCA-3';

[0086] Downstream primer ISAV-RAA-R1 (SEQ ID NO.3):

[0087] 5'-CTCATCAGTGTCGCCATGCTTCCAG-3'.

[0088] (3) Design of crRNA

[0089] The corresponding crRNA was designed based on the cDNA sequence of infectious salmon anemia virus obtained by reverse transcription and used in the detection system.

[0090] Sequence of crRNA (SEQ ID NO.4):

[0091] 5'-UAAUUUCUACUAAGUGUAGAUUUCACCAAUUGGUUCAAGGUUU-3';

[0092] (4) Design of ssDNA reporter probe

[0093] The specific probe base sequence of the infectious salmon anemia virus provided by the invention is TTATT, the 5' end of the ssDNA reporter probe is marked with a FAM fluorescent reporter group, and the 3' end is marked with a BHQ1 fluorescent quencher group.

[0094] The sequence of the ssDNA reporter probe is TTATT;

[0095] (5) Extraction of total RNA of infectious salmon anemia virus:

[0096] The total RNA of infectious salmon anemia virus was extracted using an RNA extraction kit. The entire step was performed according to the instructions of the FreeZolReagent RNA extraction kit. The specific steps are as follows:

[0097] 1) Take 500 μL of the tissue grinding supernatant to 1.5 mL and add it into a 1.5 mL EP tube.

[0098] 2) Add 100 μL of Dilution Buffer to the EP tube, cover the tube tightly, and vortex until the solution is fully mixed to dilute the sample and make it easier for subsequent processing.

[0099] 3) Let stand at room temperature for 5 minutes to allow the solution to be fully mixed for subsequent processing.

[0100] 4) Centrifuge at 10,000 rpm for 15 minutes at room temperature. This step is to separate impurities such as proteins, DNA, and polysaccharides, so that they precipitate to the bottom of the tube, while RNA is distributed in the upper solution.

[0101] 5) Carefully remove the centrifuge tube and pipette the supernatant solution (about 500 μL) into a new 1.5 mL centrifuge tube to collect the upper solution containing RNA.

[0102] 6) Add an equal volume of isopropanol to the supernatant solution, mix thoroughly by inverting, and let stand at room temperature for 10 minutes to promote RNA precipitation.

[0103] 7) Centrifuge at 10,000 rpm for 10 minutes. After centrifugation, white gel-like precipitate can be seen on the side and bottom of the tube. Carefully discard the supernatant without losing the precipitate, and collect the RNA precipitate.

[0104] 8) Add 1 mL of 75% ethanol, flick the bottom of the tube to suspend the precipitate, and invert it upside down several times to wash the RNA precipitate and remove residual impurities.

[0105] 9) Centrifuge at 9000rpm for 3min, discard the supernatant, do not lose the precipitate, and collect the RNA precipitate again.

[0106] 10) Repeat steps 6) and 7) and discard the supernatant to ensure the purity of the RNA precipitate.

[0107] 11) Leave at room temperature for 1 min, add 20-100 μL RNase-free ddH2O (nuclease-free water), and vortex at room temperature for 3 min to fully dissolve the RNA precipitate for use in subsequent experiments.

[0108] (6) Synthesis of cDNA

[0109] The extracted total RNA of infectious salmon anemia virus was used to prepare the reaction system according to Table 1. The reaction procedure was 37°C for 1 h or 72°C for 15 min. The product was directly used for subsequent experiments or stored at -80°C for future use.

[0110] Table 1 Components of the reverse transcription system kit

[0111]

[0112] (7) Establishment of RAA reaction system

[0113] Use the basic RAA nucleic acid amplification kit and prepare the reaction system according to the kit instructions (Table 2). Mix the reaction solution in a tube of reaction dry powder and react at 39°C for 30 minutes.

[0114] Table 2 RAA nucleic acid amplification system

[0115]

[0116] (8) Selection of Cas12a protein:

[0117] Amino acid sequence of Cas12a protein (SEQ ID NO.5):

[0118]

[0119] (9) Determination of CRISPR / Cas12a detection system

[0120] According to Table 3, nuclease-free water, a solution of Cas12a protein, a buffer, a solution of ssDNA reporter probe, a ribonuclease inhibitor (at a concentration of 40U / μL), and crRNA were added to the reaction tube in sequence, and the mixture was mixed by low-speed rotation on a vortexer and reacted at 37°C for 20min. The fluorescence value of the reacted system was determined in a multifunctional microplate reader, and the excitation wavelength of the microplate reader was 480-500nm, and the emission wavelength was 510-540nm, and the fluorescence value of the sample to be tested was detected.

[0121] The buffer may be a buffer having a formula of: 10 mM Tris-HCl, 10 mM magnesium chloride, 10 mM sodium chloride, and 100 g / mL bovine serum albumin (BSA).

[0122] Table 3 CRISPR / Cas12a reaction system

[0123]

[0124] Results and Analysis:

[0125] The cleavage activities of different Cas12a proteins are compared, LbCas12a (commercially available) and AsCas12a (commercially available) are selected as the control group of the present invention, and then the method of the present invention is used to compare with the BaCas12a (i.e., the Cas12a protein of the present invention) in the present invention, and it is applied in the CRISPR-Cas12a detection system, and the reaction temperature is set to 37 DEG C, and it is transferred to the ELISA plate after 20min of water bath according to the set temperature successively, and the fluorescence intensity value with an excitation wavelength of 494nm and an emission wavelength of 525nm is measured using an ELISA instrument, and the cleavage activity of different Cas12a proteases is judged according to the fluorescence value obtained.

[0126] The results are as follows Figure 1 As shown, it was found that the cleavage activities of different Cas12a proteins were different, and the cleavage activity of the Cas12a protease in the present invention was significantly better than that of other Cas12a proteins. When the activity of Cas12a protein cleavage is higher, when the target infectious salmon anemia virus content is low, when the RAA reactant, crRNA and Cas12a protein can also form a ternary complex, the cleavage activity of Cas12a protein can also be activated.

[0127] The incubation temperature during the detection process will affect the Cas12a protein cleavage activity. When the incubation temperature is too high or too low, it will cause the denaturation or inactivation of the Cas12a protein. Therefore, the appropriate incubation temperature is the basis for the Cas12a protein to exert cleavage activity. In the present invention, the incubation temperatures are set to be 25 ° C, 30 ° C, 37 ° C, 40 ° C, and 45 ° C, respectively. The CRISPR-Cas12a detection system is configured, and the ELISA plate is transferred to the set temperature water bath for 20 min, and the fluorescence intensity value with an excitation wavelength of 494 nm and an emission wavelength of 525 nm is measured using an ELISA instrument.

[0128] The results are as follows Figure 2 As shown, the relative fluorescence intensity value of Cas12a protein continues to rise in the temperature range of 25°C-37°C, and the cutting activity slowly increases; it reaches the highest point at 37°C, and the cutting activity is the largest; after 37°C, the relative fluorescence intensity value begins to decline, and begins to decline sharply between 40°C-45°C, and the cutting activity also continues to decrease. Therefore, it is further preferred that the optimal reaction temperature of Cas12a protein is 37°C.

[0129] In the detection system, incubation time that is too long or too short will affect the function of Cas12a protein, resulting in poor gene editing effect; appropriate incubation time can ensure that Cas12a protein is fully expressed and correctly folded, and improve the efficiency of cutting fluorescent reporter probes. Set the incubation time to 10min, 20min, 30min, 40min, and 50min respectively. Configure the CRISPR-Cas12a detection system, and use a microplate reader to measure the fluorescence intensity value after the incubation time set in a 37°C water bath.

[0130] The results are as follows Figure 3 As shown, the relative fluorescence intensity value of Cas12a protein increases with the incubation time. When the incubation time is 50min, the relative fluorescence intensity value is the largest, and the Cas12a protein cutting activity is the largest. When the incubation time of Cas12a protein is within 20min, it has an obvious cutting effect. The side proves that the Cas12a protein in the present invention has a higher activity, can reduce the incubation time, thereby improving the detection efficiency. The incubation time is not less than 20min, and it is further preferred that the incubation time is 20min-50min; further preferably, the incubation time is 20min.

[0131] crRNA and Cas12a protein form a complex that can recognize specific target gene sequences and guide Cas12a protein to perform precise ssDNA reporter probe cutting. If the ratio of crRNA to Cas12a protein is too high, it may cause excessive competition of crRNA, reduce the efficiency of Cas12a protein binding to target gene sequence, and thus reduce cutting activity; on the contrary, if the ratio is too low, it may cause Cas12a protein to fail to be effectively activated, which will also affect its cutting activity. In order to achieve the best Cas12a protein cutting activity, it is necessary to optimize the ratio of crRNA:Cas12a protein in the experimental design to ensure that enough crRNA is used to recognize the target sequence and effectively activate the Cas12a protein, while avoiding excessive use of crRNA to cause competition effects, so as to maximize the cutting efficiency of Cas12a protein.

[0132] The ratio of crRNA:Cas12a protein was optimized, and the volume ratios of crRNA:Cas12a were set to 0.5:1, 0.75:1, 1:1, 1:1.5, and 2:1. The CRISPR-Cas12a detection system was configured, and the fluorescence intensity value was measured using an ELISA instrument after incubation at 37°C for 20 minutes.

[0133] Depend on Figure 4 It can be seen that as the ratio of crRNA:Cas12a increases, the relative fluorescence intensity value also increases continuously. When crRNA:Cas12a is 1:1, the relative fluorescence intensity value is the largest, and the Cas12a protein cleavage activity is the largest. After that, as the ratio of crRNA:Cas12a increases, the relative fluorescence intensity value continues to decrease. Further preferably, the volume ratio of crRNA:Cas12a is 1:1.

[0134] Generally speaking, when the concentration of ssDNA reporter probe increases, the rate and affinity of Cas12a protein binding to target DNA can be promoted, thereby enhancing the cutting activity of Cas12a protein. Because ssDNA reporter probe can act as an auxiliary factor to help Cas12a protein stabilize the binding of target DNA to itself, making it easier for Cas12a protein to complete cutting. When ssDNA reporter probe is added to a certain amount, its promoting effect on Cas12a protein reaches a balance, and more addition can only increase the cost of detection.

[0135] The concentration of ssDNA reporter probe was optimized, with cDNA of infectious salmon anemia virus as the target DNA, and the concentration of ssDNA reporter probe was set to 100nM, 150nM, 200nM, 250nM, and 300nM. The CRISPR-Cas12a detection system was configured, and after incubation at 37°C for 20 minutes, the fluorescence intensity value was measured using an enzyme reader.

[0136] Depend on Figure 5 It can be seen that as the concentration of the ssDNA reporter probe increases, the relative fluorescence intensity value also increases continuously, and when the concentration of the ssDNA reporter probe is 300 nM, the relative fluorescence intensity value is the maximum. More preferably, the concentration of the ssDNA reporter probe is 200 nM.

[0137] In order to verify the specificity of crRNA of infectious salmon anemia virus cDNA, specificity detection was carried out. Three common viruses in salmon were selected, namely salmon alphavirus, infectious salmon anemia virus and infectious pancreatic necrosis virus, and 4 systems were set up for CRISPR-Cas12a detection. The first was a blank group, the second was the RAA amplification system with only salmon alphavirus added, the third system was the RAA amplification system with only infectious salmon anemia virus added, and the fourth system was the RAA amplification system with only infectious pancreatic necrosis virus added. After incubation in a 37°C water bath for 20 minutes, the cells were transferred to an ELISA plate and the fluorescence intensity values ​​with an excitation wavelength of 494nm and an emission wavelength of 525nm were measured using an ELISA instrument. Figure 6 As shown, only when the crRNA corresponding to the infectious salmon anemia virus exists can the Cas12a protein in the system be activated to produce trans-cutting activity and emit fluorescence, while other virus systems cannot be activated.

[0138] The preparation methods of the RAA amplification system of salmon alphavirus and the RAA amplification system of infectious pancreatic necrosis virus adopt the preparation method of the kit of the present invention, the cDNA sequence of salmon alphavirus is SEQ ID NO.6, and the cDNA sequence of infectious pancreatic necrosis virus is SEQ ID NO.7;

[0139] SEQ ID NO.6:

[0140] 5'-GCAACATTGCCGATCTGAGGTGGCTTGCCCTGGGTGATACTGGCAGCCGTTAGGACTGGCTCCTCACACGTAAACGTCTGGGAGTCGCTGGTGAAAGTGACGGTTGCCAAGTCAGCGCTCTTGCATTTCTTGTCGAATTTCACTGTGGTACCAGGTGGCACCCTCACTGTGCACTGGCTGTCGTTGCATGTTACG-3';

[0141] SEQ ID NO.7:

[0142] TCCAAAGCTCCACACTACCGGCCGGTCTCTATGCTCTGAACGGGACGCTCAACGCTGCCACCTTCGAAGGCAGTCTGTCTGAGGTGGA.

[0143] The infectious salmon anemia virus detection method based on RAA combined with CRISPR / Cas12a established in this experiment has good specificity and can be used to specifically detect infectious salmon anemia virus in salmon.

[0144] The detection limit of infectious salmon anemia virus was determined, and infectious salmon anemia virus RAA reactants with different concentrations were prepared. The concentrations of the infectious salmon anemia virus RAA reactants were 0 fg / μL, 5 fg / μL, 10 fg / μL, 20 fg / μL, 50 fg / μL, 100 fg / μL, 150 fg / μL, and 200 fg / μL. The detection was performed according to the method of the present invention, and then a linear fitting graph was performed with the concentration of the infectious salmon anemia virus RAA reactant as the abscissa and the fluorescence intensity as the ordinate, as shown in FIG. Figure 7 As shown, the linear curve is y=19.891x+218.27, R 2 =0.9961, and the minimum detection limit of infectious salmon anemia virus is calculated to be 2.02 fg / μL. The method of the present invention is used to detect the infectious salmon anemia virus RAA reactant with a known concentration of 65 fg / μL, and the fluorescence intensity is measured to be 1511 a.u., which is brought into the linear curve of the present invention, and the concentration of infectious salmon anemia virus in the infectious salmon anemia virus RAA reactant is calculated to be 64.99 fg / μL. It can be seen that the present invention can accurately detect infectious salmon anemia virus.

[0145] It should be noted that the terms used in the present invention are only for describing specific embodiments, rather than limiting the scope of the present application. As shown in the present specification, unless the context clearly indicates an exception, the words "one", "a", "a kind of" and / or "the" do not specifically refer to the singular, but may also include the plural. The terms "include", "comprise" or any other variant thereof are intended to cover non-exclusive inclusion, so that the process, method or device including a series of elements includes not only those elements, but also includes other elements not explicitly listed, or also includes elements inherent to such process, method or device. In the absence of more restrictions, the elements defined by the sentence "include one..." do not exclude the presence of other identical elements in the process, method or device including the elements.

[0146] It should also be noted that the terms "center", "up", "down", "left", "right", "vertical", "horizontal", "inside", "outside", etc., indicating the orientation or positional relationship, are based on the orientation or positional relationship shown in the drawings, and are only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as a limitation on the present invention. Unless otherwise clearly specified and limited, the terms "installed", "connected", "connected", etc. should be understood in a broad sense, for example, it can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be a direct connection, or it can be an indirect connection through an intermediate medium, or it can be a connection between the two elements. For those of ordinary skill in the art, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.

[0147] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the technical solutions of the embodiments of the present invention.

Claims

1. A method for detecting infectious salmon anemia virus in salmon based on RAA-CRISPRCas12a, characterized in that: The steps include: A solution of Cas12a protein, a solution of guide RNA, a solution of ssDNA reporter probe, a ribonuclease inhibitor, nuclease-free water, and RAA reactants were dispersed in a buffer, incubated, and fluorescence intensity was detected; The amino acid sequence of the Cas12a protein is shown in SEQ ID NO.5; The preparation method of the RAA reactant is specifically as follows: Based on the cDNA sequence obtained by reverse transcription of the total RNA sequence of infectious salmon anemia virus, A RAA primer pair designed based on a cDNA sequence obtained from infectious salmon anemia virus, the RAA primer pair comprising an upstream primer ISAV-RAA-F1 and a downstream primer ISAV-RAA-R1; Upstream primer, concentration 10 μM, volume 2 μL; downstream primer, concentration 10 μM, volume 2 μL; buffer A, volume 25 μL; nuclease-free water, volume 13.5 μL; cDNA sequence, volume 5 μL; buffer B, volume 2.5 μL; mix the above solutions in a tube of reaction powder and react at a reaction temperature of 39°C for 30 min; The cDNA sequence is shown in SEQ ID NO.1; The nucleotide sequence of the upstream primer ISAV-RAA-F1 is shown in SEQ ID No.2; The nucleotide sequence of the downstream primer ISAV-RAA-R1 is shown in SEQ ID No.3; The sequence of the guide RNA is shown in SEQ ID NO.4; The method is for non-disease diagnosis and / or non-treatment purposes.

2. The method according to claim 1, characterized in that The nucleotide sequence of the ssDNA reporter probe is TTATT, wherein the N-terminus of the ssDNA reporter probe is modified with a fluorescent group, and the C-terminus of the ssDNA reporter probe is modified with a quenching group; The fluorescent group is 5'-FAM; The quenching group is 3'-BHQ1.

3. The method according to claim 1, characterized in that The incubation temperature is 36°C-38°C, and the incubation time is 25min-35min; The fluorescence intensity was detected using an enzyme marker, with an excitation wavelength of 480nm-500nm and an emission wavelength of 510nm-540nm.

4. The method according to claim 1, characterized in that: The ratio of Cas12a protein solution, guide RNA solution, ssDNA reporter probe solution, ribonuclease inhibitor, nuclease-free water, RAA reactant and buffer was 2:2:1:1:22:10:2 by volume; The molar concentration of the solution of the Cas12a protein is 200nM; The molar concentration of the guide RNA solution is 200 nM; The molar concentration of the ssDNA reporter probe solution is 200 nM; The concentration of the ribonuclease inhibitor is 40 U / μL.

5. Application of the method for detecting infectious salmon anemia virus in salmon based on RAA-CRISPR Cas12a as described in any one of claims 1-4 in detecting infectious salmon anemia virus in salmon; the application is for non-disease diagnosis purposes and / or non-therapeutic purposes.

Images