Application of miRNA-entrapped cationic lipid nanoparticles in ulcerative colitis

Abstract

The invention discloses an application of miRNA-entrapped cationic lipid nanoparticles in ulcerative colitis, the cationic lipid nanoparticles can be smoothly delivered to colon tissues by entrapment of one miRNA of miR-1247-3P, sth-miR-6 and sth-miR-18, and the ulcerative colitis can be effectively treated by up-regulating the expression of DGCR8 and ALDH2, down-regulating the expression of ACSS1, resisting oxidative stress and inhibiting secretion of inflammatory factors, so that the ulcerative colitis can be effectively treated, and the ulcerative colitis can be effectively treated. The traditional Chinese medicine composition disclosed by the invention can be used for effectively relieving inflammatory symptoms of ulcerative colitis, so that the effect of relieving and treating ulcerative colitis is achieved, and a new choice is provided for treatment of ulcerative colitis.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to application of cationic lipid nanoparticles encapsulating miRNA in ulcerative colitis. Background Art

[0002] Ulcerative colitis is a chronic autoimmune disease characterized by abdominal pain, diarrhea, bloody stools, and mucous stools. It is prone to relapse and is difficult to heal. In modern society, the treatment of inflammatory bowel disease mainly uses drugs such as 5-aminosalicylic acid and glucocorticoids. However, these drugs have side effects such as drug resistance and intestinal flora imbalance, which seriously affect the patient's prognosis. In recent years, biological agents and nanotechnology have shown great potential in the treatment of ulcerative colitis. In particular, nanoparticle drug delivery systems targeting nucleic acids can improve treatment efficiency and reduce systemic side effects, becoming a research hotspot.

[0003] Therefore, it is necessary to propose a drug delivery system based on cationic lipid nanoparticles to exert its anti-ulcerative colitis effect and provide a new option for the treatment of ulcerative colitis. Summary of the invention

[0004] The purpose of the present invention is to propose the application of cationic lipid nanoparticles encapsulating miRNA in ulcerative colitis, so as to provide a new option for the treatment of ulcerative colitis.

[0005] The present invention proposes the use of cationic lipid nanoparticles encapsulating miRNA in the preparation of drugs, wherein the miRNA is selected from one of miR-1247-3P, sth-miR-6, and sth-miR-18, and the nucleotide sequences are shown in SEQ ID NOs: 1-3 respectively; the drug is used to alleviate or treat ulcerative colitis.

[0006] Furthermore, the drug is used for at least one of the following purposes:

[0007] a) Upregulate the expression of DGCR8 and ALDH2, and downregulate the expression of ACSS1;

[0008] b) Antioxidant stress;

[0009] c) inhibit the secretion of inflammatory factors;

[0010] d) Restoration of colon morphology and length.

[0011] Furthermore, the miRNA-encapsulated cationic lipid nanoparticles are obtained by incubating miRNA with a blank cationic lipid nanoparticle solution.

[0012] Preferably, the cationic lipid nanoparticles are prepared based on a thin film hydration method, using dioctadecyldimethylammonium bromide as the cationic lipid.

[0013] More preferably, the preparation process of the cationic lipid nanoparticles further comprises the use of soybean lecithin, cholesterol and monostearate glyceride; the mass ratio of the soybean lecithin to cholesterol is (2-4):1, and the addition amount of the dioctadecyl dimethyl ammonium bromide is 10-40wt%.

[0014] More preferably, the cationic lipid nanoparticle preparation process further comprises using soybean lecithin, cholesterol, dioctadecyl dimethyl ammonium bromide and monostearate glyceride in a mass ratio of 2:1:2:1.

[0015] More preferably, the cationic lipid nanoparticles encapsulating miRNA have a particle size of 175-186 nm and a potential of 38.5-40.5 mV.

[0016] More preferably, the encapsulation efficiency of the miRNA is greater than 80%, and more preferably the encapsulation efficiency is greater than 85%.

[0017] Furthermore, the drug also includes pharmaceutically acceptable adjuvants, including but not limited to excipients, diluents, regulators, etc. Those skilled in the art can prepare suitable dosage forms according to the selected administration method to facilitate administration.

[0018] Furthermore, the drug is used for intravenous, intraperitoneal, intramuscular or subcutaneous injection, or for administration through the cavity, mucosa and skin, etc. Cavity administration includes routes such as the digestive tract, respiratory tract, urinary tract and reproductive tract.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The miRNA-encapsulated cationic lipid nanoparticles of the present invention can be smoothly delivered to colon tissue by encapsulating one of miRNAs selected from miR-1247-3P, sth-miR-6, and sth-miR-18, and can resist oxidative stress, inhibit the secretion of inflammatory factors, and protect pro-inflammatory mediators, thereby effectively alleviating the inflammatory symptoms of ulcerative colitis, thereby exerting the efficacy of alleviating and treating ulcerative colitis.

[0021] The cationic lipid nanoparticles encapsulating miRNA provided by the invention can interact with negatively charged molecules on the surface of the colon mucosa (such as glycoproteins in the mucus layer) based on the positive charge on the surface of the cationic lipid nanoparticles, thereby strengthening the retention and uptake of the nanoparticles in the colon tissue. In addition, the size of the nanoparticles is controlled within a suitable range so that it can pass through the mucus layer and act on the colon epithelial cells.

[0022] The cationic lipid nanoparticles used in the present invention are mainly composed of lipid components such as lecithin, monocholesterol and monostearate glyceride, dioctadecyl dimethyl ammonium bromide, etc. After these components are mixed in a certain proportion, they are prepared into nanoparticles by processes such as thin film hydration method or reverse evaporation method. Subsequently, miRNA1247-3p, sth-miRNA-6, and sth-miRNA-18 are wrapped inside the nanoparticles and stably combined through electrostatic interaction. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a graph showing the potential and particle size distribution of miRNA-SLNs prepared under the prescription of Example 2 of the present invention.

[0024] Figure 2 This is a TEM image of miRNA-SLNs prepared under the prescription of Example 2 of the present invention.

[0025] Figure 3 The corresponding miRNA measurement results of mouse colon tissue after administration in Example 3 of the present invention.

[0026] Figure 4 These are the comparative results of the body weight, colon length and colon histology of mice after administration in Example 3 of the present invention.

[0027] Figure 5 This is a picture of the mouse colon after drug administration in Example 3 of the present invention.

[0028] Figure 6 This is the result of HE staining of the colon pathology of mice after administration in Example 3 of the present invention.

[0029] Figure 7 This is the result of the effect of miRNA-SLNs on the spleen index of UC mice in Example 3 of the present invention.

[0030] Figure 8 These are the results of the effects of miRNA-SLNs on the levels of inflammatory factors in UC mice in Example 3 of the present invention.

[0031] Fig. 9 These are the results of the effects of miRNA-SLNs on oxidative stress in DSS-induced colitis mice in Example 3 of the present invention.

[0032] Fig.10 This is the result of the effect of miRNA-SLNs on DGCR8 / ALDH2 / ACSS1 protein expression in Example 3 of the present invention.

[0033] Fig.11 These are the results of the effects of miRNA-SLNs on the expression levels of DGCR8, ALDH2, and ACSS1 genes in mouse colon tissue in Example 3 of the present invention. DETAILED DESCRIPTION

[0034] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] In one embodiment, a cationic lipid nanoparticle encapsulating miRNA and its use in the treatment of ulcerative colitis is provided. By constructing an ulcerative colitis model for experiments, it is believed that the mechanism of efficacy may be related to the regulatory effect of miRNA on DGCR8, ALDH2, and ACSS1, and has anti-inflammatory, oxidative stress relief and other effects. At the same time, we believe that DGCR8 / ALDH2 / ACSS1 may be an important mechanism involved in the regulation of colitis diseases, and has the potential to be more worthy of in-depth research in the study of UC. The lipid nanoparticle has significant anti-colitis efficacy and is expected to provide a new and effective means for the treatment of ulcerative colitis.

[0036] In the above embodiment, the miRNA is selected from one of miR-1247-3P, sth-miR-6, and sth-miR-18, and the specific sequence derived from the miRNA is as follows:

[0037] miR-1247-3P: CGGGAACGUCGAGACUGGAGC (SEQ ID NO: 1)

[0038] sth-miR-6: CAACACUGCACUGGAAGAUGGA (SEQ ID NO: 2)

[0039] sth-miR-18:AGGAGAAACGAAGUAGAACCCU (SEQ ID NO: 3)

[0040] In some embodiments, the regulatory effect of cationic lipid nanoparticles encapsulating miRNA is verified by establishing a mouse ulcerative colitis model induced by dextran sulfate sodium salt (DSS). It is understandable that the DSS model, as a recognized ulcerative colitis model in the art, is the gold standard in the current field of intestinal inflammation modeling research.

[0041] Example 1 Preparation of cationic lipid nanoparticles encapsulating microRNA

[0042] 1.1 Preparation of blank cationic SLNs by thin film-ultrasound method

[0043] Weigh 20 mg of soybean lecithin (SPC), 10 mg of cholesterol (Chol), 5 mg of monostearate glyceride (GMS), and 10 mg of dioctadecyl dimethyl ammonium bromide (DDAB), mix and fully dissolve in chloroform solvent, place in an eggplant-shaped bottle, and remove the organic solvent by reduced pressure rotary evaporation under vacuum conditions at 55°C. When a uniform translucent lipid film appears inside the eggplant-shaped bottle, add RNase-Free Water, stir with a stirrer at 55°C to hydrate the lipid film, and hydrate the film by ultrasound or hand shaking if necessary. Use a cell disruptor for probe ultrasound, and pass through a 0.22μm microporous filter membrane to obtain blank cationic SLNs.

[0044] 1.2 Preparation of miRNA-loaded cationic solid lipid nanoparticles (miRNA-SLNs)

[0045] Based on the blank cationic lipid carrier prepared in 1.1, a certain amount of the prepared blank cationic SLNs solution was taken, diluted with enzyme-free water, and an equal volume of miRNA (sth-miRNA-6, sth-miRNA-18, miRNA-1247-3p) solution was added dropwise, and incubated at room temperature for 30 minutes to obtain the drug-loaded nanocomplex solution miRNA-SLNs.

[0046] 1.3 Establishment of Cy5-miRNA standard curve

[0047] Take the prepared miRNA-SLNs solution (miRNA is fluorescently labeled with Cy5) and dilute it to a series of concentrations of 0.20625, 0.4125, 0.825, 1.65, 3.3, 6.6, and 13.2 μg / mL. Accurately pipette it into a 96-well black board and measure its fluorescence intensity at Ex640nm and Em 681nm on a full-function microplate reader to establish a standard curve. Linear regression analysis was performed with fluorescence intensity (F) as the ordinate and miRNA (Cy5) concentration (C) as the abscissa, and the regression equation F = 3534.8C + 41.425 (R 2 =0.9993).

[0048] 1.4 Determination of encapsulation efficiency

[0049] The encapsulation efficiency of cationic miRNA-SLNs was determined by ultrafiltration tube separation-fluorescence spectrophotometry, and the full-function microplate reader was set to Ex 640nm and Em 681nm. The miRNA-SLNs liposome solution was added to the ultrafiltration tube Millipore (300K) at 5000r·min. -1 Centrifuge for 10 minutes, and the filtrate obtained is free miRNA (i.e., miRNA not encapsulated), and its fluorescence intensity F1 is measured. Take an equal amount of miRNA from the preparation and dilute it with methanol and measure its fluorescence intensity F2. Encapsulation efficiency calculation formula 1:

[0050] Encapsulation efficiency (%) = (1-F1 / F2) × 100% (1)

[0051] Example 2 Optimization of cationic lipid nanoparticle formulation for microRNA encapsulation

[0052] 1) Effect of the ratio of phospholipids to cholesterol on cationic SLNs

[0053] Phospholipids and cholesterol are important components of liposomes. Phospholipids are the main raw material for preparing liposomes. Cholesterol affects the permeability and fluidity of the membrane and plays an important role in the stability of the phospholipid bilayer

[119] . The ratio of SPC / Chol was adjusted to 2:1, 3:1, and 4:1, and SLNs were prepared according to the process of 1.1, and the optimal ratio of GMS / SPC that met the requirements was selected.

[0054] 2) Effect of DDAB dosage on cationic SLNs

[0055] DDAB, as a lipid carrier component, can effectively deliver genes and drugs into mammalian cells, and has the advantages of strong transfection ability and wide application. DDAB is proposed as a double-chain cationic amphiphile for medical applications in drug delivery systems and is an important component of cationic SLNs. Three doses of DDAB 5mg, 10mg, and 20mg were selected for preparation to screen out the optimal DDAB dosage.

[0056] 3) Effect of the ratio between organic solvent and lipid on cationic SLNs

[0057] The mixed lipids are well soluble in chloroform, so chloroform is selected as the solvent, and the mixed lipids are dissolved in 5 / 10 / 20 mg lipid / mL chloroform respectively to screen the best lipid-organic solvent ratio.

[0058] 4) Effect of ultrasonic conditions on cationic SLNs

[0059] Ultrasonic conditions have a great influence on the particle size and dispersion state of nanoparticles. The size of the ultrasonic power or the length of time may affect the structure, stability and dispersion of the drug. Therefore, the experiment explored the optimal ultrasonic time by changing different ultrasonic conditions.

[0060] 5) Determination of particle size and zeta potential

[0061] A nanoparticle size analyzer was used, the temperature was set to 25°C, and the equilibrium time was 180 s; the prepared SLNs suspension was diluted 50 times, and each sample was measured 3 times.

[0062] 6) Morphological observation

[0063] The prepared miRNA-SLNs were dropped onto a 200-mesh copper grid, stained with 2% phosphotungstic acid and allowed to dry, and their appearance was observed under a transmission electron microscope and photographed for record.

[0064] 7) Stability study of cationic miRNA-SLNs

[0065] The prepared miRNA-SLNs solution was stored at 4°C, and the changes in zeta potential and particle size were measured within one month.

[0066] result:

[0067] 1) Effect of SPC / Chol ratio on cationic SLNs

[0068] As shown in Table 1, when the proportion of SPC increases, the particle size of SLNs also increases. Since SPC is negatively charged, the potential decreases as the proportion increases. When the SPC / Chol ratio is 2:1, the particle size of the nanoparticles is 138.53±0.9nm and the potential is 50.08±0.55mV, which is most consistent with the cationic characteristics and has the smallest particle size.

[0069] Table 1: Effect of different SPC / Chol ratios on particle size, PDI, and potential (n=3)

[0070]

[0071] 2) Effect of DDAB dosage on cationic SLNs

[0072] As shown in Table 2, with the increase of DDAB, the particle size and potential gradually increase. When the DDAB input is 10 mg, the SLNs are the smallest, and the potential is more in line with the requirements of cationic lipids.

[0073] Table 2: Effect of DDAB dosage on particle size, PDI, and potential (n=3)

[0074]

[0075] 3) Effect of organic solvent to lipid ratio on cationic SLNs

[0076] As shown in Table 3 , the ratio of organic solvent to lipid had little effect on the nanoparticles, but when the ratio was 10 mg lipid / mL chloroform, the particle size of the prepared SLNs was the smallest.

[0077] Table 3: Effects of different lipid / chloroform ratios on particle size, PDI, and encapsulation efficiency (n=3)

[0078]

[0079] 4) Effects of ultrasound time and power on lipid nanoparticles

[0080] The results are shown in Table 4. As the ultrasonic time and power increase, the particle size decreases. Therefore, the ultrasonic power is 30% and the ultrasonic time is 10 min.

[0081] Table 4: Effect of different ultrasonic time on particle size, PDI and encapsulation efficiency (n=3)

[0082]

[0083] 5) Determination of process recipe

[0084] According to the results of single factor investigation, the optimal preparation process of miRNA-SLN is as follows:

[0085] Weigh SPC:Chol:DDAB:GMS = 2:1:2:1, mix and dissolve in 10 mg lipid / mL chloroform, place in a round-bottom flask after fully dissolved, vacuum and rotary evaporate to remove organic solvent at 55°C, wait for a uniform lipid film to form at the bottom of the round-bottom flask, hydrate the film with RNase free water, and fully hydrate with a stirrer at 55°C. Use a cell disruptor to perform probe ultrasound at 40% for 10 minutes to make the sample particle size and dispersion uniform. Finally, filter through a 0.22μm filter membrane to obtain the desired miRNA-SLNs solution.

[0086] 6) Determination of encapsulation efficiency

[0087] The encapsulation efficiency of cationic miRNA-SLNs in the formulation 5) was determined by ultrafiltration tube separation-fluorescence spectrophotometry, and the full-function microplate reader Ex 640nm, Em 681nm. Take the miRNA liposome solution, ultrafiltration tube Millipore (300K) 5000r·min －1 Centrifuge for 10 minutes, and the filtrate obtained is the unencapsulated miRNA, and its fluorescence intensity F1 is measured. Take an equal amount of miRNA from the preparation and dilute it with methanol and measure its fluorescence intensity F2.

[0088] The encapsulation efficiency was calculated as follows:

[0089] Encapsulation efficiency (%) = (1-F1 / F2) × 100%

[0090] The encapsulation efficiency was measured to be 89.9%.

[0091] 7) Potential and size of miRNA-SLNs

[0092] Take an appropriate amount of miRNA-SLNs sample and dilute it 50 times to measure the particle size and potential. Each sample was measured 3 times, the temperature was 25°C, and the equilibrium time was 120s. The average particle size was 180.9±4.85nm and the potential was 39.21±0.57mV. Compared with the blank SLNs particle size of 138.53±0.9nm and the potential of 50.08±0.55mV, the particle size of miRNA-SLNs increased. Since miRNA is negatively charged, the potential decreased after encapsulation, indicating that miRNA was successfully encapsulated by the SLNs carrier, such as Figure 1 As shown, Figure 1 A shows the average particle size, Figure 1 B shows the average potential.

[0093] 8) Characterization of miRNA-SLNs under transmission electron microscopy

[0094] The mi-RNA-SLNs were observed and photographed under a transmission electron microscope. The observation results are shown in Figure 2 As shown, miRNA-SLNs have an irregular circular appearance.

[0095] 9) Stability study of lipid nanoparticles

[0096] miRNA-SLNs were prepared according to the process recipe determined in 5) above, and their particle size, PDI and zeta potential were measured within one month (preparation day, 7th, 14th, 30th day). The results showed that there was no significant change in particle size and zeta potential, and no changes in aggregation and precipitation were visible to the naked eye.

[0097] Therefore, the miRNA-SLNs prepared by the process recipe determined in this example have the optimal parameters required by the liposome delivery system, which is used for subsequent delivery effect verification.

[0098] Example 3 Cationic miRNA-SLNs delivery results

[0099] The ulcerative colitis mouse model was established by freely drinking 3% dextran sodium sulfate aqueous solution. The experiment used tail vein injection to deliver miRNA-SLNs to mice for treatment. The DSS group represented the model group, NC represented the negative control group, no-miR-6 group, no-miR-18 group, and miR-1247-3p group represented the miRNA-SLNs constructed by miR-1247-3P, sth-miR-6, and sth-miR-18 for DSS model administration, respectively, the KZ group was the blank SLNs for DSS model administration, and the 5-ASA group was the 5-ASA administration group.

[0100] 1. miRNA-SLNs were successfully delivered to mouse colon tissue

[0101] RT-qPCR was used to measure the expression of corresponding miRNA in the colon tissue of mice after administration. Figure 3 As shown, the expression of A.no-miR-6B.no-miR-18C.miR-1247-3p in mouse colon tissue ( # p<0.05, ## P<0.01, and ### P<0.001 vs. NC group; * p<0.05, ** p<0.01, and *** P<0.001vs.DSS group). It can be seen that after administration of sth-miRNA-6, the expression of sth-miRNA-6 was about 100 times higher than that of other groups (3A); in the sth-miRNA-18 group and miRNA-1247-3p group, compared with other groups not receiving miRNA treatment, the expression of sth-miRNA-18 and miRNA-1247-3p was several thousand to tens of thousands times higher than that of other groups (3B, 3C). This result shows that cationic miRNA-SLN was effectively delivered to mice and highly expressed in colon tissue.

[0102] 2. miRNA-SLNs alleviate ulcerative colitis symptoms in UC mice

[0103] The acute inflammatory model of ulcerative colitis was induced by free drinking of 3% DSS water in mice, and the therapeutic effect of miRNA-SLNs on UC mice was evaluated by tail vein administration. According to ethical regulations, mice with a weight loss of about 25% will be euthanized in advance. First, the changes in weight loss, colon length, and colon histology scores of mice were examined to make a preliminary judgment on the efficacy. As shown in the figure, the weight loss, DAI score, colon length, colon histopathology score, colon image, and colon pathology HE staining indicators of mice in each treatment group were used to evaluate the effect of miRNA on DSS-induced colitis. Figure 4 A is the weight change, B is the DAI score, C is the colon length, and D is the colon pathology score; Figure 5 For colon pictures; Figure 6 HE staining for colon pathology ( # p<0.05, ## P<0.01, and ### P<0.001 vs. N group; * p<0.05, ** p<0.01, and *** P<0.001vs.DSS group).

[0104] The experimental results showed that the weight of mice in the NC group showed a steady upward trend, while the weight of the model group began to decrease significantly on the 4th day. The miRNA-SLNs treatment group and the 5-ASA treatment group effectively improved the degree of weight loss. Compared with the NC group, the DAI score of the DSS group increased significantly from the 4th day, while the DAI of the miRNA and 5-ASA treatment groups was significantly lower than that of the model group. In addition, compared with the NC group, the colon length of the DSS group was significantly shortened; and compared with the DSS group, the miRNA-SLNs and 5-ASA treatment groups significantly inhibited the shortening of the colon; at the same time, the results of HE staining of colon tissue pathological sections showed that compared with the NC group, the colon tissue structure of the DSS group was severely damaged, mainly manifested by a large number of inflammatory cells infiltration, the crypt structure was destroyed and deformed, and even the crypt structure disappeared, and the goblet cell reduction led to reduced mucus secretion. The miRNA-SLNs and 5-ASA treatment groups can restore tissue damage, reduce inflammatory cell aggregation, and are accompanied by the recovery of crypt structure and goblet cells. This suggests that DSS leads to an increase in histological scores, while miRNA-SLNs and 5-ASA treatments reduce histological scores. The above indicators did not play the role of improving colitis in the blank liposome group (KZ group).

[0105] 3. Spleen index

[0106] UC is caused by overstimulation of the immune system, and spleen weight increases as the degree of inflammation worsens. Figure 7 As shown ( # p<0.05, ##P<0.01, and ### P<0.001 vs. NC group; * p<0.05, ** p<0.01, and *** P<0.001vs.DSS group). Compared with the NC group, the spleen index of the DSS group was significantly increased, indicating that the spleen of the UC mice immune organ showed a declining trend. Compared with the DSS group, the spleen index of the drug-treated group was significantly reduced, indicating that the miRNA-SLNs treatment group had a protective effect on the spleen of the colitis mice immune organ, among which the no-miR-18 group had a significant difference (*p<0.05).

[0107] 4. Effect of miRNA-SLNs on the expression level of inflammatory factors in UC mice

[0108] The anti-inflammatory effect of miRNA-SLNs on UC mice was evaluated by measuring the levels of inflammatory cytokines in colon tissue. Figure 8 It can be seen that compared with the NC group, the levels of TNF-α, IL-1β, and IL-6 in the DSS group were significantly increased. Compared with the DSS group and the KZ group, the miR-SLNs treatment group had an anti-inflammatory effect on DSS-induced colitis in mice by inhibiting the secretion of proinflammatory cytokines TNF-α, IL-1β, and IL-18, among which sth-miRNA-18 had a better anti-inflammatory effect than miRNA-1247-3p and sth-miRNA-6 ( # p<0.05, ## P<0.01, and ### P<0.001 vs. NC group; * p<0.05,**p<0.01, and *** P<0.001vs.DSS group). However, the KZ group did not have an anti-inflammatory effect compared with the DSS group.

[0109] 5. miRNA-SLNs alleviate oxidative stress in UC mice

[0110] Studies have shown that oxidative stress is closely related to the onset of colitis. Fig. 9 As shown in Figure 2, compared with the NC group, the NO, MPO activity and MDA content in the DSS group were significantly increased ( Fig. 9 B, 9C, 9D); T-SOD activity was significantly reduced ( Fig. 9 A); Compared with the DSS group, the MDA content, NO, and MPO activity in the treatment group were significantly decreased ( Fig. 9D, 9B, 9C), T-SOD activity increased significantly; indicating that the treatment group can effectively alleviate the oxidative stress level of DSS-induced colitis mice, among which sth-miRNA-18 has better anti-inflammatory effect than sth-miRNA-6 and miRNA-1247-3p ( # p<0.05, ## P<0.01, and ### P<0.001 vs. NC group; * p<0.05, ** p<0.01, and *** P<0.001vs.DSS group). However, the KZ group did not alleviate the oxidative stress level of DSS-induced colitis mice.

[0111] 6. Effect of miRNA-SLNs on DGCR8 / ALDH2 / ACSS1 protein expression

[0112] Western-blot test results are as follows Fig.10 As shown, Fig.10 A is the glue picture. Fig.10 B The results showed that compared with the NC group, the DGCR8 protein expression in the DSS group was significantly downregulated, while the protein expression in the miRNA-SLNs group and the 5-ASA group was significantly increased, among which the DGCR8 protein expression in the sth-miRNA-6 and sth-miRNA-18 treatment groups was significantly restored (P<0.05, P<0.01). Fig.10 C shows that compared with the NC group, the ALDH2 expression in the DSS group was significantly decreased; compared with DSS, the ALDH2 protein expression in each miRNA-SLNs treatment group showed an up-regulation trend, but only the up-regulation of ALDH2 protein expression in the sth-miRNA-18 treatment group showed a significant difference (P<0.05). Fig.10 D shows that in the determination of ACSS1 protein, compared with the NC group, the ACSS1 protein expression in the DSS group was significantly increased; compared with the DSS group, the protein expression in the miRNA-SLNs treatment group showed a downward trend, and only the ACSS1 protein expression in the sth-miRNA-18 treatment group was significantly different (P<0.01). The DGCR8 / ALDH2 / ACSS1 protein expression levels in the KZ group were comparable to those in the DSS group, indicating that SLNs themselves had no regulatory effect.

[0113] In summary, in Western-blot detection, the sth-miRNA-18 treatment group showed significant differences in the expression of three proteins compared with the DSS group, suggesting that sth-miRNA-18 has a better therapeutic effect on UC mice, and its possible mechanism is related to the upregulation of DGCR8 / ALDH2 and the downregulation of ACSS1.

[0114] 7. Effect of miRNA-SLNs on the expression of DGCR8 / ALDH2 / ACSS1 genes

[0115] The gene expression levels of DGCR8, ALDH2, and ACSS1 in mouse colon tissue were detected by RT-qPCR technology. Fig.11 As shown in the figure, the expression trends of DGCR8, ALDH2, and ACSS1 genes are similar to those of proteins, which further proves that miRNA-SLNs regulate the three genes, upregulating the expression of DGCR8 and ALDH2 and downregulating the expression of ACSS1 ( # p<0.05, ## P<0.01, and ### P<0.001 vs. NC group; * p<0.05, ** p<0.01, and *** P<0.001vs.DSS group).

[0116] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Use of cationic lipid nanoparticles encapsulating miRNA in the preparation of drugs, characterized in that: The miRNA is selected from one of miR-1247-3P, sth-miR-6 and sth-miR-18, and the nucleotide sequences are shown in SEQ ID NOs: 1-3 respectively; the drug is used for alleviating or treating ulcerative colitis.

2. The use according to claim 1, characterized in that: The drug is used for at least one of the following purposes: a) Upregulate the expression of DGCR8 and ALDH2, and downregulate the expression of ACSS1; b) Antioxidant stress; c) inhibit the secretion of inflammatory factors; d) Restoration of colon morphology and length.

3. The use according to claim 1, characterized in that: The miRNA-encapsulated cationic lipid nanoparticles are obtained by incubating miRNA with a blank cationic lipid nanoparticle solution.

4. The use according to claim 3, characterized in that: The cationic lipid nanoparticles are prepared based on a thin film hydration method, using dioctadecyl dimethyl ammonium bromide as the cationic lipid.

5. The use according to claim 4, characterized in that: The preparation process of the cationic lipid nanoparticles also includes using soybean lecithin, cholesterol and monostearate glyceride; the mass ratio of the soybean lecithin to cholesterol is (2-4):1, and the addition amount of the dioctadecyl dimethyl ammonium bromide is 10-40wt%.

6. The use according to claim 5, characterized in that: The cationic lipid nanoparticle preparation process also includes using soybean lecithin, cholesterol, dioctadecyl dimethyl ammonium bromide and monostearate glyceride in a mass ratio of 2:1:2:

1.

7. The use according to claim 6, characterized in that: The cationic lipid nanoparticles encapsulating miRNA have a particle size of 175-186 nm and a potential of 38.5-40.5 mV.

8. The use according to claim 5 or 6, characterized in that: The encapsulation rate of the miRNA is greater than 80%.

9. The use according to claim 1, characterized in that: The medicament further includes a pharmaceutically acceptable adjuvant.

10. The use according to claim 1, characterized in that: The medicine is used for intravenous, intraperitoneal, intramuscular or subcutaneous injection, or for administration through a cavity, mucosa or skin.

Images