Anti-wars1 antibodies and uses thereof

Abstract

The present invention relates to an anti-WARS1 antibody and a pharmaceutical composition comprising the same as an active ingredient. The anti-WARS1 antibody disclosed by the invention is specifically combined with the WARS1, so that the secretion of TNF-alpha induced by the WARS1 can be inhibited. In addition, the anti-WARS1 antibody of the present invention can be effectively used in the prevention or treatment of inflammatory diseases including sepsis, chronic obstructive pulmonary disease, inflammatory bowel disease, rheumatoid arthritis, atopic dermatitis, macrophage activation syndrome, and the like.

Description

Technical Field

[0001] The present invention relates to an antibody specifically binding to a WARS1 protein and uses thereof. Background Art

[0002] Aminoacyl-tRNA synthetase (ARS) plays a key role in the production of proteins as an enzyme that mediates the reaction in which amino acids specifically bind to tRNA. Recently, it has been found that in addition to protein production, the above-mentioned ARS is also related to various life phenomena such as apoptosis, angiogenesis, and inflammatory response. In ARS, human tryptophanyl-tRNA synthetase 1 (tryptophanyl-tRNA synthetase 1, WARS1) is an aminoacyl-tRNA synthetase that connects tRNA that recognizes tryptophan and tryptophan. Recently, the role of WARS1 in the host's defense mechanism against infection has received increasing attention. The inventors have previously reported that within a few minutes after being infected with bacteria, monocytes can secrete WARS1 present in the cell to the outside without de novo synthesis (Young Ha Ahn. et al. Nature Microbiology (2016) 2: 16191).

[0003] Secreted WARS1 can serve as an endogenous ligand for TLR4 and TLR2, inducing the activation of innate immunity by activating macrophages. Furthermore, WARS1 initiates the production of pro-inflammatory cytokines and chemokines including TNF-α, IL-6, MIP-1α, and IL-8 and induces the infiltration of neutrophils. Then, the expression of the WARS1 gene maintains the continuous secretion of WARS1 under the induction of IFN-γ. Consistent with the above findings, high levels of WARS1 were also observed in the blood of patients with sepsis.

[0004] In view of this, a strategy of developing anti-WARS1 antibodies for the treatment of infectious and / or inflammatory diseases caused by bacteria, viruses and / or fungi can be considered. However, ARS including WARS1 have many similarities in protein structure, so antibodies obtained by immune response show problems such as cross-reactivity with other ARS, and in most cases, highly sensitive antibodies are not generated.

[0005] Therefore, it is necessary to develop antibodies that can specifically bind only to WARS1 without cross-reacting with other ARSs to effectively neutralize WARS1. Summary of the invention

[0006] Technical issues

[0007] The present inventors have devoted themselves to discovering antibodies or fragments thereof that specifically bind to WARS1, which is expressed at significantly increased levels in patients with infectious diseases such as sepsis. As a result, they prepared a novel anti-WARS1 antibody that specifically binds to WARS1 and inhibits inflammatory responses in immune cells, and confirmed its pharmacological activity, thereby completing the present invention.

[0008] Technical Solution

[0009] In order to achieve the above-mentioned object, one embodiment of the present invention provides an anti-WARS1 antibody or a fragment thereof, comprising: a heavy chain variable region, comprising an H-CDR1 comprising an amino acid sequence comprising sequence 3, an H-CDR2 comprising an amino acid sequence comprising sequence 5, and an H-CDR3 comprising an amino acid sequence comprising sequence 7; and a light chain variable region, comprising an L-CDR1 comprising an amino acid sequence comprising sequence 12, an L-CDR2 comprising an amino acid sequence as shown in the following sequence 95, and an L-CDR3 comprising an amino acid sequence as shown in the following sequence 96: N-terminal -Ala Asn Xaa1 Xaa2 His Arg Pro Ser-C terminus (SEQ ID NO: 95), wherein Xaa1 is Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro, and Xaa2 is Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro, in which case when Xaa1 is Ser, Xaa2 is not His, N-terminus-Gly Ala Trp AspAsp Ser Xaa3 Ser Ala Tyr Val-C terminus (SEQ ID NO: 96), wherein Xaa3 is Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro.

[0010] Still another embodiment of the present invention provides a polynucleotide encoding the above-mentioned antibody or a fragment thereof, an expression vector comprising the above-mentioned polynucleotide, and a transformed cell introduced with the above-mentioned expression vector.

[0011] Another embodiment of the present invention provides a method for preparing an antibody or a fragment thereof, comprising: a step of culturing the above-mentioned transformed cells; and a step of obtaining the antibody or a fragment thereof.

[0012] Another embodiment of the present invention provides a pharmaceutical composition for preventing or treating inflammatory diseases, comprising the above-mentioned antibody or a fragment thereof as an active ingredient.

[0013] Another embodiment of the present invention provides use of the above-mentioned antibody or fragment thereof in preventing or treating inflammatory diseases.

[0014] Another embodiment of the present invention provides a method for preventing or treating inflammatory diseases, comprising the step of administering the above antibody or fragment to an individual.

[0015] Effects of the Invention

[0016] The anti-WARS1 antibody of the present invention specifically binds to WARS1 and inhibits the secretion of TNF-α induced by WARS1 in immune cells. In addition, the anti-WARS1 antibody of the present invention was administered to a severe sepsis mouse model, a chronic obstructive pulmonary disease mouse model, an inflammatory bowel disease mouse model, a rheumatoid arthritis mouse model, an atopic dermatitis mouse model, and a macrophage activation syndrome model, and the results showed that the anti-WARS1 antibody of the present invention had a disease-improving effect in the mouse models of each disease. Therefore, the anti-WARS1 antibody of the present invention can be effectively used for the treatment of inflammatory diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The figure is a schematic diagram of the vector used to express the heavy chain of the anti-WARS1 antibody.

[0018] Figure 2 The figure is a schematic diagram of the vector used to express the light chain of the anti-WARS1 antibody.

[0019] Figure 3a and Figure 3b This is a diagram showing the results of confirming the anti-WARS1 antibody by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

[0020] Figure 4a and Figure 4b This is a graph showing the results of confirming the binding ability of anti-WARS1 antibodies to WARS1 (derived from human, marmoset (NHP), mouse, rat, or pig) by direct enzyme-linked immunosorbent assay (direct ELISA).

[0021] Figure 5 The graph shows the results of confirming the binding ability of anti-WARS1 antibodies to WARS1 (derived from human, marmoset, mouse, rat or pig) by direct enzyme-linked immunosorbent assay as a dissociation constant (Kddissociation constant).

[0022] Figures 6a to 6c This is a graph showing the results of confirming the binding ability of anti-WARS1 antibodies to WARS1 (derived from human, marmoset, mouse, rat, or pig) by the sandwich enzyme-linked immunosorbent assay (ELISA) method.

[0023] Figure 7 The figure shows the results of confirming the binding specificity of anti-WARS1 antibodies to recombinant WARS1 protein and secreted WARS1 by Western blotting. Hu: human, Mar: marmoset, P: pig, R: rat, M: mouse.

[0024] Figure 8 Shown are the results of peptide preparation using the human WARS1 sequence and epitope mapping of antibody binding specificity.

[0025] Figures 9a to 9c The figure shows the preparation of alanine (Ala) mutants of human WARS1 recombinant protein for epitope mapping and the results.

[0026] Fig.10 This is a graph showing the results of measuring the concentration of TNF-α in the culture medium after treating a mouse macrophage cell line (J774.1A) with a recombinant WARS1 protein and IgG or an anti-WARS1 antibody.

[0027] Fig.11 This is a diagram showing an experimental plan for confirming the anti-inflammatory effect of an anti-WARS1 antibody using a sepsis mouse model.

[0028] Fig.12 This is a graph showing the results of examining the survival rate of mice after administering IgG1 or anti-WARS1 antibody to a severe sepsis mouse model.

[0029] Fig.13 It is a diagram showing the base sequence of the pOptiVec Topo vector.

[0030] Fig.14 This is a graph showing the results of confirming the anti-inflammatory activity of anti-WARS1 antibodies (GKB101, H54K) in human lung fibroblasts (HLF). *p<0.05, **p<0.01, ***p<0.001 vs PBS.

[0031] Fig.15 The figure shows the experimental scheme for examining the efficacy of anti-WARS1 antibody (H54K) in inhibiting respiratory damage using a COPD mouse model.

[0032] Fig.16a and Fig.16bThe graph shows the results of administering normal (Normal), isotype (Isotype) IgG1 or anti-WARS1 antibody (H54K) to the COPD mouse model, and confirming the infiltration of immune cells in the lung tissue, collagen deposition, and mucus secretion in the respiratory tract by hematoxylin and eosin (H&E) staining, Masson trichrome staining, and periodic acid-Schiff-Alcian Blue (PAS-AB) staining, respectively.

[0033] Fig.17a and Fig.17b To show that after administration of PBS (CON), isotype IgG1 or anti-WARS1 antibody (H54K) to COPD mouse model, alveolar lavage fluid ( Fig.17a ) and lung tissue ( Fig.17b ) is a graph showing the results of inflammatory cytokine and chemokine expression in the cells. *p<0.05, **p<0.001.

[0034] Fig.17c This is a graph showing the results of confirming the expression of cough-inducing genes in lung tissue by quantitative polymerase chain reaction (q-PCR) after administration of PBS (CON), isotype IgG1, or anti-WARS1 antibody (H54K) to a COPD mouse model.

[0035] Fig.18a and Fig.18b To show that after administration of PBS (CON), isotype IgG1 or anti-WARS1 antibody (H54K) to COPD mouse model, lung tissue ( Fig.18b ) and bronchoalveolar lavage fluid ( Fig.18a ) is a graph of the results for immune cells within the cell.

[0036] Fig.19 This is a graph showing the results of analyzing immune cells in mediastinal lymph nodes by flow cytometry after administration of PBS (CON), isotype IgG1, or anti-WARS1 antibody (H54K) to a COPD mouse model.

[0037] Fig. 20 To show the results of analyzing immune cells in the blood by flow cytometry after administration of PBS (CON), isotype IgG1, or anti-WARS1 antibody (H54K) to the COPD mouse model.

[0038] Fig.21This is a diagram showing an experimental plan for confirming the inflammatory bowel disease-improving effect of an anti-WARS1 antibody using a dextran sulfatesodium-induced colitis (DSS) mouse model.

[0039] Fig.22a This is a diagram showing the clinical index determination standard for assigning a clinical activity index (DAI) for evaluating the inflammatory bowel disease improving effect of an anti-WARS1 antibody (GKB101, H54K) using a DSS mouse model.

[0040] Figure 22b The graph shows the results of evaluating the clinical activity index of each administration group after administration of saline, isotype IgG1 (IgG1) or anti-WARS1 antibody (GKB101, H54K) in the DSS mouse model. In this case, the control group (control) is a group without treatment.

[0041] Fig.23 The graph shows the results of evaluating the intestinal bleeding score of each administration group after administration of saline (saine), isotype IgG1 (IgG1) or anti-WARS1 antibody (GKB101, H54K) in the DSS mouse model. In this case, the control group (control) is a group without treatment.

[0042] Fig.24 The graph shows the results of evaluating the colonic consistency (stool consistency) score of each administration group after administration of saline, isotype IgG1 (IgG1) or anti-WARS1 antibody (GKB101, H54K) in the DSS mouse model. In this case, the control group (control) is a non-treated group.

[0043] Fig.25 The graph shows the results of measuring the intestinal length of each administration group after administration of saline, isotype IgG1 (IgG1) or anti-WARS1 antibody (GKB101, H54K) in the DSS mouse model. In this case, the control group (control) is a group without treatment.

[0044] Fig.26 The graph shows the results of measuring the spleen weight of each administration group after administration of saline, isotype IgG1 (IgG) or anti-WARS1 antibody (GKB101, H54K) in the DSS mouse model. In this case, the control group (control) is a group without treatment.

[0045] Fig. 27 The graph shows the results of measuring immune factors in various parts of intestinal tissue after administration of saline, isotype IgG1 (IgG) or anti-WARS1 antibody (GKB101, H54K) in the DSS mouse model. *p<0.05, ***p<0.001, ****p<0.0001 vs. saline administration group.

[0046] Fig.28 This is a graph showing the results of confirming the gene expression of immune factors in various parts of intestinal tissue by qPCR after administration of saline, isotype IgG1 (IgG), or anti-WARS1 antibody (GKB101, H54K) in the DSS mouse model. *p<0.05, **p<0.01, ***p<0.001 vs. saline administration group.

[0047] Fig.29 The graph shows the results of confirming the degree of crypt damage in the colon tissue of each administration group by H&E staining after administration of physiological saline (saline), isotype IgG1 (IgG) or anti-WARS1 antibody (GKB101, H54K) in the DSS mouse model.

[0048] Fig.30 This is a graph showing the anti-inflammatory activity of anti-WARS1 antibody (H54K) confirmed in J774A.1 cells, human fibroblast-like synoviocytes (FLS), and osteoclasts differentiated from RAW264.7 cells. *p<0.05, **p<0.01, ***p<0.001.

[0049] Fig.31 The figure shows the experimental scheme for examining the rheumatoid arthritis improving effect of anti-WARS1 antibody in the collagen-induced arthritis (CIA) mouse model.

[0050] Fig.32a This is a graph showing the clinical index standard for evaluating the clinical arthritis index by observing the feet of each administration group after administration of isotype IgG1 or anti-WARS1 antibody (GKB101, H54K) to the CIA mouse model.

[0051] Figure 32bThis figure shows the results of analyzing the clinical arthritis index and the AUC thereof by observing the feet of each administration group after administration of isotype IgG1 or anti-WARS1 antibody (GKB101, H54K) to the CIA mouse model. *p<0.05, **p<0.01 vs. H54K antibody administration group.

[0052] Figures 33a to 33d This is a graph showing the results of confirming the expression of inflammatory factors in the serum and foot joints of each administration group after administration of isotype IgG1 or anti-WARS1 antibody (GKB101, H54K) to the CIA mouse model. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 vs. anti-WARS1 antibody administration group.

[0053] Figures 34a to 34c The graphs and diagrams show the results of confirming the anti-inflammatory activity, cell migration and proliferation inhibitory effects of anti-WARS1 antibody (GKB101, H54K) in human dermal fibroblasts (HDFa) or human keratinocytes treated with Staphylococcus aureus. *p<0.05, ***p<0.001, ****p<0.0001 vs PBS.

[0054] Fig.35 This is a diagram showing the experimental plan for confirming the atopic dermatitis improving effect of anti-WARS1 antibodies in an atopic mouse model.

[0055] Fig.36 The graph shows the results of evaluating clinical indicators in each administration group after administration of isotype IgG1, dexamethasone, or anti-WARS1 antibody (GKB101, H54K) to an atopic mouse model.

[0056] Fig.37 This is a graph showing the results of confirming that the anti-WARS1 antibody (GKB101, H54K) improves tight junction in human colon cancer cell line (Caco-2). *p<0.05, **p<0.01, ***p<0.001 vs PBS.

[0057] Fig.38 This is a diagram showing the experimental plan for confirming the anti-inflammatory effect of anti-WARS1 antibody (GKB101, H54K) in tissues in the macrophage activation syndrome model using CpG.

[0058] Fig.39This is a graph showing the results of evaluating ferritin, one of the clinical indicators, after administration of an anti-WARS1 antibody (GKB101, H54K) in a macrophage activation syndrome model using CpG.

[0059] Fig.40a and Fig.40b The graphs show the results of measuring the expression of WARS1 and inflammatory cytokines in the liver tissue of mice after administration of an anti-WARS1 antibody (GKB101, H54K) in a macrophage activation syndrome model using CpG.

[0060] Fig.41a and Fig.41b The graph shows the results of analyzing the distribution and infiltration of immune cells in the spleen and liver tissues of mice after administration of anti-WARS1 antibody (GKB101, H54K) in the macrophage activation syndrome model using CpG. DETAILED DESCRIPTION

[0061] Anti-WARS1 Antibody

[0062] The present invention provides an antibody or a fragment thereof that specifically binds to WARS1.

[0063] In this case, the antibody or fragment thereof that specifically binds to WARS1 may be an antibody or fragment thereof that specifically binds to R20, R24, K27, I36, I43, or K47. The WARS1 may be human WARS1 comprising the amino acid sequence of sequence 94.

[0064] The term "antibody" used in this specification refers to an immunoglobulin molecule that reacts with a specific antigen, and refers to a protein molecule that specifically recognizes an antigen. The heavy chain and light chain of an immunoglobulin may each contain a constant region (C) and a variable region (V). The light chain and heavy chain variable regions of an immunoglobulin contain three variable regions called complementarity determining regions (CDRs) and four framework regions (FRs). The above CDRs are mainly antigen binding sites that bind to the epitope of an antigen.

[0065] The term "WARS" used in this specification refers to tryptophanyl-tRNA synthetase, also known as tryptophan-tRNA ligase, TrpRS, WRS, etc. WARS is an enzyme that mediates the aminoacylation reaction of the amino acid tryptophan and tRNA. WARS is encoded by the WARS gene in humans, and the amino acid sequence and mRNA base sequence of the protein are known as Genbank accession number NP_004175.2 (protein), GenBank accession number NM_004184.3 (mRNA base sequence), etc. WARS has two subtypes (isoforms) such as cytoplasmic form (cytoplasmic form) (WARS1 or tryptophanyl-tRNAsynthetase 1, cytoplasmic) and mitochondrial form (mitochondrial form) (WARS2 or tryptophanyl-tRNAsynthetase 2, mitochondrial). In the present invention, WARS may be WARS1. The WARS1 described above is not limited, and preferably, it may be human WARS1 comprising the amino acid sequence of sequence 94.

[0066] The anti-WARS1 antibody of the present invention may be an antibody or a fragment thereof that specifically binds to the above-mentioned WARS1. Furthermore, the antibody fragment of the present invention may be Fab, F(ab')2, Fd, sdFv, Fv, dAb, scFv, sdAb, tetramer, etc., and may include any form that includes an antigen binding site that can specifically bind to WARS1.

[0067] One embodiment of the present invention provides an anti-WARS1 antibody or a fragment thereof, comprising: a heavy chain variable region, comprising an H-CDR1 comprising an amino acid sequence comprising sequence 3, an H-CDR2 comprising an amino acid sequence comprising sequence 5, and an H-CDR3 comprising an amino acid sequence comprising sequence 7; and a light chain variable region, comprising an L-CDR1 comprising an amino acid sequence comprising sequence 12, an L-CDR2 comprising an amino acid sequence as shown in the following sequence 95, and an L-CDR3 comprising an amino acid sequence as shown in the following sequence 96: N-terminal -Ala Asn Xaa1 Xaa2 His Arg Pro Ser-C terminus (sequence 95), wherein Xaa1 can be Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro, and Xaa2 can be Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro, and when Xaa1 is Ser, Xaa2 is not His. N-terminus - Gly Ala Trp Asp Asp Ser Xaa3 Ser AlaTyr Val - C-terminus (SEQ ID NO: 96), wherein Xaa3 can be Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro.

[0068] Specifically, in the L-CDR2 of the light chain variable region, Xaa1 may be any one selected from the group consisting of Ile, Leu, Thr, Val and Gln, in which case Xaa2 may be His or Leu. Furthermore, when Xaa1 is Ser, Xaa2 may be any one selected from the group consisting of Ile, Leu, Lys, Glu and Phe.

[0069] Specifically, in the above-mentioned L-CDR3 of the light chain variable region, Xaa3 may be Leu or Asn.

[0070] More specifically, the L-CDR1 of the above-mentioned light chain variable region may include the amino acid sequence of sequence 12, L-CDR2 may include any amino acid sequence selected from the group consisting of sequence 20, sequence 22, sequence 24, sequence 26, sequence 28, sequence 30, sequence 32, sequence 34, sequence 36, sequence 38, sequence 40, sequence 42 and sequence 44, and L-CDR3 may include the amino acid sequence of sequence 16 or sequence 46.

[0071] Preferably, the heavy chain variable region may comprise the amino acid sequence of SEQ ID NO: 9. Furthermore, the light chain variable region may comprise any amino acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 49.

[0072] In one example of the present invention, the antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 21.

[0073] In one example, the antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 23.

[0074] In one example, the antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 25.

[0075] In one example, the antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 27.

[0076] In one example, the antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 29.

[0077] In one example, the antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 31.

[0078] In one example, the antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 33.

[0079] In one example, the antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 35.

[0080] In one example, the above-mentioned antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 37.

[0081] In one example, the above-mentioned antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 39.

[0082] In one example, the antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 41.

[0083] In one example, the antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 43.

[0084] In one example, the antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 45.

[0085] In one example, the above-mentioned antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 47.

[0086] In one example, the above-mentioned antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 48.

[0087] In one example, the antibody or fragment thereof may comprise: a heavy chain variable region comprising the amino acid sequence of sequence 9 and a light chain variable region comprising the amino acid sequence of sequence 49.

[0088] In the present invention, the antibody or fragment thereof may include an immunoglobulin Fc region. In this case, the immunoglobulin Fc region refers to a protein that includes the heavy chain constant region 2 (CH2) and the heavy chain constant region 3 (CH3) of an immunoglobulin, but does not include the variable region of the heavy chain and light chain of the immunoglobulin and the light chain constant region (CL). The immunoglobulin Fc region may be derived from IgG, IgA, IgE, IgD or IgM.

[0089] Furthermore, not only the wild-type Fc region, but also the Fc region of the above-mentioned immunoglobulin can be an Fc region variant. Furthermore, the term "Fc region variant" used in this specification is different from the sugar chain pattern (glycosylation pattern) of the wild-type Fc region, and can be a form in which sugar chains are increased compared to the wild-type Fc region, sugar chains are reduced compared to the wild-type Fc region, or sugar chains are removed (deglycosylated). Furthermore, it also includes aglycosylated Fc regions. The Fc region or variant can have adjusted numbers of sialic acid (sialic acid), fucosylation (fucosylation), and glycosylation (glycosylation) by adjusting culture conditions or genetic engineering of the host.

[0090] Furthermore, the sugar chain of the Fc region of the immunoglobulin can be deformed by common methods such as chemical methods, enzymatic methods, and genetic engineering methods using microorganisms. Furthermore, the Fc region variant may be a mixed form of the Fc regions of immunoglobulins IgG, IgA, IgE, IgD, or IgM. Furthermore, the Fc region variant may be a form in which a part of the amino acids in the Fc region are substituted with other amino acids.

[0091] In one specific example of the present invention, the Fc region may comprise the amino acid sequence of sequence 51.

[0092] The antibody of the present invention may contain a fusion protein comprising the light chain variable region (VL) and light chain constant region (CL) of an anti-WARS1 antibody and a fusion protein comprising the heavy chain variable region (VH), heavy chain constant region 1 (CH1) and Fc region of an anti-WARS1 antibody.

[0093] Specifically, the anti-WARS1 antibody may comprise (I) and (II): (I) N'-X'-[linker]o-Fc region fragment or variant thereof-C'; and (II) N'-X"-C'.

[0094] In this case, in the above structural formulas (I) and (II), the above N' is the N-terminus, the above C' is the C-terminus, the above X is the antigen-binding site of the anti-WARS1 antibody or a fragment thereof, which is composed of X' and X", the above X' is the antigen-binding site of the heavy chain of the anti-WARS1 antibody or a fragment thereof, which includes the variable region (VH) and the CH1 region, the above X" is the light chain antigen-binding site of the anti-WARS1 antibody or a fragment thereof, which includes the variable region (VL) and the constant region (CL), the above linker is a peptide linker, and the above o is 0 or 1.

[0095] In this case, the anti-WARS1 antibody or a fragment thereof, the antigen-binding site, the variable region, and the constant region are as described above.

[0096] The peptide linker may be composed of 1 to 50 consecutive amino acids or 3 to 30 consecutive amino acids. In one example, the peptide linker may be composed of 23 amino acids. Furthermore, the peptide linker may contain at least one cysteine. Specifically, it may contain one, two or three cysteines. Furthermore, the peptide linker may be derived from the hinge of an immunoglobulin. For example, the hinge may be selected from the hinge regions of a variety of IgG subtype antibodies. Furthermore, the hinge may be in a form in which a portion of the amino acids in the hinge region of an immunoglobulin source are substituted by other amino acids, or in a form in which a portion of the amino acid sequence is appended. In a specific example, the peptide linker may be a peptide linker consisting of an amino acid sequence of sequence 50.

[0097] Polynucleotide encoding anti-WARS1 antibody

[0098] Another embodiment of the present invention provides a polynucleotide encoding an anti-WARS1 antibody or a fragment thereof. The anti-WARS1 antibody or a fragment thereof is as described above.

[0099] The polynucleotide may include the base sequence of sequence 52 encoding the heavy chain region of an anti-WARS1 antibody or a fragment thereof. The polynucleotide may include any base sequence selected from the group consisting of sequence 54 to sequence 69 encoding the light chain region of an anti-WARS1 antibody or a fragment thereof.

[0100] Furthermore, as long as the same polypeptide is encoded, the polynucleotide can be mutated by substitution, insertion, deletion or a combination thereof of one or more bases. In the case of preparing the polynucleotide sequence by chemical synthesis, the synthesis method known in the technical field to which the present invention belongs can be used, for example, the method described in the document Engels and Uhlmann, Angew Chem Int Ed Engl., 37: 73-127, 1988 can be used, and it can be triester, phosphite, phosphoamine and H-phosphate method, PCR and other automatic primer methods, oligonucleotide synthesis on solid support, etc.

[0101] According to one specific example, the above-mentioned polypeptide can comprise a base sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or at least about 100% identical to the base sequence of SEQ ID NO: 52, SEQ ID NO: 54 to SEQ ID NO: 69.

[0102] The above-mentioned polynucleotide may also contain a signal sequence or a leader sequence. The term "signal sequence" used herein refers to a nucleic acid encoding a signal peptide that indicates the secretion of the target protein. The above-mentioned signal peptide is cleaved after translation in the host cell. Specifically, the signal sequence of the present invention is a nucleotide encoding an amino acid sequence that starts the movement of a protein that penetrates the endoplasmic reticulum (ER, endoplasmic reticulum) membrane.

[0103] The characteristics of the signal sequence are well known in the art to which the present invention belongs, and usually contain 16 to 30 amino acid residues, or more or less amino acid residues than this. The usual signal peptide is composed of three regions: the basic N-terminal, the central hydrophobic region, and the more polar C-terminal region. The central hydrophobic region contains 4 to 12 hydrophobic residues that immature polypeptides use to fix the signal sequence when moving through the membrane lipid bilayer.

[0104] After initiation, the signal sequence is cleaved in the lumen of the ER by cellular enzymes known as signal peptidases. In this case, the signal sequence may be a tissue plasminogen activation (tPa), a herpes simplex virus glycoprotein D signal sequence (HSV gDs), an IgG signal sequence, or a secretory signal sequence of growth hormone. Preferably, secretory signal sequences used in higher eukaryotic cells, including mammals, may be used. The signal sequences useful in the present invention include, for example, antibody light chain signal sequences such as antibody 14.18 (Gillies et al., J. Immunol. Meth 1989. 125: 191-202), antibody heavy chain signal sequences such as MOPC141 antibody heavy chain signal sequence (Sakano et al., Nature, 1980. 286: 676-683), and other signal sequences known in the art to which the present invention belongs (for example, see Watson et al., Nucleic Acid Research, 1984. 12: 5145-5164). In one example, the above signal sequence may include the amino acid sequence of sequence 1.

[0105] Vectors carrying polynucleotides

[0106] Another embodiment of the present invention provides a vector carrying the polynucleotide encoding the anti-WARS1 antibody or a fragment thereof. In this case, the polynucleotide may contain a heavy chain region comprising the base sequence of SEQ ID NO: 52 and a light chain region comprising any base sequence selected from the group consisting of SEQ ID NO: 54 to SEQ ID NO: 69.

[0107] The term "vector" used in this specification can be recombined and inserted into the host cell genome by introduction into the host cell. Alternatively, the above-mentioned vector, as an appendage, can be understood as a nucleic acid tool containing a nucleotide sequence that can replicate spontaneously. The above-mentioned vector includes linear nucleic acids, plasmids, phagemids, cosmids, RNA vectors, viral vectors, minichromosomes and the like. Examples of viral vectors include retroviruses, adenoviruses and adeno-associated viruses, but are not limited thereto.

[0108] Specifically, the above-mentioned vector can be plasmid DNA, phage DNA, etc., and can be commercially developed plasmids (pUC18, pBAD, pIDTSAMRT-AMP, etc.), Escherichia coli-derived plasmids (pYG601BR322, pBR325, pUC118, pUC119, etc.), Bacillus subtilis-derived plasmids (pUB110, pTP5, etc.), yeast-derived plasmids (YEp13, YEp24, YCp50, etc.), phage DNA (Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11, λZAP, etc.), animal virus vectors (retrovirus, adenovirus, vaccinia virus, etc.), insect virus vectors (baculovirus, etc.), etc. The protein expression amount and modification of the above-mentioned vectors vary with different host cells. Preferably, the host cell that best suits the target is selected for use.

[0109] Furthermore, the plasmid may contain a selection marker such as an antibiotic resistance gene, and the host cell retaining the plasmid may be cultured under selective conditions.

[0110] The term "gene expression" or "expression" of the target protein as used in this specification is understood to be the transcription of the DNA sequence, the translation of the mRNA transcript, and the secretion of the antibody product or its fragment. An effective expression vector may be RcCMV (Invitrogen, Carlsbad) or a variant thereof. The above expression vector may contain a human cytomegalovirus (CMV) promoter for promoting continuous transcription of the target gene in mammalian cells and a bovine growth hormone polyadenylation signal sequence for increasing the steady-state level of the transcribed RNA.

[0111] Transformed cells

[0112] Another embodiment of the present invention provides a transformed cell into which the above-mentioned expression vector carrying the polynucleotide encoding the anti-WARS1 antibody or fragment thereof is introduced. In this case, the anti-WARS1 antibody or fragment thereof is as described above.

[0113] The term "transformed cell" used in this specification refers to a prokaryotic cell or eukaryotic cell into which a recombinant expression vector can be introduced. The above-mentioned transformed cell can be prepared by introducing the vector into a host cell for transformation. In addition, the antibody or fragment thereof of the present invention can be produced by expressing the polynucleotide contained in the above-mentioned vector.

[0114] The above transformation can be carried out by a variety of methods. As long as the antibody of the present invention can be produced, it is not particularly limited. Specifically, the above transformation method can use calcium chloride (CaCl2) precipitation method, Hanahan method using a reducing substance called dimethyl sulfoxide (DMSO, dimethyl sulfoxide) in the calcium chloride precipitation method to improve efficiency, electroporation, calcium phosphate precipitation method, protoplast fusion method, stirring method using silicon carbide fiber, Agrobacterium-mediated transformation method, transformation method using PEG, dextran sulfate, Lipofectamine and drying / inhibition-mediated transformation method, etc. In addition, virus particles can be used to deliver the target into the cell by infection. In addition, the vector can be introduced into the host cell by a gene gun, etc.

[0115] Furthermore, the host cells used in the preparation of the above-mentioned transformed cells are not particularly limited as long as they are capable of producing the antibodies of the present invention. Specifically, the above-mentioned host cells may include prokaryotic cells, eukaryotic cells, mammals, plants, insects, fungi or cells of cellular origin, but are not limited thereto. An example of the above-mentioned prokaryotic cells can use Escherichia coli. And, an example of eukaryotic cells can use yeast. And, the above-mentioned mammals can use CHO cells, F2N cells, COS cells, BHK cells, Bowes melanoma cells, HeLa cells, 911 cells, AT1080 cells, A549 cells, SP2 / 0 cells, human lymphoblastoid cells, NSO cells, HT-1080 cells, PERC.6 cells, HEK 293 cells or HEK293T cells, etc., but are not limited thereto, as long as the mammals that can be used as host cells in the technical field to which the present invention belongs can be used.

[0116] Furthermore, in order to optimize the properties of antibodies as therapeutic agents or for other purposes, the glycosylation-related genes of host cells can be modified by methods known in the technical field to which the present invention belongs to adjust the sugar chain morphology (e.g., sialic acid, fucosylation, glycosylation) of the antibodies.

[0117] Method for producing anti-WARS1 antibodies or fragments thereof

[0118] Another embodiment of the present invention provides a method for preparing the anti-WARS1 antibody or a fragment thereof.

[0119] The preparation method may include: step i), culturing the transformed cells; and step ii), obtaining an anti-WARS1 antibody or a fragment thereof.

[0120] The term "culturing" used in this specification refers to a method of growing microorganisms under appropriate artificially adjusted environmental conditions.

[0121] The method for culturing the transformed cells can be carried out by a method well known in the art to which the present invention belongs. Specifically, the above-mentioned culture is not particularly limited as long as it can be produced by expressing the antibody of the present invention. The above-mentioned culture can be carried out in a continuous manner in a batch process or a fed batch or repeated fed batch process.

[0122] Furthermore, the step of obtaining the above-mentioned antibody from the culture can be carried out by a method known in the technical field to which the present invention belongs. Specifically, the above-mentioned obtaining method is not particularly limited as long as it can obtain the antibody or fragment thereof of the present invention. Preferably, the above-mentioned obtaining method can be a method such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity and size gradient).

[0123] Pharmaceutical composition comprising an anti-WARS1 antibody or a fragment thereof

[0124] Another embodiment of the present invention provides a pharmaceutical composition for preventing or treating an inflammatory disease, comprising an anti-WARS1 antibody or a fragment thereof as an active ingredient, wherein the anti-WARS1 antibody or a fragment thereof is as described above.

[0125] The term "inflammation" as used in this specification refers to a series of processes that are used to protect an organism from harmful factors, including inhibiting cell damage, removing damaged tissue and necrotic cells, and regenerating tissues through the participation of immune cells, blood vessels, and inflammatory mediators. "Inflammatory disease" is a general term for diseases with inflammation as the main lesion.

[0126] The inflammatory disease is selected from peritonitis, osteomyelitis, cellulitis, meningitis, encephalitis, pancreatitis, traumatic shock, cystic fibrosis, stroke, Lyme disease, polyarteritis nodosa, allergic vasculitis, Lou Gehrig's disease, articular cell arteritis, bursitis, tenosynovitis, epicondylitis (tennis elbow), Henoch-Schönlein purpura, multicentric reticulohistiocytosis, surcoilosis, hemochromatosis, sickle cell anemia and other hemochromatosis, hyperlipoproteinemia, hypogammaglobulinemia, familial Mediterranean fever, relapsing fever, sepsis, septic shock, multiple organ dysfunction syndrome, bronchopulmonary dysplasia (broncho-pulmonary dysplasia) Any one of the group consisting of: rheumatoid arthritis, dysplasia, inflammatory bowel disease, chronic obstructive pulmonary disease (COPD), macrophage activation syndrome (MAS), chronic systemic lupus erythematosus, scleroderma, atopic dermatitis, psoriasis, allergy, dermatitis, diabetic retinopathy, retinitis, macular degeneration, uveitis, conjunctivitis, arthritis, rheumatoid arthritis, ankylosing spondylitis, osteoarthritis, osteoporosis, allergy, diabetes, diabetic nephropathy, pyelonephritis, nephritis, Sjögren's syndrome, autoimmune pancreatitis, periodontal disease, asthma, graft versus host disease, chronic pelvic inflammation, endometritis, rhinitis, transplant rejection and chronic prostatitis.

[0127] The preferred dosage of the above-mentioned pharmaceutical composition varies with the patient's state and weight, the severity of the disease, the form of the drug, the route of administration and the period, and can be appropriately selected by relevant practitioners. In the pharmaceutical composition for preventing or treating inflammatory diseases of the present invention, as long as it can show anti-inflammatory activity, especially as long as it can show the therapeutic effect of inflammatory diseases, any amount (effective amount) of the above-mentioned antibody or its fragment can be included according to the purpose, dosage form, matching purpose, etc., based on the total weight of the composition, and the usual effective amount is determined in the range of 0.001 weight percent to 20.0 weight percent. Wherein, "effective amount" refers to the amount of active ingredients that can induce improvement or treatment of the disease state, especially the improvement of the state of inflammatory diseases or the therapeutic effect. The above-mentioned effective amount can be determined experimentally within the usual ability of relevant practitioners.

[0128] The term "treatment" used in this specification can be used to include therapeutic treatment and preventive treatment, including application or any form of administration for treating diseases in mammals including humans. In addition, the above term includes the following meanings: inhibiting or delaying the progression of a disease; restoring damaged or defective functions or partially or completely alleviating a disease by repair; or stimulating an ineffective process or alleviating a serious disease. In this case, "prevention" can be used to alleviate or reduce an individual's pathological state or disease.

[0129] Pharmacokinetic parameters such as bioavailability and underlying parameters such as clearance rate can also affect efficacy. Therefore, "improved efficacy" (e.g., improved efficacy) can result from improved pharmacokinetic parameters and improved efficacy, which can be measured in experimental animals or human subjects by comparing parameters such as clearance rate and disease treatment or improvement.

[0130] In another aspect, the pharmaceutical composition of the present invention is administered in a "therapeutically effective amount".

[0131] The term "administration" used in this specification refers to the introduction of a prescribed substance into an individual by an appropriate method, and the composition can be administered by a common route as long as it can reach the target tissue. It can be administered intraperitoneally, intravenously, intramuscularly, subcutaneously, intradermally, orally, focally, intranasally, intrapulmonaryly, or rectally, but is not limited thereto.

[0132] The term "therapeutically effective amount" or "pharmaceutically effective amount" used in this specification refers to the amount of a compound or composition that is effective in preventing or treating a target disease, and refers to an amount that is sufficient and has no side effects to treat the disease at a reasonable benefit / risk ratio that can be applied to the treatment. The level of the above-mentioned effective amount can be determined based on factors including the patient's health status, the type of disease, the severity of the disease, the activity of the drug, sensitivity to the drug, the method of administration, the time of administration, the route of administration and the metabolic ratio, the treatment period, the drugs used in combination or simultaneously, and other factors well known in the medical field. In a specific example, the therapeutically effective amount represents the amount of a drug that is effective in treating inflammatory diseases.

[0133] In this case, the pharmaceutical composition may further include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may be any carrier as long as it is a non-toxic substance suitable for delivery to the patient. It may include distilled water, ethanol, fat, wax and inactive solids. The pharmaceutical composition may further include a pharmaceutically acceptable adjuvant (buffer, dispersant).

[0134] Specifically, the pharmaceutical composition may contain a pharmaceutically acceptable carrier and be prepared into a parenteral dosage form according to the administration route by a method known in the technical field of the present invention. Wherein "pharmaceutically acceptable" means that it can be applied to the application (prescription) object without inhibiting the activity of the active ingredient and has no abnormal toxicity.

[0135] When the above-mentioned pharmaceutical composition is prepared as a dosage form for parenteral administration, it can be formulated into the form of injection, transdermal administration, nasal inhalation and suppository together with appropriate carriers according to methods known in the technical field to which the present invention belongs. When formulated as an injection, the appropriate carrier can use sterile water, ethanol, glycerol or propylene glycol and other polyols or their mixtures. Preferably, Ringer's solution, phosphate buffered saline containing triethanolamine (PBS, phosphate buffered saline) or sterile water for injection, 5% glucose isotonic solution can be used. The content of the preparation of the drug combination is well known in the technical field to which the present invention belongs. Specifically, reference can be made to the literature [Remington's Pharmaceutical Sciences (19th ed., 1995)] and the like. The above-mentioned literature is regarded as a part of this specification.

[0136] Depending on the patient's condition, weight, sex, age, severity of the patient's disease, and route of administration, the preferred dosage of the pharmaceutical composition may be in the range of 0.01 μg / kg to 10 g / kg per day or in the range of 0.01 mg / kg to 1 g / kg. Administration may be once or several times a day, or divided into once a month to once every two weeks. In any aspect, the above dosage should not be interpreted as limiting the scope of the present invention.

[0137] The subjects to which the above-mentioned pharmaceutical composition can be applied (prescribed) are mammals and humans, and humans are particularly preferred. The pharmaceutical composition of the present invention may also contain any known compound or natural extract having a therapeutic effect on inflammatory diseases.

[0138] Another embodiment of the present invention provides use of the anti-WARS1 antibody or a fragment thereof in preparing a medicament for preventing or treating an inflammatory disease, wherein the inflammatory disease, prevention, treatment, anti-WARS1 antibody or a fragment thereof are as described above.

[0139] Another embodiment of the present invention provides the use of the anti-WARS1 antibody or a fragment thereof in preventing or treating an inflammatory disease, wherein the inflammatory disease, prevention, treatment, anti-WARS1 antibody or a fragment thereof are as described above.

[0140] Another embodiment of the present invention provides a method for preventing or treating an inflammatory disease, comprising the step of administering the anti-WARS1 antibody or a fragment thereof to an individual. The inflammatory disease, prevention, treatment, anti-WARS1 antibody or a fragment thereof, and administration are as described above. The individual may be a mammal, preferably a human. Furthermore, the individual may be an individual suffering from an inflammatory disease or having a high probability of suffering from an inflammatory disease.

[0141] The administration route, dosage and frequency of the above-mentioned antibody or fragment thereof can be administered to an individual in a variety of methods and amounts according to the patient's condition and the presence or absence of side effects. The optimal administration method, dosage and frequency of administration can be selected from an appropriate range by ordinary technicians. The preferred dosage of the above-mentioned anti-WARS1 antibody or fragment thereof can be in the range of 0.01 μg / kg to 10 g / kg or 0.01 mg / kg to 1 g / kg per day according to the patient's condition, weight, sex, age, severity of the patient's disease, and administration route. Administration can be once or several times a day, or divided into once a month to once every two weeks. From any aspect, the above dosage should not be interpreted as limiting the scope of the present invention.

[0142] Furthermore, the above-mentioned antibody or fragment thereof may be administered in combination with any compound or natural extract known to have a therapeutic effect on inflammatory diseases, or may be formulated with other drugs into a combined preparation.

[0143] Embodiments of the present invention

[0144] The present invention will be described in more detail below by way of examples, but these examples are merely for the purpose of illustrating one or more specific examples, and the scope of the present invention is not limited to these examples.

[0145] Example 1. Preparation of GKB101

[0146] In order to produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 53) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 18) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were cloned into pOptiVEC (Thermo Fisher, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 ). In this case, the antibody information used is shown in Tables 2 and 3 below.

[0147] The vector was introduced into Expi293 cells using Expifectamine 293 reagent (Thermo Fisher) at a ratio of 1:1 to simultaneously express the heavy chain and light chain in the same cell. After the vector was introduced, the cells were shaken and cultured for about 5 days, and then the cell culture fluid was centrifuged and the supernatant was recovered to separate and purify the antibody.

[0148] Specifically, the recovered supernatant was loaded onto a Hitrap Mabselect Sure column (GE Healthcare Life Sciences), and then washed with PBS to remove non-specific binding. Proteins specifically bound to the column were separated using 100 mM citrate buffer (pH 3.0) + 300 mM sodium chloride (NaCl). The eluate obtained by fast protein liquid chromatography (FPLC) was loaded onto a size exclusion chromatograph (GE Healthcare Life Sciences) to obtain a highly pure antibody. The above-mentioned purified anti-WARS1 antibody was named "GKB101" (Table 1, Figure 3a and Figure 3b ).

[0149] Table 1

[0150]

[0151]

[0152] Example 2. Preparation of GKB101 variants

[0153] In order to prepare antibodies that specifically bind to WARS1, various variants were prepared by changing the sequence of CDR2 and / or CDR3 of the light chain variable region based on GKB101 in Example 1. In this case, the antibody information used is shown in Tables 2 and 3.

[0154] The light chain variants of GKB101 were amplified by PCR. The base sequences of primers used to amplify the gene containing the mutation sites of CDR2 and CDR3 of the light chain variable region are shown in Table 4.

[0155] The L-CDR2 and L-CDR3 variants containing each mutation were then amplified using a vector template (pcDNA3.3-GKB101) and the above primers (10 pmol each) under the conditions of 98°C / 1 min, 98°C / 10 sec, 55°C / 15 sec, 72°C / 5 min, 28 cycles, and 72°C / 5 min to perform PCR to amplify the gene containing the mutation site, and then 0.5 μl of DpnI restriction enzyme was added to the PCR product and the enzyme reaction was performed at 37°C for 30 minutes. After the enzyme reaction, the purified PCR product was mixed with NEBuilder reaction mixture (Master mix) (NEB, Cat#E2621) and reacted at 50°C for 60 minutes, and then transformed into DH5α competent cells to screen positive clones.

[0156] Table 2

[0157]

[0158]

[0159]

[0160]

[0161] Table 3

[0162]

[0163] Table 4

[0164]

[0165]

[0166] In this case, the nucleic acid sequence encoding ANSHRPS is GCTAATAGTCATCGGCCAAGC (SEQ ID NO: 70), and the nucleic acid sequence encoding GAWDDSLSAYV is GGTGCTTGGGATGATAGCCTGAGTGCTTATGTC (SEQ ID NO: 71).

[0167] Example 2.1. Preparation of S53I

[0168] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 54) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 21) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0169] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "S53I" (Table 5, Figure 3a and Figure 3b ).

[0170] Table 5

[0171]

[0172]

[0173] Example 2.2. Preparation of S53L

[0174] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 55) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 23) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0175] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "S53L" (Table 6, Figure 3a and Figure 3b ).

[0176] Table 6

[0177]

[0178]

[0179] Example 2.3. Preparation of S53T

[0180] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 56) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 25) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0181] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "S53T" (Table 7, Figure 3a and Figure 3b ).

[0182] Table 7

[0183]

[0184] Example 2.4. Preparation of S53V

[0185] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 57) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 27) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0186] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "S53V" (Table 8, Figure 3a and Figure 3b ).

[0187] Table 8

[0188]

[0189]

[0190] Example 2.5. Preparation of S53Q

[0191] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 58) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 29) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0192] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "S53Q" (Table 9, Figure 3a and Figure 3b ).

[0193] Table 9

[0194]

[0195]

[0196] Example 2.6. Preparation of H54I

[0197] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 59) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 31) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0198] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "S53I" (Table 10, Figure 3a and Figure 3b ).

[0199] Table 10

[0200]

[0201] Example 2.7. Preparation of H54L

[0202] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 60) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 33) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0203] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "H54L" (Table 11, Figure 3a and Figure 3b ).

[0204] Table 11

[0205]

[0206]

[0207] Example 2.8. Preparation of H54K

[0208] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 61) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 35) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0209] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "H54K" (Table 12, Figure 3a and Figure 3b ).

[0210] Table 12

[0211]

[0212]

[0213] Example 2.9. Preparation of H54Q

[0214] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 62) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 37) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0215] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "H54Q" (Table 13, Figure 3a and Figure 3b ).

[0216] Table 13

[0217]

[0218] Example 2.10. Preparation of H54F

[0219] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 63) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 39) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0220] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "H54F" (Table 14, Figure 3a and Figure 3b ).

[0221] Table 14

[0222]

[0223]

[0224] Example 2.11. Preparation of SH / IL

[0225] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 64) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 41) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0226] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "SH / IL" (Table 15, Figure 3a and Figure 3b ).

[0227] Table 15

[0228]

[0229]

[0230] Example 2.12. Preparation of SH / LL

[0231] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 65) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 43) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0232] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "SH / LL" (Table 16, Figure 3a and Figure 3b ).

[0233] Table 16

[0234]

[0235]

[0236] Example 2.13. Preparation of SH / QL

[0237] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 66) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 45) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0238] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "SH / QL" (Table 17, Figure 3a and Figure 3b ).

[0239] Table 17

[0240]

[0241]

[0242] Example 2.14. Preparation of SHL / ILN

[0243] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 67) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 47) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0244] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "SHL / ILN" (Table 18, Figure 3a and Figure 3b ).

[0245] Table 18

[0246]

[0247]

[0248] Example 2.15. Preparation of SHL / LLN

[0249] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 68) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 48) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0250] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "SHL / LLN" (Table 19, Figure 3a and Figure 3b ).

[0251] Table 19

[0252]

[0253]

[0254] Example 2.16. Preparation of SHL / QLN

[0255] To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of an anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 69) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 49) and a constant region (SEQ ID NO: 19) of an anti-WARS1 antibody light chain were loaded into pOptiVEC (Thermo Fisher Scientific, Inc., Figure 1 ) and pcDNA 3.3 vector (Thermo Fisher Scientific, Figure 2 )middle.

[0256] The above vector was introduced into Expi293 cells in the same manner as in Example 1 to isolate and purify the antibody, which was named "SHL / QLN" (Table 20, Figure 3a and Figure 3b ).

[0257] Table 20

[0258]

[0259]

[0260] Example 3. Confirmation of the binding ability of anti-WARS1 antibodies to WARS1

[0261] Example 3.1. Confirmation of the binding ability of anti-WARS1 antibodies to WARS1 in vitro

[0262] The ability of the anti-WARS1 antibody of the present invention prepared in the same manner as in Examples 1 and 2 to bind to the WARS1 protein was confirmed by direct ELISA and sandwich ELISA.

[0263] Specifically, for direct ELISA, WARS1 recombinant protein derived from humans, marmosets (NHP), mice, rats, and pigs at a concentration of 1 μg / ml was coated on a 96-well culture plate (Maxisorp, Thermo Fisher Scientific), and then blocked with PBS containing 1% bovine serum albumin (BSA) at room temperature for 1 hour. GKB101 antibody or its variant antibody was diluted concentration-dependently and added to each coated well, reacted at room temperature for 1 hour, and then washed 4 times with PBST (PBS+Tween20). After treating each well with an antibody conjugated to HRP (anti-human IgG, cell signaling company) and reacting for 1 hour, it was washed with PBST. Finally, the absorbance was measured at a wavelength of 490 nm after color development using TMB substrate (BD company) (NIVO) ( Figures 4a to 5 ).

[0264] The sandwich ELISA is to coat the GKB101 antibody or its variant antibody at a concentration of 1 μg / ml on a 96-well culture plate (Maxisorp, Thermo Fisher Scientific), and then block with PBS containing 1% bovine serum albumin at room temperature for 1 hour. After the WARS1 recombinant protein of human, marmoset (NHP), mouse, rat or pig is diluted concentration-dependently and added to each well coated with the antibody, react at room temperature for 1 hour, and then wash 4 times with PBST (PBS+Tween20). The anti-his tag antibody (Santa Cruz) is reacted in each well for 1 hour. After washing 4 times with PBST (PBS+Tween20), the antibody conjugated with HRP (anti-mouse IgG, Santa Cruz) is reacted for 1 hour, and the absorbance is measured at a wavelength of 490 nm after color development with TMB substrate (BD) (NIVO) ( Figures 6a to 6c ).

[0265] As a result, in the measurement and comparison of the binding ability of anti-WARS1 antibodies to recombinant WARS1 proteins of GKB101 antibodies and their variant antibodies, it was confirmed that the WARS1 recombinant proteins derived from humans, marmosets (NHP), mice, rats, and pigs all had strong binding abilities equal to or stronger than that of the GKB101 antibody.

[0266] Furthermore, for human recombinant proteins, the K values ​​of S53Q, H54K, SH / QL, SHL / ILN, SHL / LLN and SHL / QLN antibodies were d Value is about 10 -12 M, K of SHL / ILN, SHL / LLN and SHL / QLN antibodies in recombinant proteins from marmoset (NHP) d Value is about 10 -12 M level.

[0267] Furthermore, for mouse-derived recombinant proteins, the K values ​​of S53V, S53Q, H54K, H54Q, SH / QL, SHL / ILN, SHL / LLN, and SHL / QLN antibodies were d Value is about 10 -12 M. In addition, for rat-derived recombinant proteins, the K values ​​of S53V, S53Q, H54L, H54K, H54Q, SH / QL, SHL / ILN, SHL / LLN and SHL / QLN antibodies were d Value is about 10 -12 M. In addition, for the porcine recombinant protein, the K values ​​of S53L, S53V, S53Q, H54K and H54Q antibodies were d Value is about 10 -9 M. As a result, for the WARS1 recombinant protein, S53V, S53Q, H54L, H54K, H54Q, SH / QL, SHL / ILN, SHL / LLN and SHL / QLN antibodies showed K d Value is about 10 -12 M level high bonding strength.

[0268] Example 3.2. Confirmation of the binding ability of anti-WARS1 antibody to WARS1 by Western blotting

[0269] The ability of the anti-WARS1 antibody of the present invention prepared by the same method as in Example 1 and Example 2 to bind to the WARS1 protein was confirmed by Western blotting.

[0270] In this case, the WARS1 protein sample uses WARS1 recombinant protein (human, mouse, pig, marmoset (NHP) or rat origin), cell culture fluid and human or mouse serum. In particular, the cell culture fluid is obtained by treating human monocyte cell line THP-1 or mouse macrophage cell line J774.1A with lipopolysaccharide (LPS, 100ng / ml) for 24 hours to induce an inflammatory response, and then obtaining the cell culture supernatant for use.

[0271] 30 μg of WARS1 recombinant protein (human, mouse, pig, marmoset (NHP) or rat), cell supernatant obtained by the above method and mouse or human serum were loaded onto 8% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) and transferred to PVDF membrane (Millipore). Then, the membrane was reacted with 1 μg / ml GKB101 or its variant antibody for 1 hour, and then washed three times with TBST (TBS+Tween20). Then, after reacting with secondary antibody (anti-human IgG HRP, Millipore) for 1 hour, it was washed three times with TBST and treated with ECL ( Bright ECL, Advanta) was used to confirm protein expression (LAS-4000, Fujifilm).

[0272] Results, such as Figure 7 As shown, the GKB101 antibody and its variant antibodies of the present invention can specifically detect all recombinant proteins, culture supernatants of THP-1 cells or J774A.1 cells, and WARS1 in human or mouse serum. In particular, S53I, S53L, S53V, S53Q, H54I, H54K, H54Q, H54F, and SH / LL antibodies can detect recombinant proteins of pig origin at levels equal to or higher than those of the GKB101 antibody.

[0273] Example 4. Epitope mapping

[0274] Peptides corresponding to the WHEP domain sequence of the human WARS1 protein and alanine-mutated human WARS1 protein were prepared, and the ability of the anti-WARS1 antibody to bind to them was confirmed by ELISA.

[0275] Specifically, in order to map the epitope using the peptide, an anti-WARS1 antibody at a concentration of 1 μg / ml was coated on a 96-well culture plate (Maxisorp, Thermo Fisher Scientific), and then blocked with PBS containing 1% bovine serum albumin at room temperature for 1 hour. Each biotin-labeled peptide was diluted concentration-dependently and added to each coated well to react at room temperature for 1 hour, and then washed 4 times with PBST (PBS+Tween20). After treating each well with HRP-conjugated streptavidin (R&D systems) and reacting for 1 hour, it was washed with PBST. Finally, the absorbance was measured at a wavelength of 490 nm after color development using TMB substrate (BD) (NIVO) ( Figure 8 ).

[0276] The results showed that among the GKB101 antibody and its variant antibodies, S53L, H54K, SH / IL, SH / LL, SHL / ILN, and SHL / LLN showed strong binding forces in all five peptides. Among them, H54K, SH / QL, SHL / ILN, and SHL / QLN showed equal or better binding forces to the WHEP domain sequence peptide of human WARS1 compared to GKB101.

[0277] In order to map the epitope of human recombinant WARS1 protein in which alanine was substituted for a specific amino acid in the WHEP domain, an anti-WARS1 antibody at a concentration of 1 μg / ml was coated on a 96-well culture plate (Maxisorp, Thermo Fisher Scientific), and then blocked with PBS containing 1% bovine serum albumin at room temperature for 1 hour. Each WARS1 protein was diluted to 50 ng / ml and added to each coated well. After reacting at room temperature for 1 hour, it was washed 4 times with PBST (PBS+Tween20). An anti-his tag antibody (Santa Cruz) was reacted in each well for 1 hour. After washing 4 times with PBST (PBS+Tween20), an antibody conjugated to HRP (anti-mouse IgG, Santa Cruz) was used for reaction for 1 hour, and then the absorbance was measured at a wavelength of 490 nm after color development with TMB substrate (BD) (NIVO) ( Figures 9a to 9c ).

[0278] The results showed that the epitopes of GKB101, S53I, S53Q, S53I, H54K, and H54Q antibodies were all located at the R20, R24, K27, I36, I43, and K47 sites for the human WARS1 WHEP domain.

[0279] Example 5. Confirmation of the specific neutralization ability of anti-WARS1 antibodies against WARS1 in vitro

[0280] The neutralizing ability of the anti-WARS1 antibody of the present invention prepared by the same method as in Example 1 and Example 2 against WARS1 was confirmed in vitro.

[0281] Specifically, with 4×10 4 Amount of cells / well Mouse macrophage cell line J774A.1 cells were inoculated into a 96-well cell culture plate (Nunc) and cultured for 24 hours. In this case, the cells were cultured using high glucose DMEM (Gibco) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. For the antigen-antibody mixture, the human-derived WARS1 recombinant protein (5 μg) and the anti-WARS1 antibody of the present invention (5 μg) were mixed and reacted in an incubator at 37°C for 2 hours to prepare the antigen-antibody mixture.

[0282] Two hours before treating the cells with the antigen-antibody mixture, the cell culture medium was replaced with a new one, and the cells in each well were treated with the antigen-antibody mixture prepared in the above manner. After about 15 hours, the culture medium of each cell was centrifuged to recover the supernatant, and the concentration of TNF-α in the supernatant was measured (ELISA MAX TM Standard Set Mouse TNF-α (BioLegend). In this case, IgG was used as a control group relative to the anti-WARS1 antibody.

[0283] As a result, in mouse macrophages, 7 of the 17 anti-WARS1 antibodies of the present invention (GKB101, S53I, S53L, S53Q, H54K, SHL / LLN, and SHL / QLN antibodies) inhibited the secretion of TNF-α increased by WARS1 by more than 40%. In addition, compared with the GKB101 antibody, the S53I, S53L, S53Q, and SHL / LLN antibodies showed equal or higher WARS1 neutralization abilities ( Fig.10 ).

[0284] Example 6. Confirmation of the activity of anti-WARS1 antibodies in vivo

[0285] In order to confirm the activity of the anti-WARS1 antibody of the present invention at the in vivo level, mice were used in which severe sepsis was induced by injection of cecal slurry (CS).

[0286] Specifically, mice (C57BL / 6, DBL, Korea, 8 weeks old) were injected with 21 mg of cecal slurry, and IgG1, GKB101 antibody, S53I antibody, S53Q or S53K antibody were intraperitoneally administered at a concentration of 2.5 mg / kg, 5 mg / kg or 10 mg / kg 4, 8 and 12 hours later for a total of 3 times ( Fig.11 ). Then, the survival of the mice was observed for 72 hours.

[0287] The results of evaluating the efficacy of S53I, S53Q, and H54K using a severe sepsis mouse model confirmed that in the case of S53I, the survival rate did not show a concentration-dependent increase trend, while S53Q and H54K antibodies significantly increased the survival rate at concentrations of 2.5 mg / kg and 10 mg / kg.

[0288] Next, the inflammatory disease improving effect of the anti-WARS1 antibody of the Examples was confirmed using H54K, which is a variant of the anti-WARS1 antibody. Therefore, the following Examples describe the use of anti-WARS1 antibody, H54K, and M105A in combination.

[0289] II. Evaluating the efficacy of anti-WARS1 antibodies in inhibiting respiratory damage in a COPD mouse model

[0290] Example 7. Confirmation of anti-inflammatory activity of anti-WARS1 antibodies in chronic obstructive pulmonary disease-related cell lines

[0291] In order to confirm the therapeutic effect of anti-WARS1 antibody (H54K) on chronic obstructive pulmonary disease, the anti-inflammatory activity of anti-WARS1 antibody was confirmed using cells related to chronic obstructive pulmonary disease.

[0292] In this case, human lung fibroblast cell line (HLF, ATCC, PCS-201-013) was used as the cell and cultured in DMEM containing 10% FBS and 1% antibiotic / antimycotic.

[0293] Specifically, 2×10 4The above cell lines were inoculated in 96-well culture plates, respectively, and cultured in DMEM containing 0.1% FBS for 24 hours. In this case, WARS1 (10 μg / ml) and anti-WARS1 antibodies (3C6, GKB101, H54K, 5 μg / ml) or PBS were mixed and reacted at 37°C for 1 hour to prepare. The prepared cells were treated with the above WARS1 / anti-WARS1 antibody mixture and then cultured for 16 hours. After 16 hours, the culture medium was taken and the concentrations of IL-8 (Biolegend, 430515) and IL-6 (BioLegend, #431304) in the culture medium were measured by ELISA. In this case, WARS1 treated with PBS was used as a control group.

[0294] Results, such as Fig.14 As shown, in human lung fibroblasts, the secretion of IL-8 and IL-6 increased in the WARS1 alone treatment group (control group). In contrast, the secretion of IL-8 and IL-6 decreased in a concentration-dependent manner in the WARS1 and anti-WARS1 antibody treatment groups compared to the control group. In particular, the greatest decrease was confirmed in the H54K antibody treatment group.

[0295] Example 8. Preparation of Standard Cigarette Extract

[0296] 60 standard cigarettes CM7 (coresta monitoring cigarette 7) and isopropanol (Merck), ethanol (Merck), and n-heptadecane (Sigma-Aldrich) were prepared as experimental materials, and an automatic smoking machine (automatic smoking machine, ISO3308 standard product, model: RM20, Heinr Borgwaldt) was used as the experimental device.

[0297] Example 8.1. Capturing of Standard Cigarette Smoke

[0298] The capture of standard cigarette CM7 smoke condensate was carried out in a smoking room (temperature 22±2°C, relative humidity 60±5%) according to ISO3402. The cigarettes were burned using the following ISO standard smoking method using an RM20 automatic smoking device according to ISO3308: puff volume 35.0±0.ml, puff cycle 60±0.5 seconds, puff time 2.00±0.02 seconds, and butt length tip paper length + 3mm (overwrap + 3mm). A 92mm Cambridge filter (ISO3308 standard product) was used to capture cigarette smoke condensate.

[0299] Example 8.2. Measurement of cigarette smoke condensate weight

[0300] Before smoking, the weight of the cigarette holder equipped with the Cambridge filter before burning was measured according to the provisions of ISO4387, and the cigarette smoke condensate after burning was calculated by measuring the weight of the cigarette holder captured by the Cambridge filter after burning (ISO4387, 2000). When the standard cigarette was burned 3 times, the weight of TPM was 16.0621 mg in 19, 15.9135 mg in 20, and 15.5380 mg in 20. Therefore, the total number of standard cigarette samples was 59, and the weight of TPM was 47.5136 mg.

[0301] Example 8.3. Extraction of Standard Cigarette Smoke Condensate

[0302] The Cambridge filter discs that captured the cigarette smoke condensate by the method of Example 8.1 were separated from the cigarette holders, respectively, and placed in 100 ml conical bottles and mixed with 50 ml of isopropanol as an extraction solvent. The mixture was left at room temperature for more than 8 hours to extract the cigarette smoke condensate. After the extraction, the extract was filtered and concentrated using a vacuum filter concentrator. The concentrates loaded in the three conical bottles were gathered in a scintillation vial and completely concentrated using nitrogen.

[0303] The total particulate matter (TPM) content in the cigarette smoke condensate concentrated by the above method was calculated using the following mathematical formula 1.

[0304] Mathematical formula 1

[0305] TPM (mg / cig) = (W FHA -W FBH ) / N

[0306] Wherein, TPM: total particulate matter; WFHA: weight of cigarette holder after smoking; WFHB: weight of cigarette holder before smoking; N: number of cigarettes smoked per trap (cig.).

[0307] Example 9. Using a mouse model of chronic obstructive pulmonary disease to test the effect of anti-WARS1 antibodies in inhibiting respiratory system damage

[0308] Example 9.1. Preparation of a COPD mouse model

[0309] Male 7-week-old SPF (specific pathogen-free) BALB / c mice (18 g to 20 g) were provided by Orientbio. Until the day of the experiment, the animals were supplied with solid feed (antibiotic-free, Samyang Feed Co., Ltd.) and water, and were used in the experiment after adapting to an environment with a temperature of 22±2°C, a humidity of 55±15%, and a 12-hour light-dark cycle for one week. In addition, in order to discuss the ethics and scientific rationality of animal experiments and to effectively manage them, the approval of the Institutional Animal Care and Use Committee (IACUC) of Daejeon University was obtained.

[0310] The LPS / CS mixture for establishing a mouse model of chronic obstructive pulmonary disease (COPD) was prepared by mixing 100 μg / ml of LPS and 4 mg of standard cigarette smoking extract (CSE) at a ratio of 1:1. After 7-week-old BALB / c male mice were temporarily anesthetized with ketamine and rumph, a total of 100 μl (50 μl each) of the LPS / CS mixture was inhaled into the nose and mouth of each mouse by intermittent (INT) injection once a week for 3 weeks to prepare a COPD mouse model.

[0311] In this case, the experimental group was divided into the following groups: i) untreated normal group (Normal), ii) PBS (control group, CON), iii) isotype IgG1 antibody (3 mg / kg, intraperitoneal injection (ip)) administration group and iv) anti-WARS1 antibody (H54K) administration group. In this case, each sample ( Fig.15 ) Hereinafter, the present invention will describe that the H54K antibody as the anti-WARS1 antibody can be used in combination with the M105A antibody.

[0312] After the experiment, blood, bronchoalveolar lavage fluid and lung tissue were isolated from mice to evaluate the respiratory system damage inhibitory effect of anti-WARS1 antibody (H54K). In this case, the result value of each experimental group is expressed as mean ± standard deviation (SEM), and the numerical data between experimental groups were tested by Duncan's multiple comparison tests after one-way analysis of variance (ANOVA).

[0313] Example 9.2. Pathological analysis of lung tissue

[0314] The respiratory tract and lung tissues obtained from the experimental mice of Example 9.1 were stained with H&E staining, Masson's trichrome staining (MT staining) or Periodic acid-Schiff (PAS)-Alcian Blue (AB) staining, and then analyzed by optical microscopy.

[0315] Example 9.2.1. Observation of inflammatory immune cell infiltration in respiratory tract and lung tissue by H&E staining

[0316] Specifically, respiratory tract and lung tissues removed after administration were reacted in 4% paraformaldehyde (PFA) for 1 day for fixation, and then paraffin tissue sections were prepared. The paraffin tissue sections were washed three times with xylene and 100% ethanol to remove the paraffin.

[0317] After the tissue sections from which the paraffin was removed by the above process were reacted in a hemaxoylin solution for 5 minutes, they were washed in running water and 1% hydrochloric acid in sequence. Then, the sections were washed with running water, 1% ammonia solution (diluted in 70% ethanol), washed again with running water, and reacted in an eosin solution for 2 minutes. After the reaction was completed, the sections were reacted in 70% to 100% ethanol solutions in sequence, and then reacted in a xylene solution for 3 minutes. In this case, the reaction process in the xylene solution was carried out 3 times in total. Finally, the tissue sections were sealed with a cover glass and the morphology of the tissue was observed using an optical microscope.

[0318] Results, such as Fig.16a As shown, infiltration of inflammatory immune cells was observed around the respiratory tract in the IgG1-administered group compared to the normal group. Destruction of alveolar cells due to deepening inflammation was also observed. In contrast, infiltration of inflammatory immune cells was reduced in the anti-WARS1 antibody (H54K)-administered group, and alveolar cells were preserved.

[0319] Example 9.2.2. Observation of collagen deposition in lung tissue by Masson's trichrome staining

[0320] Masson's trichrome staining was performed on lung tissue sections prepared in the same manner as in Example 9.2.1.

[0321] Specifically, the paraffin-removed sections were reacted in a 60°C Bouin's solution, then taken out and cooled, and then reacted in Weigert's hematoxylin solution, Briebrich Scarlet solution, phospho-tungstic phosphomolybdic acid, and aniline blue solution in sequence. Finally, after reacting in a 1% acetic acid solution, the lung tissue sections were sealed with a cover glass and the degree of collagen deposition in the tissue was confirmed using an optical microscope.

[0322] Results, such as Fig.16a As shown, in the IgG1-administered group, high levels of collagen deposition were observed around tracheole and alveolar cells. In contrast, in the anti-WARS1 antibody (H54K)-administered group, a decrease in the above-mentioned collagen deposition was observed.

[0323] Example 9.2.3. Observation of mucus secretion in respiratory tissue by periodic acid-Schiff-Alcian blue staining

[0324] Tissue sections prepared from respiratory tissues removed from the experimental mice of Example 9.1 in the same manner as in Example 9.2.1 were stained with Periodic Acid Schiff (Sigma-Aldrich, 395B) and periodic acid-Schiff-Alcian blue.

[0325] Specifically, the tissue sections from which the paraffin was removed were reacted in Alcian blue solution, 0.5% periodic acid solution and Schiff's solution. After reacting with each solution, the sections were washed with running water. The sections stained by the above process were reacted in a hematoxylin solution and then washed with water, and then dehydrated by reacting in an ethanol solution with a concentration of 70% to 100%. Finally, the tissue sections were sealed with a cover glass and observed using an optical microscope.

[0326] Results, such as Fig.16b As shown, a decrease in the amount of mucus in goblet cells around the respiratory tract was observed in the anti-WARS1 antibody (H54K) administration group compared to the IgG1 administration group.

[0327] Example 9.3. Analysis of inflammatory cytokine concentrations in respiratory tract, alveolar lavage fluid, lung tissue and serum

[0328] The concentrations of inflammatory cytokines and chemokines were measured in lung tissues obtained from the experimental mice of Example 9.1.

[0329] In this case, each sample was collected in the following manner.

[0330] First, 1 ml of PBS was used to wash the bronchi and lung tissues through the mouse tracheal cannula to collect bronchoalveolar lavage fluid, which was used as bronchoalveolar lavage (BAL) fluid (BALF).

[0331] In addition, a portion of the lung tissue was removed, and a protein lysis buffer was added to a concentration of 100 μg / ml to lyse the tissue. The lysate was centrifuged at 13,000 rpm, and only the supernatant was taken as a lung tissue sample.

[0332] Blood was obtained by cardiac bleeding, transferred to a heparin tube, and centrifuged at 2000 rpm for 20 minutes at room temperature to obtain a serum sample.

[0333] Regarding mCXCL2 / MIP-2, mIL-6, and mmIP1α, for each sample obtained through the above process, the concentration of each cytokine or chemokine was measured using mouse CXCL2 / MIP-2 ELISA (R&D systems), mouse IL-6 ELISA (BioLegend), and mouse MIP1-α ELISA (R&D systems) kits.

[0334] Results, such as Fig.17a (Bronchoalveolar lavage fluid) and Fig.17b As shown in (lung tissue), CXCL1 and CXCL2, IL-6, TNFα and TARC increased in the isotype IgG1-administered group or the PBS-administered group compared with the normal group. In contrast, a decrease of about 1 / 4 to about 1 / 2 was observed in the anti-WARS1 antibody (H54K)-administered group compared with the isotype IgG1-administered group or the PBS-administered group. All data were marked with standard deviation (SEM) and analyzed using ANOVA statistical software.

[0335] In addition, in order to confirm gene expression, a part of lung tissue was removed and Trizol (Invitrogen, 15596026) was added, and mRNA was extracted according to the manufacturer's instructions. Using the above mRNA as a template, cDNA was synthesized using cDNA EcoDry premix (Random Hexamers) kit (Takara, 639546), and the expression of each gene was confirmed by q-PCR using SYBR Green real-time PCR premix (real time PCR master mix) (Applied biosystems, 4309155). In this case, the primers used are shown in Table 21 below.

[0336] Table 21

[0337]

[0338] The results are as follows Fig.17c As shown, the expression of cough inducing genes (MUC5AC, TRPA1, TRPV1) and eotaxin, an eosinophil inflammatory gene, was confirmed to be increased in the PBS-administered group compared with the normal group. In contrast, the expression of the above genes was confirmed to be decreased in the anti-WARS1 antibody (H54K)-administered group compared with the PBS-administered group or the isotype IgG1-administered group.

[0339] The above results confirmed that anti-WARS1 antibody (H54K) can inhibit the expression of inflammatory cytokines, chemokines, cough-inducing genes, and eosinophil inflammatory genes in COPD model mice.

[0340] Example 9.4. Analysis of immune cells in the respiratory tract, alveolar lavage fluid, lung tissue and serum

[0341] The immune cells in the serum, bronchoalveolar lavage fluid and lung tissue obtained from the experimental mice in Example 9.1 were analyzed by flow cytometry.

[0342] In this case, alveolar lavage fluid was obtained in the same manner as in Example 9.3.

[0343] Lung tissue samples were prepared as follows. First, a portion of the lung tissue was mixed with a 1 mg / ml collagenase solution and pulverized using a GentleMacs C-tube, and then shake-cultured at 37°C for 30 minutes. The shake-cultured solution was passed through a 70 μm cell strainer to obtain single cells.

[0344] Immunofluorescence staining was performed on the lung tissue samples prepared as above and the cells obtained from the bronchoalveolar lavage fluid. In this case, the antibodies used were PE anti-CD3e antibody (553064, BD Pharmingen), FITC anti-CD8 antibody (553031, BD Pharmingen), PE anti-CD4 antibody (553047, BD Pharmingen), PE anti-Gr-1 antibody (553128, BD Pharmingen), FITC anti-CD69 antibody (55732, BD Pharmingen), FITC anti-CD11b antibody (553310, BD Pharmingen) and PE anti-B220 antibody (561878, BD Pharmingen). After treating each cell with the above antibodies, react at 4°C for 30 minutes. After the reaction, the cells were washed three or more times with FACS buffer (0.5% FBS, 0.02% sodium azide phosphate buffer solution (NaN3 in PBS)) and analyzed using a flow cytometer. The above analysis values ​​were calculated using the FlowJo program (FlowJo TM v7Software, BD Biosciences) were used to classify immune cells into CD3+, CD4+, CD8+, CD4+CD69+, CD8+CD69+, CD4+CD62L-CD44+high, Gr-1+SiglecF- (neutrophils), CD11b+Gr-1+ (granulocytes), Gr-1-SiglecF+ (eosinophils) and Gr-1+highSiglecF+ (eosinophils_high), and then the distribution (%) of each cell was analyzed.

[0345] Results, such as Fig.18a , Fig.18b and Fig. 20 As shown, the total number of infiltrating cells, lymphocytes (especially B lymphocytes, activated T lymphocytes), neutrophils, macrophages and granulocytes in the isotype IgG1 administration group or PBS administration group increased by about 3 to 100 times compared with the normal group. In contrast, the maximum reduction to about 1 / 2 level was observed in the anti-WARS1 antibody (H54K) administration group compared with the isotype IgG1 administration group or PBS administration group. All data were marked with standard deviation (SEM) and analyzed using ANOVA statistical software.

[0346] Example 9.5. Analysis of immune cells in mediastinal lymph nodes

[0347] The immune cells in the mediastinal lymph nodes obtained from the mouse experiment in Example 9.1 were analyzed in the same manner as in Example 9.4.

[0348] Mediastinal lymph node samples were obtained as follows: First, the chest was opened, and the mediastinal lymph nodes on both sides of the medial and lateral sides of the superior vena cava located near the thymus were removed using scissors and clamps, and then passed through a 70 μm cell strainer to obtain single cells.

[0349] The mediastinal lymph node cells prepared as described above were subjected to immunofluorescence staining using the same antibodies and methods as in Example 9.4. The flow cytometric analysis values ​​were analyzed using the FlowJo program (FlowJo TM v7 Software, BD Biosciences) were used to classify immune cells into CD3+, CD4+, CD8+, CD4+CD69+, CD8+CD69+ and CD11c+B220-, and the distribution (%) of each cell was analyzed.

[0350] Results, such as Fig.19 As shown, it can be confirmed that the total number of infiltrating cells in the isotype IgG1-administered group or the PBS-administered group increased compared with the normal group. In particular, CD4+T lymphocytes and CD8+T lymphocytes in the IgG1-administered group increased and activated more than 5 times. In contrast, the maximum reduction to about 1 / 2 level was observed in the anti-WARS1 antibody (H54K)-administered group compared with the isotype IgG1-administered group or the PBS-administered group. All data were marked with standard deviation (SEM) and analyzed using ANOVA statistical software.

[0351] Example 9.6. Analysis of immune cells in blood

[0352] The immune cells in the peripheral blood mononuclear cells (PBMC) obtained from the mouse experiment in Example 9.1 were analyzed in the same manner as in Example 9.4. In this case, after the chest was opened, blood was obtained from the ventricle using a heparin (20-30 μl) syringe, and the blood was mixed with ACK solution (Thermo Fisher Scientific, A1049201) to remove red blood cells to prepare the PBMC sample.

[0353] Immunofluorescence staining was performed on the immune cells in the PBMC prepared as described above. In this case, the antibodies used were PE anti-CD3e antibody (553064, BD Pharmingen), FITC anti-CD8 antibody (553031, BD Pharmingen), PE anti-CD4 antibody (553047, BD Pharmingen), PE anti-Gr-1 antibody (553128, BD Pharmingen), FITC anti-CD19 antibody (553785, BD Pharmingen) and PerCP Cy5 anti-SiglecF antibody (565526, BD Pharmingen). After treating each cell with the above antibodies, react in the dark at 4°C for 30 minutes. After the reaction, wash more than 3 times with FACS buffer (0.5% FBS, 0.02% sodium azide phosphate buffer solution), and analyze using a flow cytometer. The above analysis values ​​are calculated using the FlowJo program (FlowJo TM v7 Software, BD Biosciences) were used to classify immune cells into CD3+, CD19+, CD4+, CD8+, and Gr-1+SiglecF- (neutrophils), and the distribution (%) of each cell was analyzed.

[0354] Results, such as Fig. 20 As shown, the blood distribution of lymphocytes increased in the isotype IgG1-administered group or the PBS-administered group compared with the normal group. In contrast, a decrease of about 30% was observed in the anti-WARS1 antibody (H54K)-administered group compared with the PBS- or isotype IgG1-administered group. All data were expressed as standard deviation (SEM) and analyzed using ANOVA statistical software.

[0355] III. Examination of the effect of anti-WARS1 antibodies on improving inflammatory bowel disease

[0356] Example 10. Examination of the effect of improving intestinal permeability by anti-WARS1 antibody treatment in colorectal cancer cell lines

[0357] In order to confirm the therapeutic effect of anti-WARS1 antibody (H54K) on inflammatory bowel disease, the intestinal permeability improvement effect of anti-WARS1 antibody treatment was confirmed using intestinal epithelial cells.

[0358] In this case, human intestinal epithelial cell line (Caco-2, ATCC, HTB-37) was used as the cell. The cells were cultured in DMEM containing 10% FBS and 1% antibiotic / antimycotic.

[0359] Specifically, 3×10 5The above cell lines were inoculated into 6-well culture plates at 10 μg / well, respectively, and cultured in DMEM containing 0.1% FBS for 24 hours. In this case, WARS1 (10 μg / ml) and anti-WARS1 antibodies (3C6, GKB101, H54K, 5 μg / ml) or PBS were mixed and reacted at 37°C for 1 hour to prepare. The prepared cells were treated with the above WARS1 / anti-WARS1 antibody mixture and then cultured for 16 hours. After 16 hours, the culture medium was removed and fixed with 4% formaldehyde at room temperature for 5 minutes. The fixed cells were treated with 0.1% TritonX-100 and reacted for 5 minutes to increase cell permeability. After blocking with 2% BSA for 1 hour, anti-human ZO-1 (Invitrogen, 1A12) antibody was diluted 1:500 in 1% bovine serum albumin and treated with cells and reacted overnight at 4°C. Then, the secondary antibody conjugated with FITC (Jackson ImmunoResearch, 200-002-037) was diluted 1:1000 in 1% BSA and treated with cells and reacted at room temperature for 1 hour. DAPI (4',6-diamidino-2-phenylindole, Sigma-Aldrich, D8417) (1 μl) was used to stain the nuclei in the cells. The fluorescently stained cells were confirmed using a confocal microscope (LSM700confocal laser scanning microscope, Carl Zeiss). In addition, the images of the cells were analyzed using Zen 3.0 software (blue edition).

[0360] Results, such as Fig.37 As shown, it was confirmed that when intestinal epithelial cells (Caco-2 cells) were treated with WARS1, the expression of ZO-1 (tight junction) decreased, but was restored by anti-WARS1 antibody treatment. In particular, the greatest restoration effect was observed in the H54K antibody treatment group.

[0361] These results confirmed that intestinal permeability can be improved by anti-WARS1 antibodies in inflammatory bowel disease.

[0362] Example 11. Testing the inflammatory bowel disease-improving effect of anti-WARS1 antibodies using an inflammatory bowel disease mouse model

[0363] Example 11.1. Preparation of an Inflammatory Bowel Disease Mouse Model

[0364] The DSS mouse model (dextran sulfatesodium-induced colitis model) was used as a mouse model of inflammatory bowel disease. Female B57BL / 6 mice (Orientbio) aged 6-10 weeks were used and kept in a constant temperature and humidity SPF experimental animal room at 21-23°C and a relative humidity of 40-45%. In addition, the number of experimental animals housed in each cage was less than 4, and the cages were changed and feed was supplied 3 times a week.

[0365] After dextran sodium sulfate (DSS) (MP biomedical, reagent-grade, MW 36-50kDa, 160110) was dissolved in sterile water at a concentration of 2.5%, 100 ml of 2.5% DSS solution was supplied to each mouse cage in a manner of changing every two days. Clinical examinations were performed regularly to confirm the extent of inflammation until the end of the experiment. In this case, when the weight loss was more than 25% of the body weight at the beginning of the weight loss test, euthanasia was performed from an ethical perspective. The experiment ended when the clinical index of the control group reached the maximum value on the 7th to 8th day from the start of the experiment.

[0366] The experiment was divided into 4 experimental groups ( Fig.21 DSS was administered from day 0, and negative control substance (vehicle, saline), isotype IgG1 (5 mg / kg, Bio Xcell, BP0297) and anti-WARS1 antibody (GKB101, H54K, 5 mpk each) were intraperitoneally administered from day 1, day 3, and day 5, respectively. In this case, saline as a vehicle was orally administered.

[0367] From the start date to the end date of the experiment, the occurrence and degree of inflammation were observed once a day and scored 0-4 points, and the total was used as the disease activity index (DAI). In addition, body weight was measured once a day and scored 0-4 points for use in DAI measurement.

[0368] All data were expressed as mean ± SEM and analyzed using ANOVA statistical software.

[0369] Example 11.2. Evaluation of clinical indicators

[0370] Example 11.2.1. Evaluation of Clinical Activity Index

[0371] In order to confirm the improvement effect of anti-WARS1 antibody on inflammatory bowel disease in the DSS mouse model, the clinical activity index (DAI) was quantitatively evaluated based on the occurrence of inflammatory symptoms and body weight changes of the experimental mice in Example 11.1 ( Fig.22a ).

[0372] Results, such as Figure 22b As shown, the clinical activity index was significantly reduced in the anti-WARS1 antibody (GKB101, H54K)-administered group compared with the control group (saline), and a significant reduction was observed in the H54K-administered group (*p<0.05, ****p<0.0001).

[0373] The results of analyzing the AUC (area under the curve) of the clinical index also showed a state similar to the results during the administration of the clinical index.

[0374] The above results confirmed that anti-WARS1 antibodies, especially H54K, have an improving effect on inflammatory bowel disease.

[0375] Example 11.2.2. Assessment of body weight

[0376] Furthermore, when the body weight loss score, which is one of the items for evaluating DAI, was evaluated, although the weight loss compared to the normal group (con) was not significant, a statistically significant difference was observed in the anti-WARS1 antibody-administered group compared to the isotype IgG1-administered group.

[0377] Example 11.2.3. Assessment of Intestinal Bleeding

[0378] Rectal bleeding was assessed in the experimental mice of Example 11.1.

[0379] Results, such as Fig.23 As shown, it was confirmed that intestinal bleeding was significantly reduced in the anti-WARS1 antibody (GKB101, H54K) administration group compared with the control group (saline) (****p<0.0001). The results of analyzing the AUC of the intestinal bleeding score also showed a state similar to the results during the administration period.

[0380] Example 11.2.4. Assessment of the Uniformity Score of Stools

[0381] The stool consistency score was assessed in the experimental mice of Example 11.1.

[0382] Results, such as Fig.24As shown, compared with the control group (saline), the fecal inertia fraction in the anti-WARS1 antibody (GKB101, H54K) administration group was reduced, and in particular, it was significantly reduced in the H54K administration group (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). The results of analyzing the fecal inertia fraction AUC showed a state similar to the results during the administration period.

[0383] Example 11.2.5. Measuring intestinal length

[0384] The colon tissue was removed from the experimental mice of Example 11.1 and the intestinal length was measured.

[0385] Results, such as Fig.25 As shown, the length of the large intestine was reduced in the control group (saline). In contrast, it was confirmed that the damage to the large intestine was significantly reduced in the anti-WARS1 antibody (GKB101, H54K)-administered group compared to the control group, and was particularly significantly reduced in the H54K-administered group (*p<0.05).

[0386] Example 11.2.5. Measuring spleen weight

[0387] The spleen was removed from the experimental mice of Example 11.1, and the weight of the spleen was measured.

[0388] Results, such as Fig.26 As shown, the spleen weight increased in the control group (PBS) compared with the untreated group. In contrast, it was confirmed that the spleen weight decreased significantly in the anti-WARS1 antibody (H54K)-administered group (**p<0.01).

[0389] Example 11.3. Confirmation of immune factor expression in intestinal tissue

[0390] Intestinal tissues were removed from the experimental mice in Example 11.1 according to the site, and proteins and mRNA were isolated, and the expression of immune factors in each sample was confirmed.

[0391] Protein samples were prepared as follows.

[0392] First, the entire intestine or the distal part is removed, and a protein lysis buffer is added to lyse the tissue. The lysate is centrifuged at 13,000 rpm, and only the supernatant is obtained and quantified to be used as an intestinal tissue sample.

[0393] The proteins isolated as described above were used to measure the concentrations of IL-1β (R&D systems, DY401), TNF-α (BioLegend, 430915), MCP-1 (R&D systems, DY479), IFN-γ (R&D systems, DY485), CXCL2 / MIP2 (R&D systems, DY425), IL-6 (BioLegend, 431315), IL-17A (R&D systems, DY421) and MIP1α (R&D systems, DY450).

[0394] Furthermore, the expression of WARS1 was measured as follows.

[0395] After coating the WARS1 monoclonal antibody at a concentration of 1 μg / ml in a 96-well culture plate (Maxisorp, Thermo Fisher Scientific), the plates were blocked with PBS containing 1% BSA at room temperature for 1 hour. Samples or recombinant WARS1 were added to the coated wells and reacted at room temperature for 1 hour, followed by washing with PBST (PBS+Tween20) 4 times. WARS1 antibody (MirimGENE Co., Ltd) was added to each well and reacted at room temperature for 1 hour, followed by washing with PBST 4 times. After reacting with a secondary antibody conjugated to HRP (anti-rat IgG, antibody conjugated to HRP) for 1 hour, the plates were washed with PBST, and then developed with TMB substrate (BD) and the OD value was measured at a wavelength of 490 nm (VersaMax microplate reader).

[0396] mRNA was extracted as follows: Trizol (Invitrogen, 15596026) was added to the same intestinal site as the protein sample, and RNA was extracted using the RNeasy RNA isolation kit (QIAGEN) according to the manufacturer's instructions. The cDNA was synthesized using the cDNA EcoDry premix (random hexamer) kit (Bao Riyi, 639546) using the above RNA as a template, and the expression of immune factors was confirmed by q-PCR. In this case, the primers used are shown in Table 22.

[0397] Table 22

[0398]

[0399]

[0400] Results, such as Fig. 27As shown, it was confirmed that the protein expressions of WARS1, TNF-α, IL-6, MIP1α, and MCP-1 were significantly reduced in the anti-WARS1 antibody (GKB101, H54K) administration group compared to the control group (saline). In particular, a greater reduction was observed in the H54K antibody administration group. In addition, it was confirmed that the mRNA expressions of immune factors such as TNF-α, IFN-γ, MCP-1, IL-6, and iNOS were also significantly reduced in the anti-WARS1 antibody administration group compared to the control group, and the reduction was the greatest in the H54K antibody administration group ( Fig.28 ). In this case, it was confirmed that WARS1 expression in intestinal tissue was also significantly reduced.

[0401] The above results confirmed that anti-WARS1 antibodies (GKB101, H54K) can inhibit the expression of inflammatory immune factors in intestinal tissue in the inflammatory bowel disease model, and in particular, it was confirmed that the inhibitory activity of the H54K variant antibody was superior to that of the GKB101 antibody.

[0402] Example 11.4. Morphological evaluation of intestinal tissue

[0403] Intestinal tissues were removed from the experimental mice of Example 11.1 and H&E staining was performed in the same manner as in Example 9.2.1 to observe the morphology of the intestinal tissues.

[0404] Results, such as Fig.29 As shown, it was confirmed that the damage of intestinal tissue and the infiltration of immune cells were reduced in the anti-WARS1 antibody-administered group compared with the control group (saline). In particular, the above effects were more excellent in the H54K antibody-administered group than in the GKB101 antibody-administered group.

[0405] IV. Examination of the effect of anti-WARS1 antibodies on improving rheumatoid arthritis

[0406] Example 12. Confirmation of anti-inflammatory activity of anti-WARS1 antibodies in rheumatoid arthritis-related cell lines

[0407] In order to confirm the therapeutic effect of anti-WARS1 antibody (H54K) on rheumatoid arthritis, the anti-inflammatory activity of anti-WARS1 antibody was confirmed using cells associated with rheumatoid arthritis.

[0408] In this case, osteoclasts differentiated from human synoviocyte-like fibroblast cell line (FLS, fibroblast like synoviocyte cell line, cell applications, 408K-05a), J774A.1 cells which are mouse macrophage cell line, and RAW264.7 cells which are mouse macrophage cell line were used as cells.

[0409] Specifically, 2×10 4 Cells / well The above cell lines were seeded into 96-well culture plates, respectively, and cultured in DMEM containing 0.1% FBS for 24 hours. In this case, WARS1 (10 μg / ml) and anti-WARS1 antibody (H54K, 10 μg / ml) were mixed and reacted at 37°C for 1 hour. The prepared cells were treated with the above WARS1 / anti-WARS1 antibody mixture and then cultured for 16 hours. After 16 hours, the culture medium was taken and the concentrations of CXCL2 (R&D systems, DY452), MMP3 (R&D systems, DY548), IL-6 (BioLegend, #431304) and TNF-α (BioLegend, #430904) in the culture medium were measured by ELISA. In the case of the J774A.1 cell experiment, IgG was administered as a control group for the anti-WARS1 antibody. RAW264.7 cells were cultured in 10% FBS / DMEM medium containing 50 ng / ml of recombinant mouse RANKL (Peprotech, 315-11) for 5 days to induce differentiation into osteoclasts. Then, only osteoclasts were collected, and the ability of anti-WARS1 antibodies to inhibit osteoclast activity was confirmed under the same conditions as the neutralization method of WARS1 (10 μg / ml) and anti-WARS1 antibodies (H54K, 10 μg / ml, 12.5 μg / ml, 25 μg / ml) described above.

[0410] Results, such as Fig.30 As shown, it was confirmed that the inflammatory response caused by cell activity in J774A.1 cells, FLS cells, and RAW264.7 cell-derived osteoclasts was reduced by treatment with the anti-WARS1 antibody (H54K).

[0411] Example 13. Testing the rheumatoid arthritis improvement effect of anti-WARS1 antibodies using a rheumatoid arthritis mouse model

[0412] Example 13.1. Preparation of rheumatoid arthritis mouse model

[0413] The improving effect of anti-WARS1 antibody (H54K) on inflammatory arthritis was confirmed using the CIA (Collagen-Induced Arthritis) mouse model, which is a rheumatoid arthritis model.

[0414] Mice were 7-week-old male DBA / 1J mice, which were kept in an SPF experimental animal room with a constant temperature and humidity of 21-23°C and a relative humidity of 40%-45% (IACUC No. 2021-0133).

[0415] In addition, the number of experimental animals housed in each cage was less than 6, and the cages were changed and feed was supplied twice a week. First, in order to prepare a CIA mouse model, after dissolving collagen type II at a concentration of 2 mg / ml in 10 mm acetic acid, it was mixed with CFA (Complete Freund's adjuvant, 2 mg / ml) at a ratio of 1:1 (v / v) to prepare a stimulant for inducing arthritis. 100 μl of collagen prepared in the above method was injected intradermally into the tail of each 7-week-old mouse for primary immunization. 21 days after the primary immunization, IFA (Incomplete Freund's adjuvant) and collagen type II were mixed at a ratio of 1:1 (v / v) to emulsify, and then injected intradermally into the tail of each mouse for secondary immunization. The mice subjected to secondary immunization were randomly divided into groups for use as experimental groups. The experimental groups were divided into an isotype IgG1 administration group (5 mg / kg) and an anti-WARS1 antibody (H54K, 5 mg / kg) administration group. Starting from the day of the secondary immunization (day 21), intraperitoneal administration was performed once every two days for 10 times.

[0416] Example 13.2. Assessment of clinical indices of arthritis

[0417] In the experimental mice of Example 13.1, starting from the administration of the experimental substance, according to the clinical index standard ( Fig.32a ) To assess the occurrence and severity of arthritis in the feet.

[0418] Results, such as Figure 32b As shown, it can be confirmed that the severity of arthritis in the anti-WARS1 antibody (KB101, H54K) administration group was reduced compared with the isotype IgG1 administration group, and in particular, it was significantly reduced in the H54K antibody administration group (IgG1 administration group vs anti-WARS1 antibody administration group (H54K), 7.85±0.319 vs 4.59±0.182, *p<0.05). The results of analyzing the AUC of the clinical arthritis index (CAI) also showed a state similar to the results during the administration period.

[0419] It was confirmed that the incidence of arthritis in the anti-WARS1 antibody (GKB101, H54K) administration group was also reduced compared with the isotype IgG1 administration group, especially in the H54K antibody administration group (isotype IgG1 vs anti-WARS1 antibody (H54K), 46.42±7.945 vs 12.5±3.689, **p<0.01). The AUC analysis results of the incidence of arthritis also confirmed that it was significantly reduced in the anti-WARS1 antibody (H54K) administration group compared with the isotype IgG1 administration group (isotype IgG1 vs anti-WARS1 antibody (H54K), 99.99±9.817 vs 35±3.931, *p<0.05).

[0420] The above results confirmed that anti-WARS1 antibodies have a therapeutic effect in the rheumatoid arthritis model, and in particular, the effect of H54K antibody is superior to that of GKB101 antibody.

[0421] Example 13.3. Analysis of inflammatory factors and osteoclast concentrations in serum and foot joints

[0422] The serum and foot joints were obtained from the experimental mice in Example 13.1, and the concentrations of inflammatory cytokines and chemokines were measured.

[0423] Specifically, skin tissue was removed from the joint tissue of mice, and protein lysis buffer was added to lyse the tissue to obtain protein in the foot joint. The lysate was centrifuged at 13,000 rpm to obtain a supernatant, which was quantified and used as tissue protein.

[0424] The above proteins were used to measure serum and foot joint WARS1, inflammatory cytokines and chemokines by ELISA using mouse CXCL2 / MIP-2 ELISA kit (R&D systems), mouse IL-6 ELISA kit (BioLegend), mouse MIP1-α ELISA kit (R&D systems), MMP3 (R&D systems, DY548), IL-6 (BioLegend, #431304), TNF-α (BioLegend, #430904), IL-17A, IL-17F, mmP9, RANKL and IL-1β kits according to the manufacturer's method.

[0425] Results, such as Figures 33a to 33dAs shown in the figure, it was observed that the concentrations of WARS1, IL-17A, IL-17F, TNF-α, IL-6, MIP1α, CXCL2 / MIP2 (IL-8 homologue), IL-1β, and MMP3 in the anti-WARS1 antibody (H54K) administration group were significantly reduced compared with the isotype IgG1 administration group ( Figures 33a to 33d ). In this case, all data were expressed as standard error (SEM) and analyzed using ANOVA statistical software.

[0426] The above results confirmed that anti-WARS1 antibodies (GKB101, H54K) inhibited not only the expression of inflammatory cytokines and chemokines but also the expression of chondrocyte fragmentation factor / osteoclast differentiation factor in the rheumatoid arthritis model.

[0427] V. Examination of the dermatitis-improving effect of anti-WARS1 antibodies

[0428] Example 14. Confirmation of anti-inflammatory activity of anti-WARS1 antibodies in human skin cell lines

[0429] To confirm the targeting mechanism of anti-WARS1 antibody (H54K) in atopic dermatitis related to anti-inflammatory activity, cell migration and proliferation inhibition, human dermal fibroblasts (adult) (HDFa, ATCC, PCS-201-012) and human keratinocytes (HaCat) were used. The cells were cultured in DMEM containing 10% FBS and 1% antibiotics / antimycotics.

[0430] Specifically, to confirm the anti-inflammatory activity, 2 × 10 4 Cells / well HDFa and HaCat cells were seeded into 96-well culture plates and cultured in DMEM containing 0.1% FBS. In order to secrete WARS1, Staphylococcus aureus (antibiotic resistance strain bank, CCARM2307) was treated with a multiplicity of infection (MOI) of 10 and then treated with PBS (vehicle) or 1.25μg / ml anti-WARS1 antibody (H54K). After additional culture for 16 hours, the culture medium of each cell was collected and the concentrations of IL-8 (BioLegend, #431504), MCD1 (R&D systems, DY336), TARC (R&D systems, DY364) and WARS1 in the culture medium were measured by ELISA. In this case, the concentration of WARS1 in the cell culture medium was measured in the same manner as in Example 11.3.

[0431] In order to confirm the inhibitory effect on cell migration and proliferation, 1×10 5 Cells / well HDFa and HaCat cells were seeded into a 24-well culture plate and cultured in DMEM containing 0.1% FBS for 24 hours. Then, the bottom of the well was scraped with a micro-tip to form a specified space without cells. Then, WARS1 (20μg / ml) and anti-WARS1 antibody (H54K, 20μg / ml) were mixed and reacted at 37°C for 1 hour. The above-mentioned mixture was treated to the corresponding wells and cultured for 16 hours. After 16 hours, each well was observed using an optical microscope and the migration and proliferation of cells were recorded by photographing.

[0432] Results, such as Figures 34a to 34c As shown, it was confirmed that the secretion of WARS1 in HDFa cells and HaCat cells increased with the treatment of Staphylococcus aureus, while the secretion of WARS1 and IL-8 decreased significantly with the treatment of anti-WARS1 antibody (H54K). In addition, it was confirmed that the migration and proliferation of the above cells also decreased with the treatment of anti-WARS1 antibody.

[0433] Example 15. Examination of the atopic dermatitis improving effect of anti-WARS1 antibody in an atopic mouse model

[0434] Example 15.1. Preparation of an atopic mouse model

[0435] Mice were 8-week-old female NC / Nga mice, which were kept in a SPF experimental animal room with a constant temperature and humidity of 21-23°C and a relative humidity of 40%-45%. The number of experimental animals per cage was less than 3, and the cages were changed and feed was supplied once a week.

[0436] First, in order to prepare an atopic mouse model, the back of the NC / Nga mouse was depilated to the upper part of the back one day before the start of the experiment, and the fat component of the skin area to be applied was removed using a 4% SDS aqueous solution. After complete drying for about 1 hour, 100 mg of Biostir AD (atopic dermatitis inducing agent, dust mite) ointment was evenly applied to the depilated area using a flat stick. Biostir AD ointment was applied at intervals of 3 times a week for 4 weeks (12 times in total). From the 14th day, 200 μg (200 μg / mouse) SpA (Staphylococcus protein A, Sigma Aldrich) was applied to the back of each mouse 3 times at intervals of 5 days. Anti-WARS1 antibody (H54K) (10 mg / kg) or isotype IgG1 (10 mg / kg) was intraperitoneally administered 3 times a week for a total of 6 times. In this case, isotype IgG1 was used as a control group and dexamethasone was used as a positive control group. Dexamethasone was intraperitoneally administered at a concentration of 10 mg / kg three times a week for a total of 6 times ( Fig.35 ).

[0437] Example 15.2. Evaluation of clinical indicators

[0438] In order to confirm the atopic dermatitis improvement effect of anti-WARS1 antibody (H54K), isotype IgG1, dexamethasone, or anti-WARS1 antibody (H54K) was administered to an atopic mouse model, and the manifestations of atopic dermatitis such as skin erythema / hemorrhage, wounds / dryness, edema, and shedding were observed and evaluated clinically.

[0439] Results, such as Fig.36 As shown, compared with the normal group (negative Compared with the group without dermatitis, the dermatitis scores of the four indicators in the group administered with isotype IgG1 increased significantly. In contrast, the dermatitis index of the group administered with anti-WARS1 antibody decreased significantly compared with the group administered with isotype IgG1.

[0440] VI. Examination of the effect of anti-WARS1 antibody on improving macrophage activation syndrome

[0441] Example 16. Confirmation of anti-inflammatory activity of anti-WARS1 antibody in macrophage activation syndrome model using CpG

[0442] Example 16.1. Preparation of Macrophage Activation Syndrome Model Using CpG

[0443] The CpG (CpG oligodeoxynucleotides (ODN)-induced macrophage activation syndrome model) mouse model was used as a macrophage activation syndrome mouse model. Female B57BL / 6J mice aged 8-10 weeks were used and kept in a SPF experimental animal room with a constant temperature and humidity of 21-23°C and a relative humidity of 40%-45%. In addition, the number of experimental animals housed in each cage was 5, and the cages were changed once a week and feed was supplied.

[0444] CpG ODN (InvivoGen, Class B, tlrl-1826) was diluted in PBS at a concentration of 45 μg / 200 μl and stored at -80°C. 200 μl was intraperitoneally administered to each mouse once every 2 days for a total of 5 times (0, 2, 4, 6, 8 days). One day after the last administration (9th day), blood was collected from the heart of the mouse under respiratory anesthesia, and the liver and spleen were collected to confirm the activity of inflammatory markers and cells. The status of the mouse was confirmed once a day until the end of the experiment.

[0445] The experimental group was divided into 6 groups. On each CpG administration day, PBS, isotype IgG (10 mg / kg, Bio X cell, BP0297), anti-WARS1 antibody ((H54K, 5 mg / kg, 10 mg / kg, 15 mg / kg) or GKB101 (10 mg / kg)) were intraperitoneally administered to the negative control group 2 hours after CpG administration according to the corresponding concentrations. All data are expressed as standard deviation (SEM) and multiple comparison analysis was performed using the ANOVA statistical method ( Fig.38 ).

[0446] Example 16.2. Analysis of WARS1 and inflammatory cytokine expression in liver tissue

[0447] A portion of the mouse liver tissue from Example 16.1 was taken and analyzed using gentleMACS TM Octo Dissociator (Miltenyi Biotec) and Trizol (Bao-Nichi Biotech, 9109, 1 ml) were used to lyse liver tissue. RNA was isolated from the lysed liver tissue and cDNA was synthesized in the same manner as in Example 11.3, and gene expression was confirmed by q-PCR using the primers in Tables 22 and 23.

[0448] Table 23

[0449]

[0450] Results, such as Fig.40b As shown, the expression of WARS1 and inflammatory cytokines and chemokines in the anti-WARS1 antibody (GKB101, H54K) administration group was reduced compared with the PBS administration group or the isotype IgG administration group. In particular, in the H54K antibody administration group, the expression of WARS1, inflammatory cytokines and chemokines decreased in a concentration-dependent manner. In order to confirm the effect of reducing WARS1 in liver tissue by anti-WARS1 antibodies (GKB101, H54K) in the CpG mouse model, a portion of the mouse liver tissue was collected and added with protein lysis buffer, and then the liver tissue was placed in an M tube (M tube) (Miltenyi Biotec, 130-093-236) and analyzed by gentleMACS. TM The cells were homogenized using an Octo Dissociator (Miltenyi Biotec). The subsequent steps were the same as in Example 11.3 for measuring WARS1.

[0451] Results, such as Fig.40a As shown, it was confirmed that the expression of WARS1 in the liver tissue of the anti-WARS1 antibody (GKB101, H54K) administration group was reduced compared with the PBS administration group or the isotype IgG1 administration group. In particular, the expression of WARS1 was reduced in a concentration-dependent manner in the H54K antibody administration group.

[0452] Example 16.3. Analysis of ferritin in blood

[0453] In order to confirm the effect of anti-WARS1 antibody (GKB101, H54K) on reducing plasma ferritin in the CpG mouse model, blood was obtained by cardiac bleeding of mice, transferred to heparin tubes and centrifuged at 2000 rpm for 20 minutes at room temperature to prepare plasma. Ferritin was measured using an ELISA kit (ferritin kit, Abcam, ab157713) according to the manufacturer's instructions.

[0454] Results, such as Fig.39 As shown, it was confirmed that the serum ferritin level was significantly reduced in the H54K antibody-administered group (15 mg / kg) compared with the PBS-administered group or the isotype IgG1-administered group.

[0455] Example 16.4. Analysis of immune cell distribution in the spleen

[0456] In order to confirm the changes in the distribution (%) of T cells and natural killer cells (NK cells) by anti-WARS1 antibodies in the CpG mouse model, the spleen of the mouse was removed and passed through a 70 μm cell filter to obtain single cells. The above cells were subjected to immunofluorescence staining. In this case, the antibodies used are shown in Table 24 below.

[0457] Table 24

[0458]

[0459] Each corresponding cell sample tube was treated with the above antibodies except the anti-mouse IFN-γ antibody and reacted for 20 minutes, and then washed with FACS buffer. The relevant test tube samples used to confirm the distribution of activated Th1 cells were fixed / permeabilized using fix / perm buffer (Invitrogen, 00-5523-00). After the above sample tubes were treated with PE anti-mouse IFN-γ antibody and reacted, they were washed with FACS buffer and then analyzed by flow cytometry. The above analysis values ​​were calculated using the FlowJo program (FlowJo TM v7 Software, BD Biosciences) classified each immune cell into CD45+CD11b+CD27-NK1.1+ (active NK cells) and CD45+CD3+CD8+IFNγ+ (active Th1 cells), and analyzed the distribution (%) of each cell. Fig.41a As shown, the distribution (%) of NK cells in the PBS-administered group and the isotype IgG1-administered group increased compared with the normal group. On the contrary, it was confirmed that the distribution of NK cells in the anti-WARS1 antibody (GKB101, H54K)-administered group decreased compared with the PBS-administered group and the isotype IgG1-administered group. In particular, the distribution (%) of NK cells in the H54K antibody-administered group decreased in a concentration-dependent manner.

[0460] Example 17. Analysis of immune cell infiltration in liver tissue

[0461] In order to confirm the effect of anti-WARS1 antibody (GKB101, H54K) on the infiltration of immune cells in liver tissue in the CpG mouse model, one lobe of mouse liver was removed and fixed in 10% formalin solution (Sigma, HT501128) for about one day. The fixed tissue was stained with H&E in the same manner as in Example 11.1 and then observed.

[0462] Results, such as Fig.41b As shown, it was confirmed that the infiltration of immune cells in the liver tissue of the anti-WARS1 antibody (H54K, GKB101) administration group was reduced compared with the PBS administration group and the isotype IgG1 administration group.

Claims

1. An anti-WARS1 antibody or a fragment thereof, characterized in that Include: a heavy chain variable region comprising an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 5, and an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 7; and a light chain variable region comprising an L-CDR1 comprising the amino acid sequence of sequence 12, an L-CDR2 comprising the amino acid sequence of sequence 95 below, and an L-CDR3 comprising the amino acid sequence of sequence 96 below, Sequence 95 is N-terminal-Ala Asn Xaa1 Xaa2 His Arg Pro Ser-C-terminal, wherein Xaa1 is Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro, Xaa2 is Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro, In this case, when Xaa1 is Ser, Xaa2 is not His, Sequence 96 is N-terminal-Gly Ala Trp Asp Asp Ser Xaa3 Ser Ala Tyr Val-C-terminal, wherein Xaa3 is Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro.

2. The anti-WARS1 antibody or fragment thereof according to claim 1, characterized in that The above-mentioned antibody or fragment thereof specifically binds to WARS1.

3. The anti-WARS1 antibody or fragment thereof according to claim 1, characterized in that The above-mentioned antibody or fragment thereof specifically binds to WARS1.

4. The anti-WARS1 antibody or fragment thereof according to claim 1, characterized in that The above-mentioned Xaa3 is Leu or Asn.

5. The anti-WARS1 antibody or fragment thereof according to claim 1, characterized in that The above light chain variable region comprises: L-CDR1 comprising the amino acid sequence of SEQ ID NO: 12; An L-CDR2 comprising any amino acid sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, and SEQ ID NO: 44; and L-CDR3 comprising the amino acid sequence of SEQ ID NO: 16 or SEQ ID NO:

46.

6. The anti-WARS1 antibody or fragment thereof according to claim 1, characterized in that The above heavy chain variable region comprises the amino acid sequence of sequence 9.

7. The anti-WARS1 antibody or fragment thereof according to claim 1, characterized in that The above-mentioned light chain variable region comprises any amino acid sequence selected from the group consisting of sequence 21, sequence 23, sequence 25, sequence 27, sequence 29, sequence 31, sequence 33, sequence 35, sequence 37, sequence 39, sequence 41, sequence 43, sequence 45, sequence 47, sequence 48 and sequence 49.

8. The anti-WARS1 antibody or fragment thereof according to claim 1, characterized in that The above antibodies contain an Fc region.

9. A polynucleotide, characterized in that Encoding the anti-WARS1 antibody or fragment thereof according to any one of claims 1 to 8.

10. An expression vector, characterized in that: Comprising the polynucleotide of claim 9.

11. A transformed cell, characterized in that: Introduce the expression vector according to claim 10.

12. A method for preparing an anti-WARS1 antibody or a fragment thereof, characterized in that: include: A step of culturing the transformed cell according to claim 11; as well as Steps for obtaining anti-WARS1 antibodies or fragments thereof.

13. A pharmaceutical composition for preventing or treating inflammatory diseases, characterized in that: The method comprises the anti-WARS1 antibody or a fragment thereof according to any one of claims 1 to 8 as an active ingredient.

14. The pharmaceutical composition for preventing or treating inflammatory diseases according to claim 13, characterized in that: The above-mentioned inflammatory diseases are selected from peritonitis, osteomyelitis, cellulitis, meningitis, encephalitis, pancreatitis, traumatic shock, cystic fibrosis, stroke, Lyme disease, polyarteritis nodosa, allergic vasculitis, Lou Gehrig's disease, articular cell arteritis, bursitis, tenosynovitis, epicondylitis, Henoch-Schönlein purpura, multicentric reticulohistiocytosis, paronychia, hemochromatosis, sickle cell anemia and other hemochromatosis, hyperlipoproteinemia, hypogammaglobulinemia, familial Mediterranean fever, relapsing fever, sepsis, septic shock, multiple organ dysfunction syndrome, bronchopulmonary dysplasia, inflammatory bowel disease, Any one of the group consisting of chronic obstructive pulmonary disease, macrophage activation syndrome, chronic systemic lupus erythematosus, scleroderma, atopic dermatitis, psoriasis, allergy, dermatitis, diabetic retinopathy, retinitis, macular degeneration, uveitis, conjunctivitis, arthritis, rheumatoid arthritis, ankylosing spondylitis, osteoarthritis, osteoporosis, allergy, diabetes, diabetic nephropathy, pyelonephritis, nephritis, Sjögren's syndrome, autoimmune pancreatitis, periodontal disease, asthma, graft-versus-host disease, chronic pelvic inflammation, endometritis, rhinitis, transplant rejection and chronic prostatitis, wherein the epicondylitis is tennis elbow.

15. Use of the antibody or fragment thereof according to claim 1 in preventing or treating inflammatory diseases.

16. A method for preventing or treating an inflammatory disease, characterized in that: The method comprises the step of administering the antibody or fragment of claim 1 to an individual.

Images