A Phanerochaete chrysosporium SX-7-2 and its application in straw degradation

Abstract

The invention discloses a Phanerochaete chrysosporium SX-7-2 and its application in straw degradation, belonging to the field of solid waste treatment. The Phanerochaete chrysosporium of the invention is derived from the rotten wood of Baimafeng, Jinzhai County, Lu'an City, Anhui Province, and a strain capable of decomposing cellulose is screened therefrom and named as SX-7-2. The Phanerochaete chrysosporium SX-7-2 of the invention has a high rice straw degradation rate, and the rice straw degradation rate reaches 31.2% after fermentation for 15 days, which is significantly higher than 5.7% of the control group.

Description

Technical Field

[0001] The invention relates to Phanerochaete chrysosporium SX-7-2 and application thereof in straw degradation, belonging to the fields of biotechnology and solid waste treatment. Background Art

[0002] With the development of agriculture, the output of crop straw is huge. If a large amount of straw is not handled properly, it will not only cause a waste of resources, but also have a negative impact on the environment. For example, burning in the field will cause air pollution, soil quality deterioration and other problems. At present, the treatment methods of straw include direct return to the field, feed, energy, etc., but these methods face some limitations in the implementation process. Using microorganisms to degrade straw has the advantages of environmental protection and high efficiency, but the existing microbial strains used for straw degradation still need to be improved in terms of degradation efficiency and adaptability to different types of straw, and cannot meet the needs of straw resource utilization. Therefore, it is of great significance to find an efficient straw-degrading microorganism. Summary of the invention

[0003] In view of the problems existing in the above-mentioned prior art, the present invention provides a Phanerochaete chrysosporium SX-7-2 and its application in straw degradation. The Phanerochaete chrysosporium of the present invention is derived from the rotten wood of Baimafeng, Jinzhai County, Lu'an City, Anhui Province. The strain that can decompose cellulose is screened and named SX-7-2. Through morphological observation of the strain, its hyphae is white and has diaphragms; the production of cellulase is detected by fermentation culture; using molecular biological methods, the 18S sequence is sequenced and analyzed, and the similarity with the known Phanerochaete chrysosporium sequence is as high as 99%, which is determined to be a new strain of Phanerochaete chrysosporium, and has the ability to degrade straw, which can promote the resource utilization of crop straw.

[0004] The Phanerodontiachrysosporium SX-7-2 of the present invention is classified and named Phanerodontiachrysosporium, and is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, with a deposit number of CGMCC No.41406 and a deposit date of July 9, 2024.

[0005] The screening method of Phanerochaete chrysosporium SX-7-2 of the present invention comprises the following steps:

[0006] Step 1: Initial screening

[0007] Weigh 10 g of rotten wood sample from Baimafeng, Jinzhai County, Lu'an City, Anhui Province, place it in a 250 mL conical flask, add 90 mL of sterile water, and mix overnight. Use the gradient dilution method to dilute the sample solution to 10 -1 ~10 -7, spread on the screening medium (CMC medium) plate, invert and culture at 20-30℃, and preliminarily identify the colonies according to their shape, color, wetness, convexity and concavity, transparency, number and size. Preliminarily screen the strains with strong cellulose degradation ability through colony size and hydrolysis circle, and streak the selected strains on the screening medium plate for one purification, repeat the streaking for secondary purification, then number them and store them in a refrigerator at 4℃.

[0008] Step 2: Rescreen

[0009] The strain obtained in the initial screening was inoculated into 10 mL of YPD medium, and cultured at 20-30°C and 100-200 rpm for 2-3 days. The seed liquid of the expanded culture was inoculated into 100 mL of fermentation enzyme production medium (CE medium) at an inoculum size of 1-5%, and cultured at 20-30°C and 100-200 rpm to determine the cellulase activity.

[0010] Step 3: Identification

[0011] Morphological identification: Pick the monoclonal strain after rescreening and inoculate it into YPD liquid culture medium. After fermentation for 1-3 days, take a small amount of bacteria on a sterile glass slide and dissolve it in 1 drop of sterile water. After drying, stain it with crystal violet, mordant it with Lugo's iodine solution, decolorize it with 95% ethanol, wash it with water, stain it with Tsar, wash it with water, and dry it. Then observe the bacterial morphology under a 40x microscope.

[0012] Molecular biological identification: The strain genome was extracted using the AxyPrep fungal genome extraction kit, and the strain 18S gene was amplified using ITS1 and ITS4 primers. The PCR product was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequence detection, and the measured sequence was compared by Blast on NCBI.

[0013] The culture medium used in the present invention is:

[0014] Screening medium (CMC medium): weigh 2 g (NH4)2SO4, 0.5 g MgSO4, 1 g K2HPO4·3H2O, 0.5 g NaCl, and 5 g CMC into a beaker, add deionized water to make up to 1 L, adjust the pH to 7.0, and sterilize at 121°C for 20 min.

[0015] Expansion medium (YPD): 10 g yeast extract, 20 g peptone, 20 g dextrose glucose, add deionized water to 1 L, sterilize at 115℃ for 30 min.

[0016] Fermentation enzyme production medium (CE medium): 3 g peptone; 2 g (NH4)2SO4; 0.3 g CaCl2·2H2O; 0.3 g MgSO4; 4 g KH2PO4; 1% Tween-80; 40 g microcrystalline cellulose; add deionized water to make up to 1 L, adjust the pH to 5.5, and sterilize at 121°C for 20 min.

[0017] The invention discloses an application of Phanerochaete chrysosporium SX-7-2 in straw degradation.

[0018] The straw includes one or more of crops such as corn, rice, wheat, sugarcane, cotton, etc.

[0019] The strain preservation tube of Phanerochaete chrysosporium SX-7-2 was streaked on a YPD plate, cultured in a 20-30° C. incubator for 1-3 days, a single clone was picked and inoculated into 100-200 mL of YPD liquid culture medium, and expanded and cultured at 20-30° C. and 100-200 rpm for 2-3 days to obtain a fermentation broth of the SX-7-2 strain.

[0020] The fermentation broth of the above-mentioned SX-7-2 strain was inoculated into 50-200 mL of straw culture medium at a volume ratio of 1-5%, and an equal amount of sterile water was added as the control group. Each group was set up with 3-5 parallels and cultured at 20-30°C with shaking for 10-20 days.

[0021] Straw culture medium: 5g NaCl, 5g peptone, 1g yeast extract, 5g CaCO3, 10g straw, add deionized water to make up to 1L, sterilize at 121℃ for 20 min.

[0022] After fermentation, filter the culture solution with filter paper, rinse the filtered straw residue repeatedly with 1-10% hydrochloric acid to ensure that the bacteria are removed, place the collected straw residue in an oven at 80-105°C for 4-10 hours, and calculate the weight loss rate using the weight loss method.

[0023] Calculation formula: .

[0024] Where: R is the dry mass of straw residue after fermentation, unit is g; R0 is the initial dry mass of straw, unit is g.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0026] The straw degradation functional strain of the present invention is screened from the rotten wood of Baimafeng, Jinzhai County, Lu'an City, Anhui Province, and is identified as Phanerochaete chrysosporium by strain morphology and sequence, and is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration Committee, with a deposit number of CGMCC No.41406 and a deposit date of July 9, 2024. Phanerochaete chrysosporium SX-7-2 has a high rice straw degradation rate, and the rice straw degradation rate reaches 31.2% after 15 days of fermentation, which is higher than 5.7% of the control group. Compared with other reports on rice straw degradation, as mentioned in patent CN 118978985A, a bacterial agent composed of four strains of Bacillus siamense 2-3C47, Bacillus siamense 2-3C48, Bacillus siamense 2-4A51 and Bacillus nanhaiense 2-3C312 acts on rice straw degradation. When the straw is treated for 40 days, the rice straw degradation rate reaches about 40%. The rice straw degradation rate of the Phanerochaete chrysosporium SX-7-2 of the present invention reaches 31.2% after 15 days of treatment, that is, the single bacterium shows an effect and potential on rice degradation that is not inferior to that of some microbial flora preparations. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Comparison of rice straw degradation rates.

[0028] Figure 2 This is a scanning electron micrograph of rice straw before degradation by SX-7-2.

[0029] Figure 3 This is a scanning electron micrograph of SX-7-2 after degrading rice straw. DETAILED DESCRIPTION

[0030] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art. In the following examples, various processes and methods not described in detail are conventional methods known in the art. The specific embodiments of the present invention described below are to supplement the purpose, technical solutions and effects of the present invention, but they are not intended to limit the scope of protection of the present invention. Within the scope of the present invention, simple changes, modifications or replacements can be made, which are all considered to be within the scope of protection of the present invention.

[0031] The culture medium used in the present invention is:

[0032] Screening medium (CMC medium): weigh 2 g (NH4)2SO4, 0.5 g MgSO4, 1 g K2HPO4·3H2O, 0.5 g NaCl, and 5 g CMC into a beaker, add deionized water to make up to 1 L, adjust the pH to 7.0, and sterilize at 121°C for 20 min.

[0033] Expansion medium (YPD medium): 10 g yeast extract, 20 g peptone, 20 g glucose, add deionized water to 1 L, sterilize at 115℃ for 30 min.

[0034] Fermentation enzyme production medium (CE medium): 3 g peptone; 2 g (NH4)2SO4; 0.3 g CaCl2·2H2O; 0.3 g MgSO4; 4 g KH2PO4; 1% Tween-80; 40 g microcrystalline cellulose; add deionized water to make up to 1 L, adjust the pH to 5.5, and sterilize at 121°C for 20 min.

[0035] Straw culture medium: 5g NaCl, 5g peptone, 1g yeast extract, 5g CaCO3, 10g rice straw, add deionized water to make up to 1 L, sterilize at 121℃ for 20 min.

[0036] The reagents used in the present invention are prepared as follows:

[0037] DNS reagent: Accurately weigh 10.6 g of 3,5-dinitrosalicylic acid and 19.8 g of NaOH and place them in a beaker. Add 1416 mL of deionized water and heat to 45°C in a water bath. Stir with a glass rod to dissolve. After dissolution, add 306 g of potassium sodium tartrate, 7.6 ml of phenol, and 8.3 g of sodium sulfite. Continue to stir and dissolve at 45°C. After all the added substances are dissolved, place in a brown bottle away from light for one week before use. It can be stored at room temperature for 6 months.

[0038] Citric acid buffer (0.05 M, pH 4.8): Accurately weigh 210 g of citric acid monohydrate and place it in a beaker. Add 750 mL of deionized water and stir to dissolve. After all the solution is dissolved, add 60 g of NaOH until the pH value is about 4.3, and then dilute to 1 L with deionized water.

[0039] 1% glucose standard solution: Accurately weigh 0.1 g of glucose that has been dried to a constant weight, dilute to 10 mL with deionized water, and prepare before use.

[0040] Crystal violet solution: Solution A: 2g crystal violet, 20mL ethanol (95%); Solution B: 0.8g ammonium oxalate, 80mL distilled water. Mix solution A and solution B and set aside.

[0041] Lugo's iodine solution: 1g iodine tablet, 2g potassium iodide. First dissolve the potassium iodide in a small amount of distilled water, then add the iodine tablet. After dissolution, add water to 300mL.

[0042] 0.5% Shahuang solution: 20mL Shahuang alcohol solution (2.5%), 80mL distilled water, 2.5% Shahuang alcohol solution is stored in a brown bottle as the mother solution and diluted when used.

[0043] Example 1: Sample processing

[0044] Weigh 5 g of the rotten wood sample from Baimafeng, Jinzhai County, Lu'an City, Anhui Province, dissolve it in 95 mL of sterile water, mix it well and place it at 30°C overnight. Take a sterile centrifuge tube and treat the sample with the gradient dilution method, diluting the sample concentration to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 For backup.

[0045] Example 2: Screening

[0046] 150 μL of each of the seven dilution samples was taken and spread on the screening medium, and then inverted and cultured at 30°C for 2 to 5 days. The seven gradient-spread plates were used to preliminarily identify the colonies according to their shape, color, wetness, concavity, transparency, and number and size on the plate. The larger the colony morphology, the stronger its ability to decompose cellulose, and it is a potential functional strain for straw degradation.

[0047] After picking a single colony of potential strains that may have the ability to degrade cellulose, streak it twice on the screening medium and invert it for 2-5 days at 30°C. According to the size of the degradation transparent zone, select the strain with the largest transparent zone, name it SX-7-2, and store it in a 20% glycerol tube in a -80°C refrigerator.

[0048] Example 3: Identification

[0049] 1. Morphological identification of strains.

[0050] The SX-7-2 strain was identified by staining.

[0051] (1) Inoculate the rescreened target strain SX-7-2 into 5 mL of YPD liquid medium and culture at 30°C and 150 rpm for 2 days.

[0052] (2) Place a drop of sterile water in the center of a clean glass slide. Use a sterile inoculation loop to take a small amount of the bacteria to be observed, mix it thoroughly with the water drop, and apply it to form a very thin bacterial film.

[0053] (3) After the smear has dried in the air, hold the slide at one end with the biofilm facing up and pass it over low heat three times to cool.

[0054] (4) Staining: Primary staining: add crystal violet solution and stain for 1 to 1.5 minutes; Mordanting: add Lugo's iodine solution and stain for 1 to 2 minutes; wash with water; Decolorization: add 95% ethanol, shake, pour off the ethanol, repeat 2 to 3 times; wash with water; Restaining: add safranin and stain for 1 to several minutes; wash with water; dry.

[0055] (5) Microscopic examination.

[0056] 2. Molecular biological identification of strains.

[0057] The rescreened target strain SX-7-2 was inoculated into 5 mL of YPD liquid medium and cultured at 30°C and 150 rpm for 2 days. The cells were centrifuged and extracted with the AxyPrep fungal genome extraction kit. The 18S gene of the strain was amplified with primers ITS1 (5′~3′ sequence: TCCGTAGGTGAACCTGCGG) and ITS4 (5′~3′ sequence: TCCTCCGCTTATTGATATGC). The PCR amplification program was: 94°C pre-denaturation reaction for 5 min, 55°C annealing for 2 min, 72°C extension for 2 min, 94°C denaturation for 1 min, 55°C annealing for 50 s, 72°C extension for 30 s, the number of cycles was set to 30 times, 72°C reaction for 5 min, and 4°C storage. The PCR product was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequence detection. The measured sequence was compared by Blast on NCBI. The results showed that SX-7-2 was Phanerodontia chrysosporium, and it was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration with the deposit number CGMCC No.41406 and the deposit date July 9, 2024.

[0058] Example 4: Rice straw degradation ability of SX-7-2

[0059] The strain preservation tube of SX-7-2 was streaked on the YPD plate and cultured in the SX30℃ incubator for 2 days. A single clone was picked and inoculated into 100 mL of YPD liquid medium and expanded at 30℃ and 150 rpm for 3 days to obtain the fermentation liquid of SX-7-2 strain. The fermentation liquid was inoculated into 200 mL of straw culture medium at a volume ratio of 5%, and an equal amount of sterile water was added as the control group. Three parallels were set for each group and cultured at 30℃ and 150 rpm for 20 days. After the fermentation, the culture liquid was filtered with filter paper, and the filtered rice straw residue was repeatedly rinsed with 1% hydrochloric acid to ensure the removal of the bacteria. The collected rice straw residue was placed in a 105℃ oven for 8 hours, and the weight loss rate was calculated by weight loss method.

[0060] Calculation formula: .

[0061] Where: R is the dry mass of rice straw residue after fermentation, unit is g; R0 is the initial dry mass of rice straw, unit is g.

[0062] At the same time, under the same conditions, the degradation rates of rice straw by two other microbial strains named SX-7-1 and SX-7-5, whose degradation transparent zones were smaller than SX-7-2 in the screening medium, were compared. The test results showed that Phanerochaete chrysosporium SX-7-2 had a higher degradation rate of rice straw, reaching 31.2% after 15 days of fermentation, which was significantly higher than the degradation rate of 5.7% in the control group ( Figure 1 ). The morphological changes of rice straw before and after degradation were observed by scanning electron microscopy. The results showed that the wax layer on the surface of rice straw was completely decomposed after degradation, indicating obvious degradation and deformation, and the integrity of the grid was destroyed, indicating that SX-7-2 has a significant degradation effect on rice straw ( Figure 2 , Figure 3 ).

[0063] At the same time, SX-7-2 was used for the degradation of cottonseed hulls in the same manner as above. After 15 days of treatment, the degradation rate of cottonseed hulls was 18.6%, which was lower than the degradation effect of SX-7-2 on rice straw. Comprehensively comparing relevant reports on rice straw degradation, such as the degradation of rice by microbial flora preparations reported in patent CN 118978985A, the Phanerochaete chrysosporium SX-7-2 of the present invention showed an effect and potential on rice degradation that was not inferior to that of some microbial flora preparations, and can be used for rice degradation to promote straw resource utilization.

Claims

1. A Phanerochaete chrysosporium SX-7-2, characterized in that: The classification of the Phanerochaete chrysosporium SX-7-2 is named Phanerochaete chrysosporium Phanerodontia chrysosporium , deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC No.41406 and the deposit date of July 9, 2024.

2. Use of the Phanerochaete chrysosporium SX-7-2 according to claim 1 in the degradation of rice straw.

3. The use of Phanerochaete chrysosporium SX-7-2 in rice straw degradation according to claim 2, characterized in that: The strain preservation tube of the Phanerochaete chrysosporium SX-7-2 is streaked on a YPD plate, cultured in an incubator at 20-30° C. for 1-3 days, a single clone is picked and inoculated into 100-200 mL of YPD liquid culture medium, and expanded and cultured at 20-30° C. and 100-200 rpm for 2-3 days to obtain a fermentation liquid of the SX-7-2 strain; the fermentation liquid of the SX-7-2 strain is inoculated into a rice straw culture medium, and cultured at 20-30° C. for 10-20 days with shaking to degrade the rice straw.

4. The use of Phanerochaete chrysosporium SX-7-2 in rice straw degradation according to claim 3, characterized in that: The inoculation ratio of the SX-7-2 strain fermentation broth is 1-5%.

5. The use of Phanerochaete chrysosporium SX-7-2 in rice straw degradation according to claim 3, characterized in that: The rice straw culture medium comprises the following components: 5 g NaCl, 5 g peptone, 1 g yeast extract, 5 g CaCO3, 10 g rice straw, and deionized water is added to make the volume 1 L, and sterilized at 121° C. for 20 min.

Images