MBTD1 gene molecular marker related to body weight and body size of goose and application of MBTD1 gene molecular marker

Abstract

The invention discloses an MBTD1 gene molecular marker related to the body weight and body size of a goose and application of the MBTD1 gene molecular marker. The molecular marker is located at the 6290111th site of the 18th chromosome of the goose, and the site polymorphism is C or A. The polymorphic site is remarkably related to the body weight and body size characters of the geese, can accurately judge the final change of the body weight and body size in the future development process of the geese, can be used for early screening of the body weight and body size characters of the geese, greatly reduces the screening cost, accelerates the genetic breeding process, effectively improves the breeding efficiency, and has broad application prospects. The method has high economic application value and scientific research value.

Description

Technical Field

[0001] The invention relates to the technical field of goose genetic breeding, and in particular to an MBTD1 gene molecular marker related to goose weight and body size and an application thereof. Background Art

[0002] Geese are one of the largest edible poultry species currently raised. Body weight and body size are significantly correlated with the growth rate, weight gain and body shape characteristics of geese, and are key indicators for evaluating the production performance of geese. Among them, body weight directly affects consumers' consumption choices and the economic benefits of enterprises. It is the most important economic trait of geese and has been widely studied in the genetic breeding of geese. Body size traits such as breast depth and semi-submerged length are also important growth traits of geese, which are significantly correlated with body weight and can reflect the growth potential, maturity and production capacity of geese.

[0003] When breeding geese based on their weight and size, accurate weight and size data must be obtained until the goslings reach sexual maturity, and then the individual breeding value is determined based on the obtained data, and then the individual is selected or eliminated. This method has a long breeding cycle, high cost, and low breeding efficiency. Summary of the invention

[0004] The purpose of the present invention is to provide a MBTD1 gene molecular marker related to goose weight and body size in view of the above-mentioned deficiencies in the prior art. By detecting the polymorphism of the molecular marker, the weight and body size traits of the goose can be quickly determined at an early stage, thereby improving breeding efficiency.

[0005] The technical solution of the present invention is described in detail as follows:

[0006] In the first aspect, the present invention provides a MBTD1 gene molecular marker related to goose weight and body size, the molecular marker is located at position 6290111 of chromosome 18 of the goose, and the site polymorphism is C or A. When the SNP (single nucleotide polymorphism) site is A, the goose has a larger weight and body size trait.

[0007] It should be understood that the MBTD1 gene molecular marker of the present invention can be a genomic fragment of any length containing the SNP site 6290111 of chromosome 18 of the goose, as long as the primers designed for it as the target gene can amplify the SNP site. The target gene is generally between 200-700 bp in length.

[0008] Optionally or preferably, the nucleotide sequence of the MBTD1 gene molecular marker is as shown in SEQ ID NO.1, and the SNP site is located at the 302nd position of the nucleotide sequence.

[0009] In a second aspect, the present invention provides the use of the MBTD1 gene molecular marker in goose genetic breeding, which is used to screen or identify geese with large body weight and size. Geese with large body weight and size can be screened in advance as breeding objects in the gosling stage.

[0010] In a third aspect, the present invention provides the above-mentioned reagent for molecular labeling of MBTD1 gene, wherein the reagent comprises a primer pair having a nucleotide sequence as shown in SEQ ID NO. 2-3.

[0011] In a fourth aspect, the present invention provides the use of the above reagent for detecting MBTD1 gene molecular markers in goose genetic breeding, for screening or identifying geese with large body weight and size.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] The present invention screens out a SNP molecular marker related to goose weight and body size, which is located at position 6290111 (Chr18:6290111) of chromosome 18 of the goose and is a part of the MBTD1 gene. The present invention also provides a target sequence SEQ ID NO.1 containing the SNP site, which can accurately obtain the polymorphism of the above site by detecting with designed primers, and then can more accurately judge the final changes in the weight and body size of the goose in the future development process according to its polymorphic characteristics, which can be used for early screening of goose weight and body size traits, greatly reducing screening costs and effectively improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The Manhattan plot and QQ plot of the genome-wide association analysis of goose body length in the embodiment;

[0015] Figure 2 The Manhattan plot and QQ plot of the genome-wide association analysis of goose semi-diving in the embodiment;

[0016] Figure 3 The Manhattan plot and QQ plot of the genome-wide association analysis of goose breast depth in the embodiment;

[0017] Figure 4 The electrophoresis result diagram of PCR performed on the sample to be tested using the primers of the present invention;

[0018] Figure 5 This is the sequencing result of PCR amplification products of different samples with genotypes CC, CA and AA. DETAILED DESCRIPTION

[0019] In order to make the technical personnel in this field better understand the present application scheme, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the described embodiments are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work should belong to the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.

[0020] Example 1

[0021] Blood samples and two body size traits data, including body weight, chest depth and semi-diving length, were collected from 504 lionhead geese (adult geese) from a goose farm in Shantou City, Guangdong Province. TM The sequencing system obtains raw sequencing data through second-generation whole-genome resequencing.

[0022] To ensure the quality and accuracy of the data, the original genome sequencing data of 504 lion-headed geese were subjected to strict quality control. First, SOAPnuke (v1.5.0) software was used to filter the data and remove low-quality sequences. Then, the filtered sequences were aligned to the swan goose reference genome using BWA (v0.7.17) software to identify SNPs. Finally, GATK (v4.2.3.0) software was used to further screen and filter the SNPs, and Plink (v1.90b6.21) software was used to perform quality control and extraction of these SNPs, retaining the minimum allele frequency (MAF) as >0.05, and passing the Hardy-Weinberg equilibrium test (p<10 -6 ), and SNPs in the autosomes, and finally 8486076 SNP sites were obtained.

[0023] Combined with the phenotypic data, the linear mixed model (LMM) in the GEMMA (v0.98.1) software was used to construct a genome-wide association matrix and a genome-wide association study (GWAS) for all traits (weight, chest depth, and semi-diving length). GWAS is one of the methods to study the genetic mechanism of complex traits. It mainly determines the genetic factors that affect phenotypic traits by analyzing the association between phenotypic traits and genetic variation. According to the results of GWAS, we converted the P value of each SNP site to -log(P), and the threshold of significant SNP was 0.05 / n (n is the number of SNPs on each chromosome). Finally, significant SNPs were screened for the next step of analysis, and the CMplot package of the R language was used to draw the Manhattan plot and Quantile-Quantile plot (QQ plot), see. Figure 1-3 .

[0024] The significant SNPs within a distance of 1.5 Mb were merged into a candidate region, and the candidate regions of all traits (weight, chest depth and semi-diving length) were fine-mapped using BFMAP (v0.65) software to predict the posterior probabilities of all SNPs in the candidate region.

[0025] Combining the results of GWAS with those of fine-mapping, we screened out the Chr18:6290111 polymorphic site in the traits of body weight, chest depth and semi-diving length. The signals of this site were significant in both GWAS and fine-mapping of different traits.

[0026] Table 1 P values ​​and fine-mapping posterior probabilities of Chr18::6290111 polymorphic sites in GWAS of different traits

[0027]

[0028] The association analysis between Chr18::6290111 polymorphic site and body weight and size is shown in Table 2 below.

[0029] Table 2 Association analysis between Chr18::6290111 polymorphic locus and body weight and size

[0030]

[0031] Note: The values ​​marked with different letters are significantly different, while the values ​​marked with the same letter are not significantly different.

[0032] In both male and female goose groups, this locus was significantly associated with body weight, breast depth and semi-submerged length.

[0033] In this embodiment, the molecular marker nucleotide sequence of the intercepted Chr18:6290111 polymorphic site is as follows:

[0034] TGTTTGAATGTCTTTAATATTATATGTAGTTTTGTGGTGCTTGGTCAACTTTCATACTATGTTGTGTTAATTTTAGTTAAATCTACCAGAGAAAAATACGTGATAAATCATTTTTAAAACTTAAGTGTTTTTCTTTTTTTTCCCCCCACAG TGACTTTTTTCAAAAAAGTTGCATCAGAAATATGCTACAGATCTATGGAAATTTTCGGGTTGGAGTTTGGAAAGGCTTTATTACTTAGCTTTTTGTTGTTGTTTTAGGGTAAACCTCCAACAAAAAAGGCTAAAGTTCTACAAAAACAAC CATTGGTGGCTAAATTAGCAGCATATGCTCAGTACCAAGCAACTTTACAAAACCAGGCAAAGACTAAAGCAGGTAATGGCACATAAACAGCTAAAACAAATTCTGAGCAATACAAGATTTATGTTTCATTAGCAGCTTCCTAAATGAAATAAC TTTCTCTTAACAGCTGTCCCTGTGGAAGGTTTCAGCTGGGGTAACTACATCAATAGCAATAGCTTTACAGCAGCTCCTGTCACCTGTTTTAAACATGTAAGTATTTTTCAATGCGTTAGTCTTTTGTGTGTGTGTATCTGCATGCATGC(SEQ ID NO.1).

[0035] In the above nucleotide sequence, the 302nd polymorphic site is C or A. The TurkeyHSD multiple comparison results found that when the marker mutated to A, the goose had a larger weight, chest depth and semi-diving length, and this trend was more obvious in the male goose group.

[0036] In summary, by collecting blood samples from lion-head geese, using DNBSEQ TM The sequencing system was used for sequencing, and SOAPnuke was used to filter the quality of the sequencing data and remove low-quality sequences. Then, the filtered sequences were aligned to the swan goose reference genome using BWA to identify SNPs. Finally, GATK was used to further screen and filter the SNPs, and Plink was used to perform quality control and extraction on these SNPs to obtain the genotype data set. Combined with its phenotypic measurement data, GEMMA software was used to adopt a single-marker LMM model to screen out the main effect genes and functional mutation sites related to four body size traits such as weight, breast depth and semi-diving length of Lionhead geese, providing new SNP sites for the breeding selection of weight, breast depth and semi-diving length of Lionhead geese.

[0037] Chr18:6290111 polymorphic site detection: MBTD1 gene sequence was found from https: / / www.ncbi.nlm.nih.gov / , and primer pairs were designed using Primer premier 5.0 software. The primer pair information is shown in Table 3 (primer sequence 5'→3'). The designed primer pair sequence was sent to Sangon Biotech for synthesis, and the primer pair was used to perform PCR on blood DNA to test the specificity of the primers. The results are attached. Figure 4 shown.

[0038] Table 3 Primer information for screening Chr18::6290111 polymorphic site

[0039] F:TTGTGGTGCTTGGTCAACT(SEQ ID NO.2) R:AGGAGCTGCTGTAAAGCTATTG(SEQ ID NO.3)

[0040] Two DNA samples of each genotype were randomly selected, and a total of six DNA samples were amplified by PCR. The PCR products obtained were sent to Sangon Biotech for sequencing. The genotypes of the Chr18:6290111 locus obtained by sequencing were CC, CA, and AA, which were consistent with the genotypes obtained by the second-generation genome sequencing of the individual. The sequencing results are attached. Figure 5 shown.

[0041] The invention concept is described in detail using specific examples herein, and the description of the above embodiments is only used to help understand the core idea of ​​the invention. It should be pointed out that any obvious modification, equivalent substitution or other improvement made by a person of ordinary skill in the art without departing from the invention concept should be included in the protection scope of the present invention.

Claims

1. A MBTD1 gene molecular marker related to goose weight and body size, characterized in that: The molecular marker is located at position 6290111 of chromosome 18 of the goose, and the site polymorphism is C or A.

2. The nucleotide sequence of the MBTD1 gene molecular marker according to claim 1, characterized in that: The sequence is shown in SEQ ID NO.1, and the SNP site is located at the 302nd position of the nucleotide sequence.

3. Use of the MBTD1 gene molecular marker according to claim 1 or 2 in goose genetic breeding, for screening or identifying geese with large body weight and size.

4. A reagent for detecting the MBTD1 gene molecular marker according to claim 1 or 2, characterized in that: The reagents include a primer pair whose nucleotide sequences are shown as SEQ ID NOs. 2-3.

5. Use of the reagent for detecting MBTD1 gene molecular markers according to claim 4 in goose genetic breeding, for screening or identifying geese with large body weight and size.

Images