Single base editing method of leymus chinensis and application of LcALS mutant

Abstract

The invention provides a single base editing method of leymus chinensis and application of an LcALS mutant, and relates to the technical field of gene engineering. According to the invention, the acetolactate synthase related gene LcALS in leymus chinensis is subjected to directed mutation for the first time, including mutation attempt on the 95th, 197th, 653rd and / or 205th amino acid residues, so that beneficial mutation for enhancing the herbicide resistance of the 95th amino acid is successfully obtained, and a theoretical basis is provided for related research on the herbicide resistance of leymus chinensis.

Description

Technical Field

[0001] The present application relates to the field of genetic engineering technology, and in particular to a single-base editing method for Leymus chinensis and the application of LcALS mutants. Background Art

[0002] Leymus chinensis is a plant of the genus Leymus in the Poaceae family. It is cold-resistant, drought-resistant, alkali-resistant, barren-resistant, and wind-resistant. Therefore, it has strong adaptability and can grow in plains, hillsides, and sandy loam.

[0003] Leymus chinensis has a lot of leaves, high nutritional value, and good palatability. All kinds of poultry like to eat it all year round. It is an excellent pasture grass species. The stems of Leymus chinensis are also good raw materials for papermaking and have important economic value. In addition, the rhizomes of Leymus chinensis have strong penetration and invasion capabilities, and can form a strong root network, which has a great role in soil consolidation. It is a good soil and water conservation plant and can be used for ecological restoration of northern grasslands, which is very important for environmental protection.

[0004] Currently, there are few studies on single-base editing of Leymus chinensis and its herbicide resistance. Summary of the invention

[0005] The present invention is the first to carry out directed mutation of the acetolactate synthase-related gene LcALS in Leymus chinensis, including attempts to mutate the amino acid residues at positions 95, 197, 653 and / or 205, and successfully obtains a beneficial mutation at position 95 that enhances the herbicide resistance of the amino acid, providing a theoretical basis for research related to the herbicide resistance of Leymus chinensis. In addition, the present invention also provides a single-base editing method for Leymus chinensis, providing a new method for single-base gene editing of Leymus chinensis.

[0006] On the one hand, the present application provides a single base editing method for Leymus chinensis, the method comprising the following steps:

[0007] Step 1: Obtain gene editing vector;

[0008] Step 2: transferring the gene editing vector into Agrobacterium to obtain Agrobacterium carrying the target gene; the target gene is the 95th, 197th, 653rd and / or 205th amino acid coding sequence of LcALS;

[0009] Step 3: Use Agrobacterium carrying the target gene to infect the A. chinensis callus.

[0010] Preferably, the target gene is the 95th amino acid coding sequence of LcALS.

[0011] Furthermore, the gene editing vector includes sgRNA, and the sgRNA includes the sequence shown in SEQ ID No.5 and / or SEQ ID No.6.

[0012] In this application, the key target sites 197, 95, 205, and 653 of ALS in Leymus chinensis were selected for gene editing screening experiments. The results showed that sites 197, 205, and 653 could not be edited, and only site 95 could be edited.

[0013] On the other hand, the present application also provides a method for improving the herbicide resistance of Leymus chinensis, the method comprising: mutating the 95th alanine residue of the wild-type LcALS into a threonine residue.

[0014] Furthermore, the method comprises:

[0015] Step 1: Obtain gene editing vector;

[0016] Step 2: Transfer the gene editing vector into Agrobacterium to obtain Agrobacterium carrying the target gene;

[0017] Step 3: Use Agrobacterium carrying the target gene to infect the A. chinensis callus.

[0018] Furthermore, the gene editing vector includes sgRNA, and the sgRNA includes the sequence shown in SEQ ID No.5 and / or SEQ ID No.6.

[0019] Preferably, the target gene is a LcALS mutant gene; more preferably, the target gene is the 95th, 197th, 653rd and / or 205th amino acid coding sequence of LcALS; more preferably, the target gene is the 95th amino acid coding sequence of LcALS.

[0020] It is understandable that those skilled in the art can select a suitable gene editing system and gene editing method to complete the mutation modification according to actual conditions.

[0021] In a preferred embodiment, the gene editing vector may be a PH-A3A-PBE vector.

[0022] In a preferred embodiment, the Agrobacterium may be Agrobacterium tumefaciens EHA105.

[0023] On the other hand, the present application also provides a LcALS mutant, which is obtained by mutation of amino acid residues at positions 95, 197, 653 and / or 205 of wild-type LcALS, and the wild-type LcALS amino acid sequence includes an amino acid sequence as shown in SEQ ID No.1 or having at least 98% identity with the SEQ ID No.1 sequence.

[0024] Furthermore, the mutation includes: mutation of the 95th alanine residue of the wild-type LcALS to a threonine residue.

[0025] Furthermore, the amino acid sequence of the LcALS mutant includes an amino acid sequence as shown in SEQ ID No. 3 or an amino acid sequence having at least 98% identity with the sequence of SEQ ID No. 3.

[0026] Furthermore, the nucleotide sequence encoding the LcALS mutant includes a nucleotide sequence as shown in SEQ ID No. 4 or a nucleotide sequence having at least 98% identity with the SEQ ID No. 4 sequence.

[0027] On the other hand, the present application also provides a nucleic acid molecule, comprising a nucleotide sequence as shown in SEQ ID No. 4 or having at least 98% identity with the sequence of SEQ ID No. 4.

[0028] On the other hand, the present application also provides the use of the LcALS mutant or the nucleic acid molecule in improving the herbicide resistance of Leymus chinensis.

[0029] Furthermore, the herbicide is an acetolactate synthase inhibitory herbicide.

[0030] Furthermore, the acetolactate synthase inhibitory herbicide includes one or more of sulfonylurea herbicides, imidazolinone herbicides, triazole pyrimidine herbicides, pyrimidineoxy (sulfur) benzoic acid herbicides, and sulfonamide hydroxytriazolinone herbicides.

[0031] The working principle of ALS inhibitor herbicides is to inhibit the ALS enzyme activity in plants, thereby preventing the synthesis of branched-chain amino acids, causing protein synthesis to be damaged, so that cells cannot complete mitosis, and the plants stop growing, eventually leading to the death of individual plants. Therefore, the performance of the sheepgrass mutants obtained by the method of this application to resist acetolactate synthase inhibitor herbicides can be improved.

[0032] The present invention has the following beneficial effects:

[0033] 1. This application is the first to carry out targeted mutagenesis of the acetolactate synthase-related gene LcALS in Leymus chinensis, including attempting to mutate its amino acid residues at positions 95, 197, 653 and / or 205, to obtain a beneficial mutation at position 95 that enhances the herbicide resistance of the amino acid, providing a theoretical basis for research related to the herbicide resistance of Leymus chinensis.

[0034] 2. In this application, a mutant variety of Leymus chinensis with excellent herbicide resistance was obtained, providing a new variety of Leymus chinensis.

[0035] 3. This application provides a single-base gene editing system for Leymus chinensis, which provides a new method for gene editing in Leymus chinensis. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The drawings described herein are used to provide a further understanding of the present application and constitute a part of the present application. The illustrative embodiments of the present application and their descriptions are used to explain the present application and do not constitute an improper limitation on the present application. In the drawings:

[0037] Figure 1 Evolutionary tree analysis of ALS in different plants, among which Lc6Ns028617 and Lc6Ns080540 are ALS of Leymus chinensis, BnALS1 and BnALS3 are ALS of Brassica napus, AtALS1 is ALS of Arabidopsis thaliana, CsALS is ALS of Citrus, AhALS2A and AhALS2B are ALS of Peanut, MdALS is ALS of Apple, SiALS is ALS of Tomato, OsALS1 is ALS of Rice, PvALS1-1 and PvALS1-2 are ALS of Switchgrass;

[0038] Figure 2 is a comparison of the base sequences of ALS in different plants, among which Lc6Ns028617 and Lc6Ns080540 are ALS from Leymus chinensis, BnALS1 and BnALS3 are ALS from Brassica napus, AtALS1 is ALS from Arabidopsis thaliana, CsALS is ALS from Citrus sinensis, AhALS2A and AhALS2B are ALS from Peanut, MdALS is ALS from Apple, SiALS is ALS from Tomato, OsALS1 is ALS from Rice, and PvALS1-1 and PvALS1-2 are ALS from Switchgrass;

[0039] Figure 3 Schematic diagram of the PH-A3A-PBE vector structure;

[0040] Figure 4 These are the positive detection images of transgenic Leymus chinensis, where (top) is the positive detection image of HYG, and (bottom) is the positive detection image of Cas9;

[0041] Figure 5This is the result map of editing the LcALS197 locus of Leymus chinensis;

[0042] Figure 6 This is the result map of editing the LcALS205 locus of Leymus chinensis;

[0043] Figure 7 This is the result map of editing the LcALS653 locus of Leymus chinensis;

[0044] Figure 8 This is the result of sequencing the PCR stock solution of Leymus chinensis LcALS95 site;

[0045] Fig. 9 This is the single clone sequencing map of the ALS95 site of Leymus chinensis Lc. DETAILED DESCRIPTION

[0046] Technical terms:

[0047] Identity: refers to the degree of similarity between the nucleotide sequences of two nucleic acid molecules or between the amino acid sequences of two protein molecules in molecular evolution research.

[0048] In order to more clearly explain the overall concept of the present application, the following is described in detail in conjunction with the accompanying drawings of the specification by way of embodiment. In the following description, a large number of specific details are provided to provide a more thorough understanding of the present invention. However, it is obvious to those skilled in the art that the present invention can be implemented without one or more of these details. In other examples, in order to avoid confusion with the present invention, some technical features well known in the art are not described.

[0049] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0050] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0051] Unless otherwise specified, in the following embodiments, the reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially. The plasmids, endonucleases, PCR enzymes, column-based DNA extraction kits and DNA gel recovery kits used in the following examples are commercial products, and the specific operations are performed according to the kit instructions.

[0052] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are intended to describe specific embodiments, rather than to limit the scope of protection of the present invention. The test methods in the following examples without specifying specific conditions are generally carried out under conventional conditions or under conditions recommended by the manufacturers.

[0053] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0054] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in botany, microbiology, biochemistry, analytical chemistry, cell culture, and related fields in the technical field, and can be specifically carried out according to Molecular Cloning: A Laboratory Manual (Fourth Edition).

[0055] In addition, the "water" mentioned in the present invention includes any feasible water that can be used in the art, such as deionized water, distilled water, ion exchange water, double distilled water, high-purity water, and purified water.

[0056] In the present specification, the amino acids at the corresponding positions are represented by the recognized IUPAC single-letter abbreviations, wherein each amino acid and its abbreviation are: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine ​​(Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y) and valine (Val or V).

[0057] In the present specification, amino acid mutations are represented by “original amino acid, position, substituted amino acid.” For example, mutation of alanine A at position 95 to threonine T is represented by A95T.

[0058] In the following examples, unless otherwise specified, % means wt %, i.e. weight percentage.

[0059] The biosynthesis of branched-chain amino acids (valine, leucine and isoleucine) in plants and microorganisms requires the catalytic action of four enzymes, including: acetolactate synthase (ALS), ketol reductoisomerase, dihydroxyacid dehydratase, and branched-chain amino acid transaminase. Among them, acetolactate synthase (ALS) is the key enzyme in the first stage of the biosynthesis process. The working principle of ALS inhibitor herbicides is to inhibit the activity of ALS enzymes in plants, thereby preventing the synthesis of branched-chain amino acids, resulting in the destruction of protein synthesis. As a result, cells cannot complete mitosis, which in turn causes the plant to stop growing and eventually leads to the death of individual plants. ALS-related genes have been found in many plants, but due to different species, the sequences of ALS in different species are not exactly the same, such as Figure 1 and Figure 2 As shown. Moreover, the efficiency and success rate of single-base editing at the same ALS site cannot be estimated in different species. Even if they are all ALS197 sites, there are still some species that can be edited by single base, while others cannot. In addition, due to the huge differences in the regulatory networks of each organism, their functions and effects also vary in different species. It can be seen that it is particularly important to find ALS-related editable sites in sheep grass. At present, there is no genetic research related to single-base editing and herbicide resistance in sheep grass.

[0060] 1. Target gene cloning

[0061] 1.1 Extraction of Leymus chinensis DNA

[0062] a. Take fresh chinensis leaves, cut them into pieces and place them in a 2mL centrifuge tube. Add 1mL of 2×CTAB extract and 3-4 steel beads. Use a grinder to crush them and mix them thoroughly. Place them in a 65℃ water bath for 15min, during which time the centrifuge tube is inverted 2-3 times. After the water bath, cool them to room temperature.

[0063] b. Add 200 μL of chloroform, shake vigorously, invert 7-8 times to mix evenly, and centrifuge at 12000 rpm for 10 min.

[0064] c. Gently aspirate the supernatant into a new 1.5 mL centrifuge tube, add isopropanol of equal volume to the supernatant, mix by inverting 5-8 times, and centrifuge at 12,000 rpm for 10 min after settling at -20°C for 20 min.

[0065] d. Discard the supernatant, add 1 mL of 70% ethanol to wash the precipitate, and centrifuge at 12,000 rpm for 5 min.

[0066] e. Repeat step d above and use a pipette to absorb the supernatant solution.

[0067] f. Turn on the circulating air in the clean bench to dry the DNA precipitate. When the precipitate changes from white to transparent and there is no liquid on the tube wall, you can proceed to the next step.

[0068] i. Add 30-50 μL of deionized water to dissolve the DNA, and use an ultra-micrometer to measure the DNA concentration to obtain the A. chinensis DNA.

[0069] 1.2 RNA extraction from Leymus chinensis

[0070] RNA was extracted from the leaves of Leymus chinensis for gene amplification. The specific extraction steps are as follows (the entire extraction process strictly complies with the RNAase-free requirement):

[0071] a. Preparation: Disinfect the mortar with alcohol and pre-cool the centrifuge tube, tweezers, and scissors in liquid nitrogen.

[0072] b. Sampling: Select fresh, tender and clean sheep grass leaves, cut them with scissors and tweezers, wrap them tightly with tin foil, and quickly freeze them in liquid nitrogen for later use.

[0073] c. Grinding sample: Add liquid nitrogen into the mortar, put the leaves into the mortar and quickly grind them into powder.

[0074] d. Take an appropriate amount of powder and put it into a 1.5mL centrifuge tube. Add 1mL of trizol extract and mix well. Let it stand at room temperature for 5 minutes.

[0075] e. Add 200 μL of chloroform, shake vigorously upside down for 15 seconds, and centrifuge at 12,000 rpm at 4°C for 15 minutes.

[0076] f. Transfer the supernatant to a new centrifuge tube and repeat step e above.

[0077] g. Transfer the supernatant to a new centrifuge tube, add isopropanol in an equal volume to the supernatant, and precipitate at -20°C for 20 min.

[0078] h. Centrifuge at 4℃12000r / min for 10min, remove the supernatant and keep the precipitate.

[0079] j. Add 1 mL of 70% ethanol to wash the precipitate, centrifuge at 7500 r / min at 4°C for 5 min and discard the supernatant.

[0080] g. Repeat step j above.

[0081] k. Centrifuge empty tube at 4℃12000r / min for 2min.

[0082] l. Use the clean bench to circulate air to dry the RNA precipitate.

[0083] m. Add 20 μL RNAase-free water to dissolve RNA, and mix well by pipetting to obtain total RNA from Leymus chinensis.

[0084] 1.3 RNA Reverse Transcription

[0085] The total RNA of Leymus chinensis was reverse transcribed into cDNA using ThransScipt One-Step RT-PCR SuperMix reverse transcription kit, which was purchased from Quanshijin Biotechnology Co., Ltd. The reaction system is shown in Table 1 (the entire extraction process strictly complies with the RNAase-free requirement):

[0086] Table 1

[0087]

[0088] The above reaction reagents were added into the PCR tube according to the reaction volume and mixed thoroughly. The reaction was carried out at 42°C for 30 min and then at 85°C for 5 s. The temperature was controlled by a PCR instrument and the reaction products were stored at -80°C.

[0089] 1.4 PCR amplification

[0090] In order to accurately obtain the LcALS gene sequence of Leymus chinensis, DNA and cDNA were used as templates for amplification. The primer sequences involved are shown in Table 2, the amplification reaction system is shown in Table 3, and the amplification program is shown in Table 4.

[0091] Table 2 Primers involved in PCR amplification

[0092]

[0093] Table 3 PCR reaction system

[0094]

[0095]

[0096] Table 4 PCR reaction program:

[0097]

[0098] 1.5 Recovery of the target fragment of LcALS gene

[0099] The PCR product was detected by electrophoresis on 1% agarose gel at 130V for 20min. After the electrophoresis, it was recovered by gel recovery. The specific operation is as follows: the bright and single LcALS gene DNA / cDNA band of Leymus chinensis was quickly cut out from the agarose gel under ultraviolet light, and the amplified product was recovered using the Novozyme Gel DNA Extraction Mini Kit. The specific steps are as follows:

[0100] a. Place the excised gel containing the LcALS gene DNA / cDNA fragment of Leymus chinensis into a 2 mL centrifuge tube, weigh the gel (minus the weight of the empty tube), and add an equal volume of Buffer GDP sol solution (0.10 g gel plus 300 μL sol solution).

[0101] b. Allow to gel in a 56°C water bath for 5-10 minutes. Invert and mix twice during the water bath to accelerate gelation.

[0102] c. Briefly centrifuge to collect the droplets on the tube wall, put the adsorption column into the collection tube, transfer the sol solution to the adsorption column, centrifuge at 12000rpm for 1min, discard the filtrate and reuse the collection tube.

[0103] d. Repeat step c until all the sol solution is transferred to the adsorption column.

[0104] e. Add 700 μL Buffer GW (dilute with anhydrous ethanol before use) to the adsorption column. Centrifuge at 12000 rpm for 1 min, discard the filtrate and reuse the collection tube.

[0105] f. Repeat step e.

[0106] g. Centrifuge at 12000 rpm for 2 min to dry the adsorption column.

[0107] h. Discard the collection tube, place the adsorption column on a clean bench and blow for 2 minutes, then put the adsorption column into a new 1.5mL centrifuge tube.

[0108] i. Preheat 30 μL ddHO 2 0, accurately add it to the center of the adsorption column membrane, leave it at room temperature for 2 minutes, centrifuge it at 12000rpm for 1 minute, and elute the DNA.

[0109] j. Measure the concentration of recovered glue using an ultra-micro spectrophotometer and store it at -20°C.

[0110] The Spark Zero Background Ptopo-Blunt Simple cloning Kit was connected, and the construction system was shown in Table 5. The reaction procedure included: using a PCR instrument to control the temperature, reacting at 37°C for 5 minutes, and then transforming Escherichia coli.

[0111] Table 5

[0112]

[0113] 1.6 Transformation of E. coli

[0114] The specific operation steps for transforming the above ligation product (full-length fragment of LcALS gene) into E. coli are as follows:

[0115] 1) Take out a tube of DH5α competent cells from the -80℃ freezer and immediately thaw it on ice.

[0116] 2) After slight dissolution, add the above ligation product to E. coli, gently pipette and mix well, and place in an ice box for 30 minutes.

[0117] 3) Place in a 42°C water bath for 1 min 30 s, return to the ice box, and place in an ice bath for 2 min.

[0118] 4) Add 400-600 μL of empty LB culture medium to the tube in a clean bench, and then place it in a 37°C shaker at 200 r / min for 40-60 min.

[0119] 5) Take out the bacterial solution, centrifuge at 12000rpm for 1min when the bacteria are obviously turbid, pour out the excess supernatant in the clean bench, retain 100μL of supernatant and precipitate and mix thoroughly, then spread on LB plate containing carbenicillin, invert the plate, and culture it at 37℃ overnight for about 12-16h. When a single clone grows on the plate, take it out of the incubator and send it for sequencing.

[0120] The sequenced LcALS sequence was compared and confirmed with the LcALS sequence in the Leymus chinensis genome (lc6Ns028617 or lc6Ns080540), and single-base editing target site selection and vector construction were performed based on the confirmed LcALS sequence.

[0121] 2 Construction of single-base editing vector in Leymus chinensis

[0122] In this example, a single-base editing vector for Leymus chinensis was constructed with reference to the literature Efficient C-to-T base editing in plants using afusion of nCas9 and human APOBEC3A.

[0123] 2.1 Select PH-A3A-PBE carrier (such as Figure 3 ) as the backbone, and the PH-A3A-PBE vector was digested with Hind III restriction endonuclease, named PH-A3A-PBE / hindIII.

[0124] The enzyme digestion system is shown in Table 6 below.

[0125] Table 6

[0126]

[0127] After 1 hour at 37°C, the PCR product was detected by electrophoresis on 1% agarose gel at 130V for 20 minutes. After the electrophoresis, the product was recovered by gel extraction. The specific operation is as follows: the bright, single target band was quickly cut out from the agarose gel under UV light, and the amplified product was recovered using the Novozyme Gel DNA Extraction Mini Kit, following the same steps as 1.5.

[0128] 2.2 Using PH-A3A-PBE as a template, the product was amplified with primers LcALS95 / 197 / 653 / 205OsU3-HindIII-F and LcALS95 / 197 / 653 / 205OsU3-target-R. The reaction system was shown in Table 7, and the reaction procedure was shown in Table 8 to obtain amplified product 1.

[0129] LcALS95 / 197 / 653 / 205OsU3-HindIII-F:acgacggccagtgccaagcttagtaattcatccaggtctc;

[0130] LcALS95 / 197 / 653 / 205OsU3-target-R: (19 bp target site reverse complement) Tgccacggatcatctgcacaa.

[0131] Table 7 Amplification product 1 PCR reaction system

[0132]

[0133] Table 8 Amplification product 1 PCR reaction program

[0134]

[0135] 2.3 Using PH-A3A-PBE as a template, the product was amplified with primers LcALS95 / 197 / 653 / 205Target-sgRNA-F and LcALS95 / 197 / 653 / 205Target-sgRNA-R. The reaction system was shown in Table 9, and the reaction procedure was shown in Table 10 to obtain amplified product 2.

[0136] LcALS95 / 197 / 653 / 205Target-sgRNA-F: A (19 bp target site) GTTTTAGAGCTAGAAATAGCAA (SEQ ID No. 5);

[0137] LcALS95 / 197 / 653 / 205 Target-sgRNA-R: gcactgcaggcatgcaagcttagcagcaagcagtatcga (SEQ ID No. 6).

[0138] Table 9 Amplification product 2 PCR reaction system

[0139]

[0140] Table 10 Amplification product 2 PCR reaction program

[0141]

[0142] 2.4 Using amplification product 1 and amplification product 2 diluted 10 times as templates, overlap extension PCR reaction was performed, and LcALS95 / 197 / 653 / 205OsU3-HindIII-F and LcALS95 / 197 / 653 / 205Target-sgRNA-R were used as primers to amplify the fragment to obtain amplification product 3. The reaction system of amplification product 3 is shown in Table 11, and the reaction procedure is shown in Table 12.

[0143] Table 11 Amplification product 3 PCR reaction system

[0144]

[0145] Table 12 Amplification product 3 PCR reaction program

[0146]

[0147] The amplified product 3 was recovered by gel electrophoresis. The PCR product was detected by 1% agarose gel electrophoresis at 130V for 20min. After the electrophoresis, it was recovered by gel electrophoresis. The specific operation is as follows: the bright, single band was cut from the agarose gel under ultraviolet light, and the amplified product was recovered by using the Novozyme Gel DNA Extraction Mini Kit, and the steps were the same as 1.5.

[0148] 2.5 The linearized vector PH-A3A-PE-Hind III obtained in 2.1 and the gel-recovered fragment (i.e., amplified product 3) obtained in 2.4 were infused and connected. The infusion reaction system is shown in Table 13. The infusion reaction procedure was as follows: react at 37°C for 1 hour. The steps for transforming Escherichia coli were the same as in 1.6. When a single clone grew on the plate, it was taken out from the incubator and sent for sequencing. The sequencing results were compared to obtain the LcALS95 / 197 / 653 / 205 positive Escherichia coli culture with the correct target site constructed on the single-base editing vector.

[0149] Table 13

[0150]

[0151] The above-mentioned LcALS95 / 197 / 653 / 205 positive Escherichia coli was used as a sample for plasmid extraction, and the steps were as follows:

[0152] Take 100 μL of the positive E. coli culture solution from the sequencing sample and add it to 10 mL of liquid LB containing kan antibiotics and shake overnight. When the culture solution becomes thick, extract the plasmid. The specific operation is as follows:

[0153] 1) Pour the shaken bacterial solution into a centrifuge tube and centrifuge at 1000 rpm for 1 min. Discard the supernatant and place the centrifuge tube upside down on filter paper to absorb excess liquid.

[0154] 2) Add 250 μL of Buffer Pl to the centrifuge tube, use a pipette to continuously pipette to resuspend the cells, and transfer to a 1.5 mL centrifuge tube.

[0155] 3) Add 250 μL of Buffer P2 to a 1.5 mL centrifuge tube and mix by inverting.

[0156] 4) Add 350 μL Buffer P3, quickly invert to mix, and centrifuge at 12,000 rpm for 10 min.

[0157] 5) Place the adsorption column in the kit into the collection tube, transfer the supernatant obtained by centrifugation to the adsorption column, and do not absorb the precipitate. Centrifuge at 12000rpm for 1min, discard the filtrate and reuse the collection tube.

[0158] 6) Add 600 μL Buffer PW2 (dilute with anhydrous ethanol before use) to the adsorption column and centrifuge at 12000 rpm for 1 min. Discard the filtrate and reuse the collection tube.

[0159] 7) Repeat step 5).

[0160] 8) Centrifuge at 12000 rpm for 2 min to dry the adsorption column.

[0161] 9) Discard the collection tube, place the adsorption column on a clean bench and blow for 5 minutes, then put the adsorption column into a new 1.5 mL centrifuge tube.

[0162] 10) Add 65 μL of preheated ddHO 2 Add O accurately to the center of the adsorption column membrane, leave it at room temperature for 2 minutes, centrifuge at 12000rpm for 1 minute, and elute the DNA.

[0163] 11) Measure the concentration of the recovered plasmid using an ultra-micro spectrophotometer and store it at -20°C.

[0164] In summary, the Panicum virgatum single-base editing vector was obtained, and the LcALS95-1 / 95-3 / 197 / 653 / 205 sites of Leymus chinensis were edited.

[0165] 3 Agrobacterium transformation of LcALS95 / 197 / 653 / 205 plasmid

[0166] Freeze-thaw method for transformation of Agrobacterium competent cells: thaw Agrobacterium tumefaciens EHA105 competent cells on ice, add 3 μL of hygromycin (HYG) and LcALS95 / 197 / 653 / 205 plasmid DNA to each cell, let stand on ice for 30 min, freeze in liquid nitrogen for 1 min; then add 600 μL of LB medium without antibiotics in a 37°C water bath for 3 min, shake and culture at 28°C, 200 rpm for 3 h; centrifuge and concentrate the bacterial solution, use 100 μL of LB medium to dissolve the bacteria, and then apply the dissolved bacteria to 50 mg·L -1 Kanamycin plus 25 mg L -1 The culture medium was inverted at 28°C and a single clone was grown. The single clone was selected for PCR identification and the positive bacteria were selected. -1 Kan+25mg·L -1 Rif, 28°C, 200 rpm, when the OD of Agrobacterium 600 When the p-value reaches 0.6-0.8, 1 mL of bacterial solution is taken and added with 1 mL of 50% sterile glycerol. After rapid freezing in liquid nitrogen, the mixture is stored in a -80°C refrigerator and then used for transformation of Leymus chinensis.

[0167] The genetic transformation of Leymus chinensis mainly uses the transformed EHA105 Agrobacterium to infect embryonic callus with a single genotype. The specific process is as follows:

[0168] (1) Callus induction and propagation of Leymus chinensis

[0169] Wild-type Leymus chinensis spikelets were used to induce callus. The spikelets were cut and disinfected. The surface of the spikelets was wiped with a paper towel soaked in 75% ethanol to remove bacteria. The spikelets were then soaked in 75% ethanol for 3-5 minutes in a clean bench, shaken once every 30 seconds, and then placed on sterile filter paper to dry. The spikelets were then cut with a sterilized blade and placed on MS + 30 g L -1 +2,4-D 2.5mg·L -1 +6-BA0.15 mg·L -1 +Agar 7.6-7.8g, pH 5.8-6.0 culture medium for callus induction and subculture propagation.

[0170] (2) Agrobacterium infection of embryonic callus of Leymus chinensis

[0171] 1) Take 100 μL of LcALS95 / 197 / 653 / 205 vector bacterial solution carrying the target gene stored in a -80℃ refrigerator and add 50 mg·L -1 Kanamycin plus 25 mg L -1 The rifampicin was cultured in LB liquid medium at 28°C, 200 rpm, with shaking overnight;

[0172] 2) 28°C, 200 rpm, shake culture until OD 600 When the pH is 0.6-0.8, it is used to prepare callus infection solution MS+30g·L -1 +2,4-D 1.5mg·L -1 +6-BA0.15 mg·L -1 , pH 5.8-6.0; AS was added to a final concentration of 100 μM;

[0173] 3) Transfer the bacterial solution to a 50 mL sterile centrifuge tube and centrifuge at 20°C, 3500 rpm for 15 min;

[0174] 4) Discard the supernatant, resuspend the precipitate with 50 mL of infection solution, transfer the re-selection solution to a 200 mL tissue culture bottle, and continue shaking and culturing at 28°C, 200 rpm until OD 600 When the concentration is 0.8, the invasion dye solution is added to dilute the bacterial solution to a final concentration of OD 600 0.3-0.4;

[0175] 5) Take the callus tissue in good condition, dense and granular, as the explant infected with Agrobacterium tumefaciens, add it to the diluted Agrobacterium resuspension solution, and shake it gently to make it even;

[0176] 6) Vacuum for 10 min, ultrasonic for 5 min, and vacuum for 10 min;

[0177] 7) Pour out the bacterial solution and place the callus on sterile filter paper to let it stand;

[0178] 8) After the callus is dried, transfer it to a new sterile filter paper culture dish;

[0179] 9) Cultivate in dark for 3 days at 23°C-25°C;

[0180] 10) Transfer the callus to the screening medium MS+30g·L -1 +2,4-D 2mg·L -1 +400mg L -1 Tim+30mg·L -1 Hyg+Agar 7.6-7.8g, pH 5.8-6.0, dark culture screening for 1.5-2 months, subculture every 2 weeks to maintain stable antibiotic screening pressure;

[0181] 11) Transfer the resistant callus to differentiation medium MS+30 g·L -1 +6BA0.5 mg·L -1 +KT 2,mg·L - 1 400mg L -1 Tim+2mg·L -1 Hyg+Agar 7.6-7.8g, 2mg·L -1 The differentiation medium was replaced with fresh one every three weeks.

[0182] 4PCR identification of transgenic callus

[0183] 1) DNA from transgenic callus of Leymus chinensis was extracted using the 2×CTAB method;

[0184] 2) Take the differentiated transgenic callus of Leymus chinensis and place it in a 2 mL centrifuge tube, add 1 mL of 2×CTAB extract, add 3-4 steel balls, use a grinder to crush and mix thoroughly, and place in a 65°C water bath for 15 min, during which the centrifuge tube is inverted 2-3 times, and then cooled to room temperature after the water bath.

[0185] 3) Add 200 μL of chloroform, shake vigorously, invert 7-8 times to mix evenly, and centrifuge at 12000 rpm for 10 min;

[0186] 4) Gently aspirate the supernatant into a new 1.5 mL centrifuge tube, being careful not to aspirate the precipitate, add isopropanol equal to the volume of the supernatant, invert 5-8 times to mix, and settle at -20°C for 20 minutes, then centrifuge at 12,000 rpm for 10 minutes;

[0187] 5) Discard the supernatant, add 1 mL of 70% ethanol to wash the precipitate, and centrifuge at 12000 rpm for 5 min;

[0188] 6) Repeat the above step 5) and use a pipette to absorb the supernatant solution;

[0189] 7) Circulate air in the clean bench to dry the DNA precipitate. When the precipitate changes from white to transparent and there is no liquid on the tube wall, proceed to the next step.

[0190] 8) Add 30-50 μL of deionized water to dissolve the DNA, measure the DNA concentration using an ultra-micrometer and mark the concentration and time on the tube wall.

[0191] PCR reaction: Qingdao Qingke Zixi Biotechnology Co., Ltd. synthesized the PCR primers of HYG gene, HYG-F: 5'-AAGGAATCGGTCAATACACTACATGG-3', HYG-R: 5'-AAGACCAATGCGGAGCATATACG-3'. PCR amplified the HYG gene, the reaction system is shown in Table 14, and the reaction procedure is shown in Table 15.

[0192] Table 14 PCR reaction system

[0193]

[0194] Table 15 PCR reaction program

[0195]

[0196] 7 μL of the PCR amplification product of the HYG gene was taken for agarose gel electrophoresis (1.0%) and photographed. When spotting, 4 μL of 2 000 bp Ladder Maker was used as a molecular weight standard.

[0197] The gel images of the regenerated plants showed that the PCR products of HYG and Cas9 genes were both about 500 bp in size ( Figure 4 ), which was in line with expectations. A total of 94 plants were tested, of which 82 were hygromycin positive.

[0198] The positive DNA was picked for PCR amplification, and the editing detection primers were synthesized by Qingdao Qingke Zixi Biotechnology Co., Ltd., among which LcALS95 / 197 / 205F: CTCCCGCGCCACCAGCCC

[0199] LcALS95 / 197 / 205R: GGGATATCAACCAGCACCG

[0200] LcALS653F: CAGGAGTTGGCGTTGATCC

[0201] LcALS653R:ATACGCGGTCCTGCCATC

[0202] The reaction system is shown in Table 16, and the reaction procedure is shown in Table 17.

[0203] Table 16 PCR reaction system

[0204]

[0205] Table 17 PCR reaction program

[0206]

[0207] The single clones with double peaks near the LcALS95 / 197 / 653 / 205 target site were sampled and ligated to the T vector.

[0208] The sequenced returned sample LcALS95 / 197 / 653 / 205 plasmid was connected to the Spark Zero Background Ptopo-Blunt Simple cloning Kit. The reaction system is shown in Table 18.

[0209] Table 18 PCR reaction system

[0210]

[0211] Reaction procedure: Use a PCR instrument to control the temperature, react at 37°C for 5 minutes, and then transform E. coli. The transformation steps are the same as 1.6. Based on the known LcALS sequence, the single-base editing effective plant A95T is obtained through sequence alignment.

[0212] That is, in this application, the key target sites 197, 95, 205, and 653 of ALS in Leymus chinensis were selected for gene editing screening experiments. The results showed that the 197 site (such as Figure 5 ), 205 sites (such as Figure 6 ), 653 sites (such as Figure 7 ) were unable to perform gene editing, and only 95 sites were successfully edited (such as Figure 8 and Fig. 9 ).

[0213] The working principle of ALS inhibitor herbicides is to inhibit the ALS enzyme activity in plants, thereby preventing the synthesis of branched-chain amino acids, causing protein synthesis to be damaged, so that cells cannot complete mitosis, and the plants stop growing, eventually leading to the death of individual plants. Therefore, the performance of the A95T mutant of Leymus chinensis obtained by the method of this application to resist acetolactate synthase inhibitor herbicides can be improved.

[0214] The above is only an embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.

Claims

1. A single base editing method for Leymus chinensis, characterized in that: The method comprises the following steps: Step 1: Obtain gene editing vector; Step 2: transferring the gene editing vector into Agrobacterium to obtain Agrobacterium carrying the target gene; the target gene is the 95th, 197th, 653rd and / or 205th amino acid coding sequence of LcALS; Step 3: Use Agrobacterium carrying the target gene to infect the A. chinensis callus.

2. The single base editing method according to claim 1, characterized in that The gene editing vector includes sgRNA, and the sgRNA includes the sequence shown in SEQ ID No.5 and / or SEQ ID No.

6.

3. A LcALS mutant, characterized in that: The LcALS mutant is obtained by mutation of amino acid residues at positions 95, 197, 653 and / or 205 of wild-type LcALS, and the amino acid sequence of wild-type LcALS includes an amino acid sequence as shown in SEQ ID No.1 or having at least 98% identity with the sequence of SEQ ID No.

1.

4. The mutant according to claim 3, characterized in that The mutation includes: the 95th alanine residue of the wild-type LcALS is mutated to a threonine residue.

5. The mutant according to claim 4, characterized in that The amino acid sequence of the LcALS mutant includes an amino acid sequence as shown in SEQ ID No. 3 or an amino acid sequence having at least 98% identity with the sequence of SEQ ID No.

3.

6. The mutant according to claim 5, characterized in that The nucleotide sequence encoding the LcALS mutant includes a nucleotide sequence as shown in SEQ ID No. 4 or a nucleotide sequence having at least 98% identity with the sequence of SEQ ID No.

4.

7. A nucleic acid molecule, characterized in that The nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID No. 4 or having at least 98% identity with the sequence of SEQ ID No.

4.

8. Use of the LcALS mutant according to any one of claims 3 to 6 or the nucleic acid molecule according to claim 7 in improving the herbicide resistance of Leymus chinensis.

9. The use according to claim 8, characterized in that: The herbicide is an acetolactate synthase inhibitory herbicide.

10. The use according to claim 9, characterized in that: The acetolactate synthase inhibitory herbicide includes one or more of sulfonylurea herbicides, imidazolinone herbicides, triazole pyrimidine herbicides, pyrimidineoxy (sulfur) benzoic acid herbicides, and sulfonamide hydroxytriazolinone herbicides.

Images