Primer set of microsatellite marker HA88 related to the growth of Hippocampus abdominalis and its application
By designing the primer set of microsatellite labeled HA88 related to the growth of the bulging hippocampus, a 245bp specific fragment was screened using PCR amplification and capillary electrophoresis technology, solving the problem of differences in the growth rate of the bulging hippocampus, achieving rapid breeding of high growth rates, and improving breeding efficiency.
Patent Information
- Application Number
- CN202411651616.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-19
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2044-11-19
AI Technical Summary
During the breeding of bulging hippocampus, there are differences in the growth rate of the same group of hippocampus individuals, and there is a lack of effective molecular marking methods to assist in the selection and breeding of rapidly growing lines.
A primer set of microsatellite labeled HA88 associated with bloated hippocampus growth was designed and applied, and a specific fragment of 245 bp was screened through PCR amplification and capillary electrophoresis technology to breed individuals with faster growth rates.
Efficient screening and breeding of growth traits of bloated hippocampus has been achieved, breeding years have been shortened, breeding process has been accelerated, and breeding efficiency has been improved.
Smart Images

Figure CN119287033B_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of fish DNA marker technology and its applications, and specifically relates to a primer set related to the microsatellite marker HA88 for the growth of Hippocampus abdominalis and its applications. Background Art
[0002] Hippocampus abdominalis is a special marine cultured fish introduced into China in recent years, with high nutritional and medicinal values. During the actual production and breeding process, the phenomenon of inconsistent specifications has occurred in the same batch of seahorses, that is, within the same breeding cycle, there are differences in the growth rates of individuals in the same batch of seahorses. The average weight of the seahorses with rapid growth at 1 month old is 0.260 g heavier than that of the slow-growing seahorses, and the average body length is 2.533 cm longer. The breeding growth rate of seahorses has a significant impact on improving the enthusiasm of farmers and promoting the development of the Hippocampus abdominalis breeding industry. Growth is an important economic and technical indicator. Selecting a strain of Hippocampus abdominalis with fast growth can effectively shorten the breeding cycle, reduce breeding costs, and increase breeding income.
[0003] Molecular marker-assisted breeding is to directly select and breed individuals with alleles or genotypes with trait advantages by means of molecular markers closely related to traits. Compared with traditional breeding methods, molecular marker-assisted selection has a large amount of information, is not easily affected by the environment, has a large selection intensity, and high selection efficiency and accuracy. Among common molecular marker technologies, microsatellite molecular markers (simple sequence repeats, SSR) are widely and randomly distributed in the genome, and have the advantages of co-dominant inheritance, high polymorphism, good stability, and simple operation, and have been widely used in the breeding research of aquatic animals.
[0004] Using molecular marker-assisted breeding to cultivate Hippocampus abdominalis with fast-growing traits is an important way to reduce costs and improve economic benefits. At present, the screening of SSR markers for seahorses mainly focuses on variety identification, and there is less research on growth. There is no report at home and abroad on the molecular marker research of seahorse growth traits. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a primer set related to the microsatellite marker HA88 for the growth of Hippocampus abdominalis and its applications.
[0006] The present invention is realized by the following technical solutions:
[0007] A primer set related to the microsatellite marker HA88 for the growth of Hippocampus abdominalis, wherein the forward primer sequence in the primer set is GACGCCATTAAGCAGTGACA (SEQ ID NO.1), and the reverse primer sequence is CCATGACACAATTTCAAGCG (SEQ ID NO.2).
[0008] The present invention also provides the application of the primer set in the selective breeding of the growth traits of the big-bellied seahorse. The application method is to perform PCR amplification on the DNA of big-bellied seahorse individuals using the primer set, and screen individuals capable of amplifying a specific fragment size of 245 bp as the basic parents to produce heterozygous or homozygous individuals with this fragment, and the offspring have a faster growth rate.
[0009] Furthermore, the PCR reaction system is 50 μL: 1 μL of DNA solution, 1 μL of upstream primer, 1 μL of downstream primer, 25 μL of 2×HS Taq PreMix (Tianlu Diagnostic Group, TOROIVD), and 22 μL of sterilized double-distilled water.
[0010] Furthermore, the PCR amplification reaction conditions are: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, for a total of 35 cycles; extension at 72 °C for 10 min.
[0011] The beneficial effects of the present invention compared with the prior art: The present invention obtains for the first time a molecular marker related to the growth of the big-bellied seahorse, and uses the primer set in the selective breeding of the growth traits of the big-bellied seahorse for the selective breeding of fast-growing varieties. Compared with the conventional breeding method, this method can shorten the breeding period, accelerate the breeding process, and improve the breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Figure 1 Electrophoresis diagram and peak diagram of the banding situation of microsatellite markers in groups F and S (pooled population);
[0013] Figure 2 Electrophoresis diagram of the band distribution of microsatellite markers in groups F and S (all individuals);
[0014] Figure 3 Electrophoresis diagram of the amplification band pattern of HA88 in the DNA pools of 46 full-sib families;
[0015] Figure 4 Electrophoresis diagram of the amplification band pattern of HA88 in 30 individuals of family A08. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0016] The technical solutions of the present invention will be further explained below through examples in combination with the drawings, but the protection scope of the present invention is not limited by any form of the examples. Unless otherwise specified, the experimental methods used in the examples are all conventional methods and techniques well known to those skilled in the art, and the materials and reagents are obtained through commercial purchases.
[0017] Example 1
[0018] 1. Obtaining materials related to the growth traits of the big-bellied seahorse
[0019] The experimental seahorses were obtained from Weihai Yinze Biotechnology Co., Ltd. Approximately 10,000 juvenile seahorses of Hippocampus abdominalis (body length 1.6 ± 0.2 cm, body weight 0.008 ± 0.002 g) produced on the same day were placed in the same breeding pool for 30 days. During the experiment, they were fed normally, and the water temperature was maintained at 18 ± 0.5 °C, the salinity was 30 ppt, and the dissolved oxygen was > 6.0 mg / L. After the experiment ended, feeding was stopped for 24 h. 1,000 seahorses were randomly scooped from the breeding pool to measure the growth indices, and the body weight of each seahorse was recorded. 60 seahorses with a body weight greater than 0.2 g and 60 seahorses with a body weight less than 0.1 g were selected.
[0020] After the measurement, the seahorse samples were placed in absolute ethanol and then frozen in an -80 °C refrigerator for later use. 60 seahorses with a fast growth rate were selected as the fast growth rate group (Group F), and 60 seahorses with a slow growth rate were selected as the slow growth rate group (Group S). The T-test was used to verify whether there was a significant difference between the two groups.
[0021] 2. Microsatellite primers
[0022] Based on the genomic data of Hippocampus abdominalis (https: / / ngdc.cncb.ac.cn / gwh / Assembly / 18745 / show), the microsatellite identification tool MISA was used to search for microsatellite loci. 95 microsatellite loci were selected, and primers were designed according to their flanking conserved sequences. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0023] 3. Extraction and detection of genomic DNA
[0024] The Tiangen Marine Animal DNA Extraction Kit was used to extract the tissue DNA of 60 seahorses in each of Group F and Group S of Hippocampus abdominalis. 1% agarose gel electrophoresis was used to determine the quality and integrity of the extracted DNA, and a UV spectrophotometer was used for concentration determination. It was diluted to 50 ng / μL with double-distilled water, and the DNA was stored at -80 °C for later use.
[0025] 4. Establishment of BSA gene pools
[0026] 30 samples with the fastest growth rate in Group F were selected, and 5 μL of DNA solution of equal amount was taken from each sample and mixed to form a fast growth gene pool (F pool). Similarly, 30 samples with the slowest growth rate in Group S were selected, and 5 μL of DNA solution of equal amount was taken from each sample and mixed to form a slow growth gene pool (S pool).
[0027] 5. Screening of microsatellite markers
[0028] Two DNA pools were subjected to PCR amplification using 95 pairs of microsatellite primers. PCR reaction system: 1 μL of DNA solution, 1 μL of forward primer, 1 μL of reverse primer, 25 μL of 2×HS Taq PreMix (Tianlu Diagnostic Group, TOROIVD), and 22 μL of sterilized double-distilled water. PCR amplification reaction conditions: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, reaction at the actual annealing temperature of each pair of primers for 30 s, extension at 72 °C for 30 s, a total of 35 cycles, and extension at 72 °C for 10 min.
[0029] The PCR products were electrophoresed using a FragmentAnalyzer TM automated capillary electrophoresis system with a sample loading volume of 2 μL, a constant voltage of 6 kV, and electrophoresis for 1 h. After electrophoresis, the results were analyzed using ProSize data analysis software. By analyzing the PCR amplification of the DNA in the two gene pools, 1 microsatellite locus that could amplify different allele fragments in the two pools was initially screened out, as Figure 1 shown.
[0030] 6. Preliminary verification of microsatellite markers
[0031] Using the technical means in step 4 (PCR amplification and capillary electrophoresis), the differential banding of 1 microsatellite marker in groups F and S was analyzed, and Pearson tests were performed on the frequencies of the differential bands. Finally, 1 microsatellite marker HA88 with significant differences was obtained. Forward primer: GACGCCATTAAGCAGTGACA (SEQ ID NO.1), reverse primer: CCATGACACAATTTCAAGCG (SEQ ID NO.2).
[0032] As Figure 2 and Table 1 show, the frequency of the 245-bp fragment of this marker was 35 in group F and 24 in group S. Pearson correlation analysis showed that this fragment was significantly correlated with the growth of Hippocampus abdominalis. The specific statistical data and the results of the correlation analysis are shown in Table 1.
[0033] Table 1 Statistics of the occurrence times of the HA88 allele fragment in the individual amplification band patterns
[0034]
[0035]
[0036] 7. Re-verification of family individuals
[0037] The primers of microsatellite locus HA88 were used to perform PCR amplification on the DNA of 46 family pools, and capillary gel electrophoresis was carried out. The results showed that the 245bp band of locus HA88 appeared in 37 families ( Figure 3 ). One family with significant growth differences was selected from these 37 families. Fifteen samples with the fastest growth rate (group F) and 15 samples with the slowest growth rate (group S) were selected from this family. SSR differential band analysis was performed on all individuals in the family, and the amplification of the 245bp differential alleles in group F and group S in the family was counted ( Figure 4 ). The results are shown in Table 2. After Pearson test, there was a significant positive correlation between the differential alleles of family A8 and growth traits (P<0.05), further verifying the significant correlation between microsatellite locus HA88 and the growth traits of the belly-swollen seahorse.
[0038] Table 2 Statistical table of the occurrence times of HA88 allele fragments in the amplification band patterns of individuals in family A8
[0039]
[0040] Example 2: Application of microsatellite markers for growth traits in the breeding of high-growth rate strains of the belly-swollen seahorse
[0041] Before the intensification of broodstock, a part of the dorsal fin of the candidate parent was cut and fixed in 95% absolute ethanol for low-temperature preservation for genomic DNA extraction. The DNA extraction and detection, PCR and capillary electrophoresis procedures, and electrophoresis result analysis were as described in Example 1. Individuals with a 245bp band genotype were selected as the basic parents to construct a core breeding population, and their offspring were collected for cultivation. 1000 seahorses were randomly fished out regularly every month for body weight measurement, and the measurement was carried out 5 times continuously. The body weights of the offspring of the common breeding population in the same period were measured in the same way. The results showed that under the same aquaculture management conditions, the offspring of the core breeding population with 245bp band parents always had a faster growth rate than the offspring of the common population at different developmental stages. The results are shown in Table 3;
[0042] Table 3 Mean body weights of offspring of the core breeding population and the common breeding population at different developmental stages
[0043]
Claims
1. The application of the primer set in the breeding of growth traits of hippocampus bulging, characterized in that: The nucleotide sequence of the primer set is shown in SEQ ID NO.1-2. The application method is to use the primer set to perform PCR amplification on the DNA of Hippocampus inflatus individuals, screen individuals that can amplify a specific fragment with a size of 245bp as basic parents, and produce heterozygous individuals or homozygous individuals having the fragment.
2. The use according to claim 1, characterized in that: The PCR reaction system is 50 μL: 1 μL DNA solution, 1 μL upstream primer, 1 μL downstream primer, 25 μL 2× HS Taq PreMix, and 22 μL sterilized double distilled water.
3. The use according to claim 1, characterized in that: The amplification reaction conditions of the PCR were as follows: pre-denaturation at 94° C. for 5 min; denaturation at 94° C. for 30 s, annealing at 55° C. for 30 s, and extension at 72° C. for 30 s, for a total of 35 cycles; and extension at 72° C. for 10 min.
Citation Information
Patent Citations
Microsatellite marker related to growth traits of hippocampus kelloggi and application of microsatellite marker
CN117025788A
Application of diplotype of hippocampus japonicus body weight associated SNP (Single Nucleotide Polymorphism) site in breeding
CN118497370A