SNP (Single Nucleotide Polymorphism) mutation site associated with turbot blackening, molecular marker and application

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) mutation site associated with turbot blackening, a molecular marker and application, and belongs to the technical field of molecular markers. According to the SNP locus related to turbot blackening, the SNP locus related to turbot blackening is found through pathway analysis, SNP locus screening, SNP locus typing and SNP locus screening related to turbot non-eye side body color blackening, the SNP locus is located on a gene tyrosinase-related protein 1b, a base G at the 835bp position is mutated into A, aspartic acid can be changed into asparagine, and the non-eye side of turbot is not prone to blackening. When scophthalmus maximus breeding is carried out, the breeding scophthalmus maximus can be subjected to pre-breeding molecular screening by using the SNP site associated with the body color blackening of the non-eye side of the scophthalmus maximus, so that the occurrence rate of the non-eye side blackening of the progeny of the scophthalmus maximus is reduced from germplasm, and the blackening phenomenon in the breeding process of the scophthalmus maximus is reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a SNP mutation site associated with melanization of turbot, a molecular marker and an application thereof. Background Art

[0002] Turbot is a bottom-dwelling flatfish with two eyes on the same side of the body, the side with eyes is above, and the side without eyes is close to the ground and below. The eyeless side refers to the side without eyes. As a high-quality economic marine fish, turbot is factory-farmed in most areas. Under normal circumstances, the eyed side of turbot is black and the eyeless side is white. However, during factory farming, some melanocytes will appear on the eyeless side of turbot, which is called melanization. Melanization will affect the aesthetics of turbot and lead to low commodity value of turbot. There are many reasons for the melanization of turbot, including: ① Breeding environment: changes in the breeding environment, such as water temperature, water quality, light intensity, light irradiation direction, etc., may affect the body color of flatfish; ② Nutritional factors: the content of DHA, EPA, ARA and vitamin D3 in feed will affect the body color of flatfish; ③ Genetic factors. At present, in the process of factory farming, the proportion of blackening of the eyeless side is very high, and the selling price of blackened individuals is usually low. This not only affects the economic benefits of the breeders, but also limits the market competitiveness of turbot. Inhibiting the occurrence of blackening of the eyeless side of the turbot has become an urgent problem that needs to be solved in the turbot farming industry.

[0003] In recent years, there have been many studies on body color abnormality, mainly focusing on flatfish - turbot, such as the culture environment of turbot, such as light intensity, water flow speed, water depth, water temperature, culture density, etc., and the impact of nutritional factors on the body color abnormality of turbot. These studies have a certain effect on improving the body color abnormality of turbot. There are also studies to solve the problem of body color abnormality from a genetic perspective, such as several gene mutations of turbot adc-2677-C / A, itpr2-7032-C / T, itpr2-554-T / C. However, there are no related research reports in turbot.

[0004] Therefore, solving the problem of turbot melanization from a genetic perspective is crucial to the turbot farming industry. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP mutation site associated with turbot melanization, a molecular marker and an application thereof. The application of the SNP mutation site to turbot breeding can effectively reduce the melanization phenomenon during turbot breeding.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a SNP mutation site associated with turbot melanization, wherein the SNP mutation site is a base G / A located at the 835bp position on the gene tyrosinase-related protein 1b.

[0008] The present invention also provides a SNP molecular marker associated with turbot melanization, wherein the SNP molecular marker associated with turbot melanization is a SNP molecular marker based on a SNP mutation site associated with turbot melanization.

[0009] Preferably, the SNP molecular marker is the base sequence shown in SEQ ID NO.1; the base G at the 835bp position of the base sequence shown in SEQ ID NO.1 is mutated into base A, and aspartic acid is changed into asparagine.

[0010] Preferably, the SNP molecular marker associated with melanization of turbot is a marker linked to the eyeless side body color trait of turbot.

[0011] The present invention also provides an application of a SNP mutation site associated with turbot melanization or a SNP molecular marker associated with turbot melanization in turbot breeding.

[0012] The present invention also provides a product for detecting SNP mutation sites associated with turbot melanization or SNP molecular markers associated with turbot melanization, and the product comprises primers or probes capable of detecting SNP mutation sites or SNP molecular markers associated with turbot melanization.

[0013] The beneficial effects of the present invention compared with the prior art are:

[0014] (1) The present invention finds a SNP site associated with the melanization of turbot through pathway analysis, SNP site screening, SNP site typing, and SNP site screening associated with the melanization of the eyeless side of turbot. The SNP site is located on the gene tyrosinase-related protein 1b, and the base G at the 835bp position mutates to A, which can change aspartic acid into asparagine, making the eyeless side of turbot less likely to melanize.

[0015] (2) When breeding turbot, the SNP loci associated with the blackening of the eyeless side of turbot of the present invention can be used to perform pre-breeding molecular screening of turbot, thereby reducing the incidence of blackening of turbot offspring from the germplasm and reducing the blackening phenomenon during turbot breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0017] Figure 1 The peak diagram of the GG gene sequencing in Example 1 of the present invention (GGCGACCC);

[0018] Figure 2 The GA genotype sequencing peak diagram in Example 1 of the present invention is the GA genotype sequencing peak diagram (GGCG / AACCC);

[0019] Figure 3 The peak diagram of the sequencing of the AA genotype in Example 1 of the present invention (GGCAACCC);

[0020] Figure 4 These are the sequencing results of the tyrp1b-835-G / A site of 12 normal turbot samples and 13 blackened turbot samples in Example 1 of the present invention. DETAILED DESCRIPTION

[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0022] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0023] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0024] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0025] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0026] In the present invention, the sequence of the gene (SEQ ID NO.1) associated with melanization of turbot is as follows:

[0027] GTGTTGGGTGTAGGTGATTACTCAAGCTCCAAAAAGTCGGATCATGCGCTCGGTAGCTATTTAAGCCAGGAGAGGGGATCGGGCCGACTCTTGGTGGGATACAGTTCTGCAGACCGAGAGGAGCAGC ATGCACAGTCAGAGCATGTGGAGAGCAGGTCTCGTGGTGGTCACCCTGTGTGCCACTGTAACGCTGGCCCAGTTCCCCCGGGAGTGCGTTACCCCCGAGGGGCTGCGCAGTGGCCAGTGCTGCCCGTCCCCTACAGGGGTGGCAGGGGACGAGTGTGGCGCGGGCACAGGACGGGGGCAGTGTGTTGCCATTGCGGCAGACAACCGCCGCCACGGACCCCAGTACCCCTACGCTGGACGAGATGACAGGGAGAGGTGGCCGCTGACATTTTTCAACCGCACTTGCCAGTGTAATGGGAACTTCAGTGGCTACAACTGTGGGCAATGCCGACACGGGTTCACTGGACCAAACTGTGATCAGAGGATCTCTGTGGTGAGGAGGAATATCATGCAGATGAGCACATCTGAGAAGCAAGCATTTGTGAATGCTCTGGACCAAGCTAAGAGGACCGTCCACCCTGACCTGGTCATCTGTACAAGAAGATACCAGGACGTGTTTGGGCCCGATGGCATCACCCCACAGTTTGAGAACATCACCATTTATAACTACTTTGTGTGGAGCCACTACTACTCCGTCAGTAAAACCTACCTGGGGCCAGGCCAGACCAGCTTCGGAGGTGTGGACTTCTCCCACGAGGGCCCGGGTTTTGTCACCTGGCACCGTTTTCATCTGTTGCAACTGGAGAGAGACATGCAGGACATGCTGGGC A

[0028] The underlined part is the start codon, and the bold underlined part is the mutation position from base G to base A.

[0029] Example 1

[0030] Embodiment 1 of the present invention provides a method for screening SNP molecular markers associated with melanization of turbot, which specifically comprises the following steps:

[0031] (1) Pathway analysis

[0032] Normal skin of normal turbot, normal white skin of turbot with black eyeless side and black eyeless side with black eyeless side were selected from Yellow Sea Aquatic Products Co., Ltd., Haiyang City, Shandong Province. RNA was extracted and bidirectional transcriptome sequencing was performed. Then SNP analysis was performed on the sequencing data to preliminarily detect the SNP sites. Then gene annotation, differential gene expression analysis, differential gene GO enrichment analysis and differential gene KEGG enrichment analysis were performed to analyze the pathways significantly enriched in the differentially expressed genes, and 5 pathways related to body color were obtained: Phototransduction pathway, Retinol metabolism pathway, Thyroid hormone synthesis pathway, PPAR signaling pathway, Melanogenesi pathway;

[0033] (2) SNP site screening

[0034] SNP analysis was performed on the five pathways related to body color in step (1). There were 59 genes with SNP sites in the five pathways. The SNP sites with non-synonymous mutations in the coding region were screened out using the Blast software on the NCBI website. Finally, 32 SNP sites in the coding region of the 42 genes were obtained.

[0035] (3) SNP locus typing

[0036] Use SNP locus typing primers:

[0037] Upstream primer (SEQ ID NO. 2): 5′-GCCCAAAGAGTCGTAGTCGT-3′;

[0038] Downstream primer (SEQ ID NO. 3): 5'-ACAAGGTGACATGTTCTTTCCTAT-3'; the 32 SNP sites obtained in step (2) of turbot were typed.

[0039] Twelve normal turbot and 13 blackened turbot samples were collected from the same growth environment at the Yellow Sea Aquatic Products Co., Ltd. in Haiyang City, Shandong Province. DNA was extracted, primers were designed for each SNP site, PCR was performed using the extracted DNA as a template, and the SNP sites were typed using direct sequencing.

[0040] Typing rules: If there is only a G peak at the corresponding position in the sequencing peak graph, the individual genotype is GG. If there are two peaks, the individual genotype is G / A. If there is only an A peak, the individual genotype is AA. The results are shown in Figures 1 to 3 .

[0041] (4) Screening for SNP loci associated with the blackening of the eyeless side of turbot

[0042] The genotypes of each SNP site of the 12 normal turbot samples and 13 melanized turbot samples collected were statistically analyzed, and the genotype statistical results of the normal turbot samples and the melanized turbot samples were subjected to one-way analysis of variance using SPSS27.0 software (P<0.05: significant difference; P<0.01: extremely significant difference). The SNP sites with significant differences were retained, and finally a SNP site with extremely significant differences in genotype distribution between normal turbot and melanized turbot samples was obtained (see Table 1), which was located at the 835bp position tyrp1b-835-G / A shown in SEQ ID NO.1 on the gene tyrosinase-related protein 1b (XM 035638489.2).

[0043] From Table 1 and Figure 4 It can be seen that the base G at the 835bp position of the sequence shown in SEQ ID NO.1 mutated into A, and aspartic acid became asparagine, making the eyeless side of the turbot less likely to melanize.

[0044] The genotype of normal turbot was 41.67% GG, 33.33% GA, and 25% AA, while the genotype of black turbot was 84.62% GG, 15.38% GA, and 0% AA.

[0045] Table 1 Statistical results of genotype distribution among different types of samples at the tyrp1b-835-G / A locus

[0046]

[0047]

[0048] Table 2 Significance of comparison between samples X 2 distributed

[0049] Blackened turbot Normal turbot 7.104*

[0050] Note: X 2 0.05(2) =5.991,X 2 0.01(2) =9.21, P=0.029

[0051] According to the typing results, the normal dominant genotype of the tyrp1b-835-G / A locus is the GG homozygous type, accounting for 41.67%; the dominant genotype of the blackened turbot is the GG homozygous type, accounting for 84.62%.

[0052] SPSS software was used to perform inter-group significance tests. The significance test results of normal turbot and black turbot were X 2 =7.104>X 2 0.05 , P<0.05, indicating that there was a significant difference in the genotype distribution between normal turbot samples and black turbot samples at this site, and this SNP site was related to the blackening of turbot.

[0053] Example 2

[0054] Example 2 of the present invention verifies whether the SNP site screened in Example 1 has universal characteristics in normal turbot and turbot with black body color on the eyeless side. The specific implementation method is:

[0055] Collection of different types of turbot samples: 50 normal turbot samples and 50 eyeless blackened turbot samples were collected. DNA of the samples was extracted and PCR amplification was performed using the primers provided by SEQ ID NO.2 and SEQ ID NO.3 with the extracted sample DNA as a template. The products were sequenced and the sequencing results were analyzed. The genotypes of the tyrp1b-835-G / A locus of the samples were statistically analyzed. The chi-square test analysis of the genotype statistical results of the normal turbot samples and the eyeless blackened turbot samples was performed using SPSS27.0 software (P < 0.05: significant difference; P < 0.01: extremely significant difference). The statistical results are shown in Tables 3 and 4.

[0056] Table 3 Statistical results of genotype distribution among different types of samples at the tyrp1b-835-G / A locus

[0057]

[0058]

[0059] Table 4 Significance of comparison between samples X 2 distributed

[0060] Blackened turbot Normal turbot 6.210*

[0061] Note: X 2 0.05(2)=5.991,X 2 0.01(2) =9.21 P = 0.045

[0062] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A SNP mutation site associated with melanization of turbot, characterized in that: The SNP mutation site is the base G / A located at the 835bp position on the gene tyrosinase-related protein 1b.

2. A SNP molecular marker associated with melanization of turbot, characterized in that: The SNP molecular marker associated with the melanization of turbot is a SNP molecular marker based on the SNP mutation site associated with the melanization of turbot according to claim 1.

3. The SNP molecular marker associated with melanization of turbot according to claim 3, characterized in that: The SNP molecular marker is the base sequence shown in SEQ ID NO.1; the base G at the 835bp position of the base sequence shown in SEQ ID NO.1 is mutated into base A, and aspartic acid is changed into asparagine.

4. The SNP molecular marker associated with melanization of turbot according to claim 2 or 3, characterized in that: The SNP molecular marker associated with the melanization of turbot is a marker linked to the eyeless side body color trait of turbot.

5. Use of the SNP mutation site associated with turbot melanization according to claim 1 or the SNP molecular marker associated with turbot melanization according to any one of claims 2 to 4 in turbot breeding.

6. A product for detecting the SNP mutation site associated with melanization of turbot according to claim 1 or the SNP molecular marker associated with melanization of turbot according to any one of claims 2 to 4, characterized in that: The product comprises primers or probes capable of detecting SNP mutation sites or SNP molecular markers associated with the melanization of turbot.

Images