Molecular marker for identifying Eurasian and interspecific hybrid grapes thereof and application of molecular marker

Abstract

The invention discloses a molecular marker for identifying Eurasian and interspecific hybrid grapes thereof and application of the molecular marker, and belongs to the technical field of biological breeding. According to the invention, through whole genome re-sequencing data analysis, a significant InDel site IH1 is identified, and the significant InDel site IH1 is located at 7bp, 224bp and 357bp of a grape No.13 chromosome. The locus shows a significant genotype difference between the Eurasian grape and the interspecific hybrid thereof. Through the number and distribution difference of the electrophoretic bands, the Eurasian grape and the interspecific hybrid thereof can be visually and accurately distinguished. Based on the characteristics of the molecular marker, the molecular marker can be used for rapidly screening interspecific filial generation strains in the early stage of breeding and removing selfing offspring. Meanwhile, the genetic background of the seedlings can be rapidly screened, the accuracy of the seedlings is guaranteed, and the method plays an important role in early screening of breeding offspring and screening of the genetic background of the seedlings.

Description

Technical Field

[0001] The invention relates to the technical field of biological breeding, and in particular to a molecular marker for identifying Eurasian grapes and their interspecific hybrids and an application thereof. Background Art

[0002] Grapes are one of the world's most important cash crops with extremely high economic value. In recent years, with the advancement of agricultural technology and the diversification of consumer demand, China's grape planting area and output have grown steadily, and the grape industry has become one of the most important fruit trees in my country. Especially in the fresh-table grape and wine grape industries, China's market demand continues to expand, which puts higher requirements on the diversity and quality of grape varieties.

[0003] In grape breeding, interspecific hybridization, as a widely used means of genetic improvement, can introduce excellent genetic resources that cultivated varieties do not have, thereby improving the genetic diversity of grapes. Through interspecific hybridization, excellent traits that cultivated varieties do not have can be transferred into cultivated varieties, such as disease resistance, cold resistance, and drought resistance. Common hybrid combinations include Eurasian grapes (Vitis vinifera) and American grapes (such as Vitis labrusca, Vitis Riparia, etc.). These hybrids are mainly used to improve disease resistance and cold resistance; as well as Eurasian grapes and wild grape species (such as Vitis amurensis, Vitis aestivalis), which aim to enhance cold resistance and stress resistance.

[0004] The phenotype of interspecific hybrid offspring is usually close to that of the parents. Therefore, it is very difficult to accurately identify the authenticity of hybrids based on traditional morphology, agronomic traits or physiological and biochemical indicators. Especially in the complex hybrid background, the screening using these traditional methods is not only affected by environmental conditions, but also inefficient and costly. In order to make up for the limitations of traditional methods, modern molecular biology techniques are widely used to improve the accuracy and efficiency of identification. The specific differences shown by interspecific hybrid offspring at the genomic level make molecular markers an ideal tool. Since interspecific hybrid offspring are derived from the combination of genes of different species, they may be heterozygous, while Vitis vinifera remains homozygous at specific loci. These genotypic differences can provide an effective basis for distinguishing Vitis vinifera from its hybrid offspring. This marker can also be used to identify the genetic background of seedlings, reduce the mixing of seedlings and rootstocks, and errors in the use of seedlings.

[0005] With the development of molecular biology, molecular marker technology has become a key tool for the identification of germplasm resources. Through analysis at the genome level, molecular markers can quickly identify hybrids in the early stages of breeding, thereby significantly shortening the breeding cycle. Rapid genetic background analysis can also be performed before seedlings are planted to determine the accuracy of seedlings and reduce economic losses caused by seedling problems. However, in the current molecular marker identification of interspecific hybridization of grapes, there are still problems such as insufficient marker specificity, complex technical operations, and high detection costs. Therefore, the development of an efficient and specific molecular marker identification method will provide important technical support for the rapid screening of interspecific hybrids of grapes and the rapid detection of seedlings, and further promote the development of grape breeding. Summary of the invention

[0006] The purpose of the present invention is to provide a molecular marker for identifying Vitis vinifera and its interspecific hybrids and its application, so as to solve the problems existing in the above-mentioned prior art. The molecular marker can accurately distinguish Vitis vinifera and its interspecific hybrids, which is beneficial to improving breeding efficiency and accuracy, reducing breeding costs, etc.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a molecular marker for identifying Eurasian grapes and their interspecific hybrids. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1. A 34 bp deletion polymorphism exists starting from the 49th position of the molecular marker:

[0009] Preferably, if there is a 34 bp deletion starting from the 49th position of the molecular marker and the genotype shows a heterozygous state, it is an interspecific hybrid grape; if there is no 34 bp deletion starting from the 49th position of the molecular marker and the genotype shows a homozygous state, it is Vitis vinifera; wherein the sequence of the 34 bp deletion is shown in SEQ ID NO: 4.

[0010] The present invention also provides a primer pair for identifying Eurasian species and interspecific hybrid grapes, the primer pair is used to amplify a molecular marker with a nucleotide sequence as shown in SEQ ID NO: 1, and the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0011] The invention also provides a kit comprising the primer pair.

[0012] The present invention also provides a method for identifying Eurasian grapes and their interspecific hybrids, comprising the following steps:

[0013] The genomic DNA of the grape sample to be tested is used as a model, and PCR amplification is performed using the primer pair described in claim 2. According to the number and distribution difference of the marker site bands of the amplified product, it is judged that the grape sample to be tested is Eurasian species or interspecific hybrid grape; the marker site is the 49th to 82nd position of the nucleotide sequence shown in SEQ ID NO: 1.

[0014] Preferably, the PCR amplification reaction system includes 25 μL of 2×Rapid Taq Master Mix, 2 μL of upstream sequence and downstream sequence, 0.1-1 μg of DNA template, and ddH2O is added to a total volume of 50 μL.

[0015] Preferably, the reaction procedure of the PCR amplification is: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, annealing temperature decreased by 0.5°C in each cycle, extension at 72°C for 30 s, for a total of 5 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for a total of 25 cycles; finally extension at 72°C for 5 min; storage at 4°C.

[0016] Preferably, the judgment method is: if a double band appears at the marker site, it is judged to be an interspecific hybrid grape; if a single band appears at the marker site, it is judged to be Vitis vinifera.

[0017] The present invention also provides the use of the molecular marker, the primer pair or the kit in identifying Eurasian species and interspecific hybrid grapes.

[0018] The present invention also provides the use of the molecular marker, the primer pair or the kit in assisting grape breeding.

[0019] The present invention discloses the following technical effects:

[0020] (1) Through in-depth analysis of whole genome resequencing data, the present invention selected a marker site with significant genotype differences, namely the InDel site at 7,224,357 bp on chromosome 13 of grape. The 34 bp deletion at this site makes the interspecific hybrid grapes appear as double bands on the electrophoresis map, while the Eurasian grapes appear as a single band. This stable genetic difference ensures that the present invention has high accuracy in the identification process of interspecific hybrid grapes, effectively avoiding the problem of misclassification.

[0021] (2) The molecular marker system of the present invention provides accurate genetic background classification in the early stage of grape breeding. This precise genetic information supports breeders to quickly screen individuals that meet breeding goals and eliminate individuals that have not been effectively hybridized, thereby shortening the breeding cycle and improving breeding efficiency. At the same time, the molecular marker can also be used to identify seedlings and determine the genetic background of seedlings, providing molecular-level evidence for seedling evaluation and identification, and ensuring the accuracy of seedlings.

[0022] (3) Compared with traditional methods, the single marker site system of the present invention significantly simplifies the detection process and reduces the reliance on multiple marker sites. This simplification measure reduces reagent consumption and operation steps, making large-scale screening and classification more economical and feasible, thereby significantly reducing the overall cost of germplasm identification.

[0023] (4) The molecular marker technology of the present invention not only improves the accuracy of identification of interspecific hybrids of grapes, but also provides a reliable scientific basis for the registration and protection of new grape varieties. By accurately distinguishing interspecific hybrids from Eurasian grapes, the technology effectively prevents variety confusion and maintains the legitimacy and uniqueness of the varieties. In addition, the present invention supports the registration, certification and intellectual property protection of grape seedlings, further helping to maintain the market value and legal rights of the varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0025] Figure 1 is the electrophoresis typing result of molecular marker IH1 in interspecific hybrids and Eurasian grapes; M represents a 500bp DNA marker, and 1-30 correspond to grape varieties Beixiang, Beifeng, Beizi, Beiquan, Xinbeichun, Beichun, Beihong, Beixin, Beimei, Sangiovese, Syrah, Ugni Blanc, Aligoté, Riesling, Zidaifu, Chardonnay, Pinot Gris, Pinot Blanc, Pinot Noir, Petit Manseng, Guirenxiang, Petit Verdot, Malbec, Sauvignon Blanc, Grenache, Marselan, Cabernet Sauvignon, Cabernet Gernischt, Cabernet Franc, and Merlot, respectively. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] Example 1 Screening and Identification of Molecular Marker IH1 of Vitis vinifera and Its Hybrids

[0032] The present invention selects representative Vitis vinifera (Cabernet Sauvignon, Cabernet Franc, Pinot Noir, etc.) and their interspecific hybrids (Northern Red, Northern Rose, etc.) for whole genome resequencing, performs standardization on the sequencing data, and identifies a significant InDel site (site information is shown in Table 1), which is located at 7,224,357bp on chromosome 13 of the grape, and the reference genome is V. vinifera PN40024 (12X). At this site, there is a significant difference between the interspecific hybrid and Vitis vinifera. The wild parent of the interspecific hybrid has a 34bp deletion, which causes the hybrid offspring to carry different alleles and show a heterozygous state, while Vitis vinifera does not have such a deletion and remains in a homozygous state. Based on this site, a molecular marker IH1 (nucleotide sequence such as SEQ ID NO: 1) is designed, and the target fragment is specifically amplified. The Vitis vinifera and its interspecific hybrid can be intuitively distinguished through the number and distribution differences of the electrophoresis bands.

[0033] Sequence of molecular marker IH1:

[0034] CCCCAGGCTATTTGTGAAGAAGATGAAGAAGATGACAAAAATGACAAT AAGATCAAGGCAAATTCTTA GTATTCATCGACTC AGAAATCTTATCTCAAGCAAAAGTATCAAATGAATATTAGATCAGGCATTACACTGGTTAATTTAGAGGTTACAATTGTATGTAACAAATAAAGCTGATTTCTGTATCCACCCAAA. The underlined portion of the above sequence is a 34 bp sequence that is deleted.

[0035] Table 1 Sequence information of InDel sites corresponding to marker IH1

[0036]

[0037] This embodiment mainly includes the following steps:

[0038] (1) Genomic data analysis and variant information acquisition

[0039] Representative European and Asian grape species and their interspecific hybrids were selected for whole genome resequencing. The sequencing data were standardized and the information of variant sites with significant genetic differences was extracted.

[0040] (2) Marker region selection and primer design

[0041] A site with genotypic differences was selected, and a marker region was screened in the region about 150 bp upstream and downstream of the site, and specific primers were designed for classification and identification. The selected marker region contains relatively stable genetic variability, and its two-wing sequences are consistent. Such a dominant marker can effectively distinguish Vitis vinifera and its interspecific hybrids.

[0042] (3) Sample preparation and DNA extraction

[0043] Select young and tender tissues of grapes (such as leaves, young stems, roots, etc.) or use mature tissues in special cases. Use the modified CTAB method to extract genomic DNA to obtain high-quality DNA samples to ensure the accuracy and reliability of subsequent analysis.

[0044] (4) PCR amplification

[0045] Touchdown-PCR was used for amplification, and the reaction volume was 50 μL. This method improves amplification specificity by gradually lowering the annealing temperature, thereby enhancing the detection ability of the target fragment.

[0046] Table 2 Reaction system

[0047]

[0048] The reaction program was as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s (0.5°C reduction per cycle), extension at 72°C for 30 s, for a total of 5 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for a total of 25 cycles; finally extension at 72°C for 5 min; and storage at 4°C.

[0049] Primer 1: 5'-CCCCAGGCTATTTGTGAAGA-3' (SEQ ID NO: 2);

[0050] Primer 2: 5'-TTTGGGTGGATACAGAAATCAG-3' (SEQ ID NO: 3)

[0051] (5) Electrophoresis and result verification

[0052] Polyacrylamide gel electrophoresis was used, and silver staining was used for color development. The electrophoresis results showed that the interspecific hybrid showed double bands, while the Vitis vinifera showed a single band. This was due to the difference in the genotypes of the two at the marker site. The interspecific hybrid had a 34bp deletion, which caused it to carry different alleles and show a heterozygous state; the Vitis vinifera did not have such a mutation and showed a homozygous state. The number and distribution of bands can distinguish the Vitis vinifera from its interspecific hybrids.

[0053] Example 2 Application of molecular marker IH1 in identification of Eurasian grapes and their hybrids

[0054] In this example, 9 interspecific hybrids (Beixiang, Beifeng, Beizi, Beiquan, Xinbeichun, Beichun, Beihong, Beixin, and Beimei) independently bred in the laboratory as shown in Table 3 and 21 Eurasian wine grapes (Sangiovese, Syrah, Ugni Blanc, Aligoté, Riesling, Zidave, Chardonnay, Pinot Gris, Pinot Blanc, Pinot Noir, Petit Manseng, Guirenxiang, Petit Verdot, Malbec, Sauvignon Blanc, Grenache, Marselan, Cabernet Sauvignon, Cabernet Gernischt, Cabernet Franc, and Merlot) were selected to verify the typing effect of marker IH1.

[0055] 1. Sampling and DNA extraction

[0056] Young leaves, tender stems and other tender tissues of hybrid seedlings were collected, and DNA was extracted using the improved CTAB plant genomic DNA rapid extraction kit.

[0057] Table 3 Names of hybrid seedling germplasm resources

[0058]

[0059]

[0060] 2. DNA quality testing

[0061] The purity and concentration of DNA samples were detected by ultraviolet-visible spectrophotometer and 1% agarose gel electrophoresis. 260 / 280 When the value is between 1.8 and 2.0, the purity is considered high. At the same time, the purity and concentration of the DNA sample are tested by 1% agarose gel electrophoresis. The high clarity and uniformity of the bands indicate that the DNA extraction quality is high; if tailing occurs, it indicates that the DNA is degraded and needs to be re-extracted. Finally, combining these two methods, the DNA concentration is diluted to about 200 ng / μL and stored at 4°C. If it is to be stored for a long time, it can be placed at -20°C.

[0062] 3. PCR amplification

[0063] 3.1 Primer design

[0064] Specific primers were designed based on the location of the InDel site at 7,224,357 bp on grape chromosome 13, as shown below:

[0065] Table 4 Molecular marker IH1 specific amplification primer information

[0066]

[0067] 3.2 PCR reaction system

[0068] All operations were performed on ice, and the total PCR amplification reaction system was 50 μL, as in Table 2 of Example 1.

[0069] 3.3 PCR parameters

[0070] To improve the specificity of the amplified product, Touchdown-PCR was used to amplify the target fragment. The specific procedure was as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s (0.5°C lowered for each cycle), and extension at 72°C for 30 s, for a total of 5 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s, for a total of 25 cycles; finally extension at 72°C for 5 min; and storage at 4°C.

[0071] 4. Polyacrylamide gel electrophoresis

[0072] (1) Preparation of electrophoretic gel

[0073] This standard uses 12% polyacrylamide gel, with a gel area of ​​306×95mm 2, the specific production process is: rinse the long and short rubber plates with detergent and tap water, then rinse with distilled water 1 to 2 times and dry. Then spray the surface with 95% ethanol. After the ethanol evaporates and confirms that there are no impurities, place the long rubber plate horizontally on the flat bracket of the laboratory table, then place the short rubber plate on it, and finally clamp the two sides of the rubber plate with clips. After assembly, use 1.5% agarose to seal the bottom. Prepare 70mL of 12% non-denaturing gel. Add 24.5mL of distilled water, 28mL of 30% polyacrylamide (29:1), 25mL of SDS-PAGE separation gel buffer, 700μL of 10% ammonium persulfate, and finally add 28μLTEMED to a clean conical flask. After mixing, use horizontal glue pouring and slowly add the glue solution to the glue chamber formed by the two glass plates to avoid bubbles. If bubbles are generated during the glue pouring process, gently tap the glass plate to remove the bubbles. Finally, insert the comb and gel for 1 to 2 hours.

[0074] (2) Electrophoresis parameters

[0075] A vertical electrophoresis tank was used, the electrophoresis voltage was 220 V, the current fluctuated with the voltage, and the electrophoresis time was 1 h.

[0076] (3) Dyeing

[0077] The results of polyacrylamide gel electrophoresis were detected by silver staining and photographed for record. The specific steps are as follows:

[0078] ① Fixation: After removing the gel, place it in a flat plate containing 250mL of 10% glacial acetic acid, so that the solution covers the gel surface by about 5mm, and shake it in parallel for 15 minutes.

[0079] ②Washing: Pour off the acetic acid solution and wash with distilled water 3 times, 2 minutes each time.

[0080] ③ Staining: Pour out the distilled water, add 250mL of 2‰ AgNO3 solution into the dish, and then shake in parallel for 30 minutes.

[0081] ④Washing: Pour out the fixing solution, add distilled water to wash once, and shake for about 10 seconds.

[0082] ⑤ Color development: Add 250mL of 3% NaOH solution and 1.25mL of formaldehyde into the dish and shake in parallel for about 10 minutes until color develops.

[0083] ⑥ Fixation: Pour away the color developing solution, add 250mL of 10% glacial acetic acid, and shake for 2 minutes to terminate the reaction.

[0084] ⑦ Preservation: Pour out the fixative, add distilled water, and preserve the gel.

[0085] 5. Results Analysis

[0086] like Figure 1As shown in the figure, the sample numbering sequence is consistent with the numbering sequence in Table 3. The electrophoresis results show that all interspecific hybrids present double bands, that is, the amplified product presents double bands at 198bp and 164bp; while the Vitis vinifera presents a single band, that is, the amplified product presents a single band at 198bp. This is due to the difference in genotypes between the two at the marker site. The interspecific hybrid has a 34bp deletion, which causes it to carry different alleles and show a heterozygous state; the Vitis vinifera does not have such a variation and shows a homozygous state. This shows that the molecular markers of the present invention can effectively distinguish Vitis vinifera and its interspecific hybrids through the number and distribution differences of the bands.

[0087] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker for identifying Vitis vinifera and its interspecific hybrids, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO:

1. A 34 bp deletion polymorphism exists starting from the 49th position of the molecular marker.

2. The molecular marker according to claim 1, characterized in that If there is a 34 bp deletion starting from the 49th position of the molecular marker and the genotype is heterozygous, it is an interspecific hybrid grape; if there is no 34 bp deletion starting from the 49th position of the molecular marker and the genotype is homozygous, it is Vitis vinifera; wherein the sequence of the 34 bp deletion is shown in SEQ ID NO:

4.

3. A primer pair for identifying Vitis vinifera and its interspecific hybrids, characterized in that: The primer pair is used to amplify a molecular marker whose nucleotide sequence is shown in SEQ ID NO: 1, and the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

4. A kit comprising the primer pair according to claim 3.

5. A method for identifying Eurasian species and their interspecific hybrids of grapes, characterized in that: The following steps are involved: The genomic DNA of the grape sample to be tested is used as a model, and PCR amplification is performed using the primer pair described in claim 3. According to the number and distribution difference of the marker site bands of the amplified product, it is judged that the grape sample to be tested is Eurasian species or interspecific hybrid grape; the marker site is the 49th to 82nd position of the nucleotide sequence shown in SEQ ID NO:

1.

6. The method according to claim 5, characterized in that The PCR amplification reaction system includes 25 μL of 2×Rapid TaqMaster Mix, 2 μL of upstream sequence and downstream sequence respectively, 0.1-1 μg of DNA template, and ddH2O is added to a total volume of 50 μL.

7. The method according to claim 5, characterized in that The reaction procedure of the PCR amplification is as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, annealing temperature decreased by 0.5°C in each cycle, extension at 72°C for 30 s, for a total of 5 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for a total of 25 cycles; finally extension at 72°C for 5 min; and storage at 4°C.

8. The method according to claim 5, characterized in that The determination method is: if a double band appears at the marker site, it is determined to be an interspecific hybrid grape; if a single band appears at the marker site, it is determined to be a Vitis vinifera.

9. Use of the molecular marker according to any one of claims 1 to 2, the primer pair according to claim 3, or the kit according to claim 4 in identifying Vitis vinifera and its interspecific hybrids.

10. Use of the molecular marker according to any one of claims 1 to 2, the primer pair according to claim 3, or the kit according to claim 4 in assisted grape breeding.

Images