SNP (Single Nucleotide Polymorphism) molecular marker related to procyanidine content character of apple and application thereof

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to procyanidine content character of apples and application of the SNP molecular marker, and belongs to the technical field of genetic breeding of the apples. The SNP molecular marker related to the procyanidine content character of the apple comprises three SNP sites which are respectively positioned at the 2nd, 107th and 657th sites, the 2nd, 107th and 668 sites and the 2nd, 107th and 716th sites of the 16th chromosome of a reference genome GDDH13v1.1 of the golden-crown apple, and allelic genes of the SNP molecular marker are A, T or T or G, C and C. According to the invention, the SNP molecular marker influencing the procyanidine content of the apple is analyzed and identified by utilizing GWAS, and if the-log10 (p) value of the SNP molecular marker is greater than 8, the SNP molecular marker is remarkably related to the procyanidine content character of the apple. On the basis of the SNP site provided by the invention, the dominant genotype beneficial for improving the procyanidine content of the apple is selected for apple breeding, so that the cross breeding period can be effectively shortened, and accurate and efficient breeding is realized.

Description

Technical Field

[0001] The invention belongs to the technical field of apple genetic breeding, and relates to a SNP molecular marker related to apple proanthocyanidin content traits and an application thereof. Background Art

[0002] Proanthocyanidins are a class of polyphenolic compounds produced by plants through the flavonoid pathway. Structurally, proanthocyanidins are a mixture of polyphenols formed by the combination of different amounts of catechins or epicatechins. Heating in an acidic medium can produce anthocyanidins. Proanthocyanidins have the functions of anti-cancer, prevention and treatment of vascular sclerosis, anti-aging, and enhancing the body's immunity. Apple fruits are rich in nutrients such as sugars, organic acids, and polyphenols. Among its polyphenolic compounds, proanthocyanidins account for the largest proportion. Proanthocyanidins are abundant in the fruits of wild species and wild relatives of the genus Malus, while their content is generally low in modern apple cultivars. Although the content of proanthocyanidins is affected by the maturity period and environmental factors, its genetic factors play a major role. Therefore, exploring the genetic factors related to the content of proanthocyanidins is of great significance for the breeding of high-quality apple varieties with high anthocyanin content.

[0003] Molecular marker technology is a genetic marker method based on DNA sequence variation, which is widely used in genetic breeding, gene positioning, species kinship identification and other fields. Single nucleotide polymorphism (SNP) refers to the DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level, including the conversion, transversion, insertion or deletion of a single base pair. SNP has the characteristics of high density, genetic stability, and ease of automation and large-scale detection in the genome, and has developed into a more common molecular marker in animal genetic variation research. In recent years, molecular markers related to apple color, polysaccharides, malic acid, fruit shape, etc. have been developed and utilized, but molecular markers for proanthocyanidin content have not been reported. Therefore, it is very important to study a molecular marker related to proanthocyanidin content for the creation of new apple germplasm. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides SNP molecular markers related to the proanthocyanidin content trait of apple and their applications. The SNP molecular markers related to the proanthocyanidin content trait of apple include three SNP sites, which are located at positions 2,107,657, 2,107,668 and 2,107,716 of chromosome 16 of the Golden Delicious apple reference genome GDDH13 v1.1, and their alleles are A, T, T or G, C, C. The -log of the SNP molecular markers of the present invention 10The (p) value is greater than 8, indicating that it is significantly correlated with the apple proanthocyanidin content trait. The genotype of the apple genome at the three SNP sites is A, T, T homozygous or A, T, T / G, C, C heterozygous, and the apple proanthocyanidin content is relatively high; the genotype of the apple genome at the three SNP sites is G, C, C homozygous, and the apple proanthocyanidin content is relatively low. The SNP sites provided by the present invention can be used for predicting the content of proanthocyanidins in apple fruits at the seedling stage in apple breeding, and provide assistance for the establishment of an apple molecular marker-assisted breeding technology system.

[0005] To achieve the technical purpose of the present invention, on the one hand, the present invention provides SNP molecular markers related to the apple proanthocyanidin content trait, wherein the SNP molecular markers comprise three SNP sites, which are respectively located at positions 2,107,657, 2,107,668 and 2,107,716 of chromosome 16 of the Golden Crown apple reference genome GDDH13v1.1, and the three SNP sites are highly linked, and their alleles are A, T, T or G, C, C.

[0006] Furthermore, in the SNP molecular markers provided by the present invention, the genotypes of the three SNP sites are A, T, T homozygous apples, and the content of proanthocyanidin B2 is 33989.93-22301683.17 ng / g; the genotypes of the three SNP sites are A, T, T / G, C, C heterozygous apples, and the content of proanthocyanidin B2 is 58921.96-18842104.41 ng / g; the genotypes of the three SNP sites are G, C, C homozygous apples, and the content of proanthocyanidin B2 is 86304.96-13252022.20 ng / g.

[0007] Specifically, the present invention found through genome-wide association analysis that the SNP site associated with the proanthocyanidin B1 and B2 content traits was significantly located on chromosome 16 of the Golden Delicious apple reference genome GDDH13 v1.1 version, and combined with the genome annotation information, it was found that the SNP site was located in the promoter of the MdMYB7 gene. The SNP site located in the promoter region of the MdMYB7 gene is significantly correlated with the proanthocyanidin content.

[0008] On the other hand, the present invention requests protection for the use of the above-mentioned SNP sites in identifying or breeding high-anthocyanin content apple varieties, wherein the genotype of the high-anthocyanin content apple varieties at the three SNP sites is A, T, T homozygous or A, T, T / G, C, C heterozygous.

[0009] On the other hand, the present invention claims protection for a set of primers for detecting the above-mentioned SNP site, wherein the upstream primer is GGCCCATAACTATAGCGTTACAACA, and the downstream primer is CTATCATTTCTCGTGTGCCCACA.

[0010] On the other hand, the present invention claims protection for a kit comprising the above primer set for detecting the genotype of the SNP site at position 2,107,716 on chromosome 16 of the Golden Delicious apple reference genome GDDH13 v1.1.

[0011] In addition, the present invention claims a method for identifying or breeding high-quality anthocyanin apple varieties, comprising the following steps:

[0012] S1. Extracting genomic DNA from the apple plant to be tested;

[0013] S2. Perform PCR amplification using the above primer set to obtain a PCR amplification product;

[0014] S3, sequencing the PCR amplification product to obtain a sequencing result, or digesting the PCR product with restriction endonuclease XmnI, and then displaying the result by agarose gel electrophoresis;

[0015] S4. Compare the sequencing results or agarose gel electrophoresis results to determine the proanthocyanidin content of the fruit of the tested apple plant.

[0016] Furthermore, the genotype of the highland anthocyanin content apple variety at the three SNP sites is A, T, T homozygous or A, T, T / G, C, C heterozygous. The nucleotide sequence of the amplified product is at least one of SEQ ID NO:1 and SEQ ID NO:2.

[0017] Furthermore, the agarose gel electrophoresis results showed a band with a length of 788bp, indicating that the genotype of the apple variety at the three SNP sites was A, T, T homozygous; the agarose gel electrophoresis results showed bands with lengths of 557bp and 232bp, indicating that the genotype of the apple variety at the three SNP sites was G, C, C homozygous; the agarose gel electrophoresis results showed three bands with lengths of 788bp, 557bp and 232bp, indicating that the genotype of the apple variety at the three SNP sites was A, T, T / G, C, C heterozygous.

[0018] Specifically, the accuracy rate of predicting the proanthocyanidin content by identifying the SNP molecular markers related to the proanthocyanidin content trait through the above method in the present invention is 86.95%.

[0019] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0020] (1) The SNP loci provided by the present invention are significantly correlated with the proanthocyanidin content trait of apple. The present invention found through genome-wide association analysis that the SNP loci associated with the proanthocyanidin B1 and B2 content traits were significantly located on chromosome 16 of the Golden Delicious apple reference genome GDDH13 v1.1. Combined with the genome annotation information, it was found that the SNP loci were located on the promoter of the MdMYB7 gene. The -log 10 The (p) value was greater than 8, indicating a significant correlation with the proanthocyanidin content trait of apple. The SNP site located in the promoter region of the MdMYB7 gene was significantly correlated with the proanthocyanidin content.

[0021] (2) The present invention provides a method for identifying or breeding high-anthocyanin content apple varieties, using a primer set for detecting SNP sites, which can be used for predicting the content of proanthocyanidins in apple fruits at the seedling stage in apple breeding, and provide assistance for the establishment of an apple molecular marker-assisted breeding technology system. The accuracy of the present invention in identifying the genotype at the SNP molecular marker related to the proanthocyanidin content trait through this method is 91.30%.

[0022] (3) The present invention provides a new technical idea for the selection of high-quality anthocyanin content apple germplasm materials from the perspective of molecular biology, laying a foundation for the genetic improvement of apple proanthocyanidin content. The SNP loci of the present invention can be applied to the identification and variety selection of high-quality anthocyanin content apple germplasm materials, which can effectively improve the accuracy and efficiency of selection in breeding, reduce the workload of breeding, and shorten the breeding cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present invention.

[0024] Figure 1 The Manhattan plot, QQ plot and Manhattan plot of whole genome association analysis combined with genome annotation information are the result plots. Figure 1 A in the figure is the Manhattan plot of SNP loci related to proanthocyanidin B1 content; Figure 1 B in the figure is the QQ plot of the SNP loci related to the content of proanthocyanidin B1; Figure 1 C in the figure is the Manhattan plot of SNP loci related to proanthocyanidin B2 content; Figure 1 D in the figure is the QQ plot of the SNP loci related to the proanthocyanidin B2 content; Figure 1 E in the figure is the result graph obtained by combining the Manhattan graph with the genome annotation information.

[0025] Figure 2It is a scatter box plot of the contents of proanthocyanidin B1 and proanthocyanidin B2 under different genotypes. Figure 2 A in the figure is a scatter box plot of the proanthocyanidin B1 content under different genotypes; Figure 2 B in the figure is a scatter plot of the proanthocyanidin B2 content under different genotypes.

[0026] Figure 3 The agarose gel electrophoresis results of PCR amplification products of 23 apple samples. DETAILED DESCRIPTION

[0027] The technical scheme of the present invention is described below in conjunction with the embodiments, but the present invention is not limited to the following embodiments. The experimental methods and detection methods described in each embodiment are conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0028] Example 1

[0029] This example provides screening of SNP sites associated with proanthocyanidin content.

[0030] 120 apple germplasm resources were collected (Table 1), and the proanthocyanidin content (proanthocyanidin B1 content and proanthocyanidin B2 content) of mature fruits of different germplasm resources was determined by high performance liquid chromatography (Table 1). Genome wide association study (GWAS) was also used to determine the SNP loci associated with the proanthocyanidin content trait in the fruit. DNA was extracted from the leaves of each germplasm resource by the CTAB method. According to the instructions of NEBNext Ultra DNA Library PrepKit (purchased from New England Biotechnology (Beijing) Co., Ltd.), at least 5 μg of genomic DNA was used for each sample to construct a sequencing library, and the sequencing was performed using an Illumina HiSeq 4000 sequencer. The sequencing results were aligned with the Golden Crown apple reference genome GDDH13 v1.1 version, and the Hapl otypeCaller (GATK (version 3.8)) developed by McKenna et al. (2010) was used to detect SNP variations. The GEMMA software package was used for association analysis, and the mixed linear model (MLM) was used for GWAS research. SNPs were identified and annotated using the ANNOVAR software package developed by Wang et al. (2010). Manhattan plots, QQ plots, and gene annotation plots were drawn using the CMplot package (Yin L, 2018). Figure 1), and the Bonferroni correction was used as the threshold for the association between SNP and traits (Jian et al.; Xu et al., 2015). Three SNP loci associated with the proanthocyanidin B1 and B2 content traits were obtained through genome-wide association analysis, which were located at positions 2,107,657, 2,107,668 and 2,107,716 on chromosome 16 of the Golden Crown apple reference genome GDDH13 v1.1 version. The alleles at the above SNP loci were A, T, T or G, C, C, respectively. The genotypes of apples from different germplasm resources at the SNP molecular markers are shown in Table 1. Table 1: Proanthocyanidin B1, B2 content and genotypes at SNP molecular markers in apples from different germplasm resources

[0031]

[0032]

[0033]

[0034] As shown in Table 1, the content of proanthocyanidin B2 in mature apple fruit is relatively rich, and the content of proanthocyanidin B2 is significantly higher than that of proanthocyanidin B1. The lowest content of proanthocyanidin B2 is 33989.93 ng /

[0035] g, with the highest being 22301683.17 ng / g. The variation range of proanthocyanidin content in apple fruits among different germplasms was relatively large.

[0036] The coefficient of variation was 115.99%. The proanthocyanidin B2 content of apples with homozygous genotypes of A, T, and T at the three SNP sites was 33989.93-22301683.17 ng / g; the proanthocyanidin B2 content of apples with heterozygous genotypes of A, T, T / G, C, and C at the three SNP sites was 58921.96-18842104.41 ng / g; the proanthocyanidin B2 content of apples with homozygous genotypes of G, C, and C at the three SNP sites was 86304.96-13252022.20 ng / g. In addition, the proanthocyanidin B2 content in the fruits of wild apple resources was high, and the proanthocyanidin B2 content in the fruits of cultivated apple resources was low, which was consistent with the trend of apple domestication and improvement. The content of proanthocyanidins in the fruits of natural populations basically conformed to the normal distribution. These results indicate that the content of proanthocyanidins in fruit is a typical quantitative trait controlled by micro-effect polygenes.

[0037] Depend on Figure 1It can be seen that the SNP loci related to the content of proanthocyanidins B1 and B2 were significantly located on chromosome 16 of the Golden Crown apple reference genome GDDH13 v1.1 through whole genome association analysis. Combined with the genome annotation information, it was found that the SNP loci were located on the promoter of the MdMYB7 gene. The -log 10 (p) values ​​greater than 8 indicate a significant correlation with the proanthocyanidin content of apple. Figure 2 It can be seen that the SNP site located in the promoter region of the MdMYB7 gene is significantly correlated with the content of proanthocyanidins.

[0038] Example 2

[0039] This example provides a method for identifying the genotype at the SNP molecular marker associated with the proanthocyanidin content.

[0040] The SNP molecular markers related to proanthocyanidin content include three SNP sites, which are highly linked. Enzyme digestion of one of the SNP sites can confirm the genotype at the SNP marker. The genotypes of 23 apple germplasm resources at 2,107,716bp (the third SNP site) of chromosome 16 of the Golden Crown apple reference genome GDDH13 v1.1 were detected by PCR amplification (Table 2). The genomic DNA of the apple to be tested was used as a template, and the primer pairs upstream and downstream of the SNP site were used as amplification primers (primer F: GGCCCATAACTATAGCGTTACAACA; primer R: CTATCATTTCTCGTGT GCCCACA). PCR amplification was performed, and the amplification product was at least one of SEQ ID NO: 1 and SEQ ID NO: 2. The amplification program was: 95℃5min; 95℃15s; 55℃15s; 72℃30s, 35cycles; 72℃5min. The PCR amplification product was cut with restriction endonuclease (XmnI) and the results were displayed by 2% agarose gel electrophoresis ( Figure 3 ), if the PCR fragment amplified in the genome to be tested cannot be digested by enzyme, a band with a length of 788bp is displayed on the agarose gel, indicating that the genotype of the genome to be tested at the third SNP site is TT, and it is speculated that it has a higher proanthocyanidin content; if the PCR fragment amplified in the genome to be tested is digested into two bands, bands with lengths of 557bp and 232bp are displayed on the agarose gel, indicating that the genotype of the genome to be tested at the third SNP site is CC, and it is speculated that it has a lower proanthocyanidin content; if the PCR fragment amplified in the genome to be tested is digested by enzyme, three bands with lengths of 788bp, 557bp and 232bp are displayed on the agarose gel, indicating that the genotype of the genome to be tested at the third SNP site is T / C heterozygous, and it is speculated that it has a higher proanthocyanidin content.

[0041] Table 2: Genotypes of 23 apple germplasm resources

[0042] serial number Apple Varieties genotype A47 Hanfu TT 59 Challenger TT 268 Hong Rou 2 TT 287 Pound Sweet TT 345 Early red one TT 9 Idared T / C 176 R8 T / C A44 Gloster69 T / C 366 Modi T / C A74 Bian Guo Hai Tang T / C 251 Simcoe T / C 106 Hongxun No.1 CC 182 H3 CC 114 Huang Taiping CC 142 Hartwigii CC 92 Begonia variegata CC 112 Brevipes CC 116 Arnoldiana CC 93 Robinson CC 331 Kobendza CC C7 Orthocarpa CC 99 Malus octyldophylla CC B14 Florentina CC

[0043] Comparing the genotypes detected in Table 2 with the genotypes of the actual apple samples (Table 1), it is known that the method of the present invention for detecting the genotypes at the SNP molecular markers associated with the proanthocyanidin content trait has a detection accuracy of 91.30%.

[0044] The embodiments described above are part of the embodiments of the present invention, rather than all of the embodiments. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention. All other embodiments obtained without creative work and related deductions and substitutions made by ordinary technicians in the field under the conditions of the concept of the present invention belong to the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with the proanthocyanidin content trait of apple, characterized in that: The SNP molecular marker includes 3 SNP sites; The three SNP sites are located at positions 2,107,657, 2,107,668 and 2,107,716 on chromosome 16 of the Golden Delicious apple reference genome GDDH13 v1.1; The three SNP sites are highly linked.

2. The SNP molecular marker according to claim 1, characterized in that: The alleles at the three SNP sites are A, T, T or G, C, C respectively.

3. The SNP molecular marker according to claim 2, characterized in that: The genotypes of the three SNP sites are A, T, and T homozygous apples, and the proanthocyanidin B2 content is 33989.93-22301683.17 ng / g; The genotypes of the three SNP sites are A, T, T / G, C, and C heterozygous apples, and the proanthocyanidin B2 content is 58921.96-18842104.41 ng / g; The genotypes of the three SNP sites in the homozygous apples are G, C, and C, and the content of proanthocyanidin B2 is 86304.96-13252022.20 ng / g.

4. Use of the SNP molecular marker according to any one of claims 1 to 3 in identifying or breeding high-altitude anthocyanin content apple varieties, characterized in that: The genotype of the highland anthocyanin content apple variety at the three SNP sites is A, T, T homozygous or A, T, T / G, C, C heterozygous.

5. The primer set for detecting the SNP molecular marker according to claim 1, characterized in that: The upstream primer of the primer set is GGCCCATAACTATAGCGTTACAACA; The downstream primer of the primer set is CTATCATTTCTCGTGTGCCCACA.

6. A kit, characterized in that: The primer set of claim 5 is used to detect the genotype of the SNP site at position 2,107,716 on chromosome 16 of the Golden Delicious apple reference genome GDDH13 v1.1 as described in claim 1.

7. A method for identifying or breeding high-quality anthocyanin apple varieties, characterized in that: Using the primer set of claim 5 or the kit of claim 6, PCR amplification is performed to obtain an amplification product, and the amplification product is analyzed to determine whether the sample is the high-altitude anthocyanin content apple variety; The genotypes of the plateau anthocyanin content apple variety at the three SNP sites are A, T, T homozygous or A, T, T / G, C, C heterozygous.

8. The method according to claim 7, characterized in that The nucleotide sequence of the amplified product is at least one of SEQ ID NO: 1 and SEQ ID NO:

2.

9. The method according to claim 7, characterized in that: The analysis is gene sequencing or agarose gel electrophoresis.

10. The method according to claim 9, characterized in that Before the agarose gel electrophoresis, the amplified product is digested with restriction endonuclease XmnI; The agarose gel electrophoresis result showed a band of 788 bp in length, indicating that the genotype of the apple variety at the three SNP sites was homozygous for A, T, and T; The agarose gel electrophoresis results showed bands of 557 bp and 232 bp in length, indicating that the genotypes of the apple variety at the three SNP sites were homozygous for G, C, and C; The agarose gel electrophoresis results showed three bands with lengths of 788 bp, 557 bp and 232 bp, indicating that the genotypes of the apple variety at the three SNP sites were A, T, T / G, C, and C heterozygous.

Images