Methods and kits for depleting and enriching nucleic acid sequences

Abstract

Kits and methods for enriching a target nucleic acid sequence, such as a nucleic acid molecule comprising a target nucleic acid sequence, and kits and methods for depleting a target nucleic acid sequence, such as a nucleic acid molecule comprising a target nucleic acid sequence. In an embodiment, the method for enriching a target nucleic acid sequence includes selectively degrading a single-stranded sample nucleic acid molecule, such as those that do not include the target nucleic acid sequence. In embodiments, the methods for depleting a target nucleic acid sequence include selectively degrading double-stranded sample nucleic acid molecules, such as those comprising a target nucleic acid sequence.

Description

[0001] This application is a divisional application of the PCT international application PCT / US2019 / 057939 filed on October 24, 2019, which entered the Chinese national phase on April 23, 2021, with application number 201980070102.1 and invention name “Methods and kits for depleting and enriching nucleic acid sequences”.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application No. 62 / 750,169, filed on October 24, 2018, the entire contents of which are incorporated herein by reference.

[0004] Statement regarding sequence listing

[0005] The sequence listing associated with this application is provided in text format in lieu of a paper copy and is hereby incorporated by reference into the application. The name of the text file containing the sequence listing is 70380_Seq_final_2019-10-24.txt. The text file is 14KB; created on October 24, 2019; and submitted with the application file via EFS-Web.

[0006] background

[0007] Complex biological samples, such as tissues, cells, cell lysates, serum, etc., pose challenges for determining the sequence and concentration of nucleic acid molecules with a specific target sequence. Similarly, determining the sequence and concentration of nucleic acids from a set of barcoded molecules, such as single-cell RNA sequencing libraries, poses similar challenges.

[0008] Typically, sequencing methods such as Sanger sequencing or next generation sequencing (NGS) methods are used to sequence nucleic acids in such complex samples and sequence libraries, wherein a large amount of excess sequences are generated in addition to those based on the target sequence of interest. In addition, when using the NGS method, a relatively large amount of sequencing reads are used to achieve the desired sequencing depth.

[0009] Selective enrichment of target nucleic acid sequences or depletion of non-target nucleic acid sequences in complex samples will simplify the interpretation of sequence data and reduce the number of reads required to achieve a specific sequencing depth.

[0010] Therefore, there is currently a need in the art to selectively remove some or all non-target nucleic acid molecules in a complex mixture, or to selectively increase the proportion of target nucleic acid molecules, for example in preparation for sequencing. The present invention seeks to meet these needs and provides further related advantages.

[0011] Overview

[0012] To this end, in certain aspects, the present invention provides methods and kits for enriching target nucleic acid molecules. Accordingly, in other aspects, the present invention provides methods and kits for depleting non-target nucleic acid molecules.

[0013] On the one hand, the present invention provides a method for enriching a target nucleic acid sequence. In an embodiment, the method comprises introducing a capture primer nucleic acid molecule complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules in a sample solution comprising a plurality of sample nucleic acid molecules, each of the sample nucleic acid molecules comprising a universal adapter nucleic acid sequence; enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; and enzymatically degrading single-stranded sample nucleic acid molecules to provide a sample solution having a higher proportion of sample nucleic acid molecules comprising a target nucleic acid sequence than the sample solution.

[0014] On the other hand, the present invention provides a method for depleting a target nucleic acid sequence. In an embodiment, the method includes introducing a capture primer nucleic acid molecule complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules in the multiple sample nucleic acid molecules into a sample solution comprising a plurality of sample nucleic acid molecules, each of the sample nucleic acid molecules comprising a universal adapter nucleic acid sequence, the universal adapter nucleic acid sequence comprising ribonucleotides; enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; and enzymatically cleaving the double-stranded ribonucleic acid molecules of the sample nucleic acid molecules to provide a sample solution depleted of sample nucleic acid molecules having a lower proportion of sample nucleic acid molecules comprising the target nucleic acid sequence than the sample solution.

[0015] In one aspect, the present invention provides a kit for enriching a target nucleic acid sequence. In an embodiment, the kit comprises a capture primer nucleic acid molecule complementary or partially complementary to the target sequence; and a degradation enzyme configured to degrade single-stranded nucleic acid molecules.

[0016] In another aspect, the present invention provides a kit for depleting a target nucleic acid sequence. In an embodiment, the kit comprises a capture primer nucleic acid molecule complementary or partially complementary to the target sequence; and a degradation enzyme configured to degrade double-stranded nucleic acid molecules.

[0017] This Summary is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description. This Summary is not intended to identify key features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The foregoing aspects of the present invention and many of the attendant advantages will become more readily understood as they become better appreciated by reference to the following detailed description when taken in conjunction with the accompanying drawings, wherein:

[0019] Figure 1A A sample solution according to an embodiment of the present invention is schematically shown, the sample solution comprising sample nucleic acid molecules to be enriched and nucleic acid molecules to be depleted.

[0020] Figure 1B Schematically shows an embodiment of the present invention Figure 1A A sample solution further comprising capture primer nucleic acid molecules.

[0021] Figure 1C Schematically shows the steps of: Figure 1B of sample solution.

[0022] Figure 1D Schematically shows the process of annealing the capture primer nucleic acid molecule to the target sequence of the nucleic acid molecule to be enriched according to an embodiment of the present invention. Figure 1C of sample solution.

[0023] Figure 1E Schematically illustrates, according to an embodiment of the present invention, the process of enzymatically extending a capture primer nucleic acid molecule annealed to a target sequence. Figure 1D of sample solution.

[0024] Figure 1F Schematically shows the process of enzymatically degrading single-stranded sample nucleic acid molecules in a sample solution according to an embodiment of the present invention. Figure 1E of sample solution.

[0025] Figure 1G Schematically shows an embodiment according to the present invention, Figure 1F The nucleic acid molecules in the sample solution are melted.

[0026] Figure 1H Schematically shows the process of removing the capture primer nucleic acid molecules according to an embodiment of the present invention. Figure 1G of sample solution.

[0027] Fig. 1I Schematically shows an embodiment of the present invention Figure 1H The sample solution further comprises a polymerase chain reaction (PCR) primer complementary to a universal adapter sequence of a sample nucleic acid molecule in the sample solution.

[0028] Figure 1JSchematically shows the steps of amplifying specific sample nucleic acid molecules of a sample solution by PCR according to an embodiment of the present invention. Fig. 1I of sample solution.

[0029] Figure 2A A sample solution according to an embodiment of the present invention is schematically shown, the sample solution comprising sample nucleic acid molecules to be enriched and nucleic acid molecules to be depleted.

[0030] Figure 2B Schematically shows an embodiment of the present invention Figure 2A The sample solution further comprises a capture primer nucleic acid molecule.

[0031] Figure 2C Schematically shows the steps of: Figure 2B of sample solution.

[0032] Figure 2D Schematically shows the process of annealing a capture primer nucleic acid molecule to a target sequence of a nucleic acid molecule to be consumed according to an embodiment of the present invention. Figure 2C of sample solution.

[0033] Figure 2E Schematically illustrates, according to an embodiment of the present invention, the process of enzymatically extending a capture primer nucleic acid molecule annealed to a target sequence. Figure 2D of sample solution.

[0034] Figure 2F Schematically shows the process of enzymatically degrading double-stranded sample nucleic acid molecules in a sample solution according to an embodiment of the present invention. Figure 2E of sample solution.

[0035] Figure 2G Schematically shows an embodiment according to the present invention, Figure 2F The sample nucleic acid molecules in the sample solution are melted.

[0036] Figure 2H Schematically shows the process of removing the capture primer nucleic acid molecules according to an embodiment of the present invention. Figure 2G of sample solution.

[0037] Fig.2I Schematically shows an embodiment of the present invention Figure 2H The sample solution further comprises a PCR primer complementary to a universal adapter sequence of a sample nucleic acid molecule in the sample solution.

[0038] Figure 2JSchematically shows the steps of amplifying the sample nucleic acid molecules of the sample solution by PCR according to an embodiment of the present invention. Fig.2I of sample solution.

[0039] Figure 3A A sample solution according to an embodiment of the present invention is schematically shown, the sample solution comprising sample nucleic acid molecules to be enriched and nucleic acid molecules to be depleted.

[0040] Figure 3B Schematically shows an embodiment of the present invention Figure 3A The sample solution further comprises a capture primer nucleic acid molecule, wherein the capture primer nucleic acid molecule comprises a closed capture primer nucleic acid molecule.

[0041] Figure 3C Schematically shows the steps of: Figure 3B of sample solution.

[0042] Figure 3D Schematically shows the process of annealing a capture primer nucleic acid molecule to a target sequence of a nucleic acid molecule to be consumed according to an embodiment of the present invention. Figure 3C of sample solution.

[0043] Figure 3E Schematically illustrates, according to an embodiment of the present invention, the process of enzymatically extending a capture primer nucleic acid molecule annealed to a target sequence. Figure 3D of sample solution.

[0044] Figure 3F Schematically shows the process of enzymatically degrading double-stranded sample nucleic acid molecules in a sample solution according to an embodiment of the present invention. Figure 3E of sample solution.

[0045] Figure 3G Schematically shows an embodiment according to the present invention, Figure 2F The sample nucleic acid molecules in the sample solution are melted.

[0046] Figure 3H Schematically shows the process of removing the capture primer nucleic acid molecules according to an embodiment of the present invention. Figure 3G of sample solution.

[0047] Fig. 3I Schematically shows an embodiment of the present invention Figure 3H The sample solution further comprises a PCR primer complementary to a universal adapter sequence of a sample nucleic acid molecule in the sample solution.

[0048] Figure 3JSchematically shows the steps of amplifying the sample nucleic acid molecules of the sample solution by PCR according to an embodiment of the present invention. Fig. 3I of sample solution.

[0049] Figure 4 A capture primer nucleic acid molecule according to an embodiment of the present invention bound to Hygro is schematically shown.

[0050] Figure 5 A capture primer nucleic acid molecule according to an embodiment of the present invention bound to AmpR is schematically shown.

[0051] Figure 6 A capture primer nucleic acid molecule according to an embodiment of the present invention bound to AmpR is schematically shown, comprising a universal adaptor sequence comprising a poly-T sequence.

[0052] Figure 7 A capture primer nucleic acid molecule according to an embodiment of the present invention bound to Hygro is schematically shown, the molecule comprising a universal adaptor sequence comprising a poly-T sequence.

[0053] Figure 8 is an image of an electrophoresis gel showing the results of an electrophoresis experiment showing enrichment of sample nucleic acid molecules containing a target sequence according to an embodiment of the present invention.

[0054] Details

[0055] The present invention provides kits and methods for enriching target nucleic acid sequences, such as nucleic acid molecules comprising the target nucleic acid sequences, and kits and methods for depleting target nucleic acid sequences, such as nucleic acid molecules comprising the target nucleic acid sequences.

[0056] As used herein, the terms "nucleic acid" and "polynucleotide" refer to biopolymers composed of monomeric units called "nucleotides". Typically, each nucleotide consists of a 5-carbon sugar, a phosphate group, and a nitrogenous base (also referred to as a "nucleobase"). The structure of the sugar component typically defines the type of nucleic acid polymer. Nucleotide monomers are linked to form a linear sequence of nucleic acid polymers. The nucleic acids encompassed by the present invention may include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), cDNA, or synthetic nucleic acids known in the art, such as peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), locked nucleic acid (LNA), or other synthetic polymers with nucleotide side chains, or any combination thereof. Nucleic acid molecules may be single-stranded or double-stranded (having complementary single-stranded polynucleotide chains hybridized by base pairing of a single nucleobase). Typically, cDNA, RNA, GNA, TNA, or LNA are single-stranded. DNA may be double-stranded (dsDNA) or single-stranded (ssDNA).

[0057] The nucleotide subunit of nucleic acid can be naturally occurring, artificial or modified. As mentioned above, nucleotides generally comprise a core base, a sugar and at least one phosphate group. Core bases are generally heterocyclic. Suitable core bases include classical purines and pyrimidines, more specifically adenine (A), guanine (G), thymine (T) (or generally uracil (U) instead of thymine (T) in RNA) and cytosine (C). The sugar is generally pentose. Suitable sugars include but are not limited to ribose and deoxyribose. Nucleotides are generally ribonucleotides or deoxyribonucleotides. Nucleotides generally comprise monophosphate, diphosphate or triphosphate. These are generally referred to as nucleotides or nucleotide residues herein to represent the subunit. In the absence of specific identification, the terms nucleotide, nucleotide residue, etc. are not intended to imply any specific structure or attribute. As mentioned above, nucleic acid of the present invention may also include synthetic variants of DNA or RNA. "Synthetic variants" encompass nucleic acids incorporating known analogs of natural nucleotides / core bases, which can hybridize with nucleic acids in a manner similar to naturally occurring nucleotides. Exemplary synthetic variants include peptide nucleic acid (PNA), phosphorothioate DNA, locked nucleic acid, and the like. Modified or synthetic nucleobases and analogs may include, but are not limited to, 5-Br-UTP, 5-Br-dUTP, 5-F-UTP, 5-F-dUTP, 5-propynyl dCTP, 5-propynyl-dUTP, diaminopurine, S2T, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-hydroxyuracil, 5 ... -methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosyl quercetin, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-D46-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, quercetin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, 2,6-di-aminopurine, etc. One of ordinary skill in the art can readily determine what base pairing is considered a base pair match and what base pairing is considered a base pair mismatch for each modified nucleobase.

[0058] method

[0059] On the one hand, the present invention provides a method for enriching and / or depleting a target nucleic acid sequence, such as a target nucleic acid sequence on a sample nucleic acid present in a complex sample solution, wherein the complex sample solution contains sample nucleic acid molecules that do not contain the target nucleic acid sequence.

[0060] Enrichment methods

[0061] In an embodiment, the present invention provides a method for enriching a target nucleic acid sequence. In an embodiment, the method for enriching a target nucleic acid sequence comprises (a) introducing a capture primer nucleic acid molecule complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules in the multiple sample nucleic acid molecules into a sample solution comprising a plurality of sample nucleic acid molecules, wherein each of the sample nucleic acid molecules comprises a universal adapter nucleic acid sequence; (b) enzymatically extending a capture primer nucleic acid molecule annealed to a target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) enzymatically degrading single-stranded sample nucleic acid molecules to provide a sample solution having a higher proportion of sample nucleic acid molecules comprising a target nucleic acid sequence than the sample solution.

[0062] A method for enriching a target nucleic acid sequence according to an embodiment of the present invention will now be described. In this regard, attention is directed to Figures 1A-1J , which schematically illustrates a method for enriching a target nucleic acid sequence according to an embodiment of the present invention.

[0063] Figure 1A A sample solution is schematically shown, the sample solution comprising nucleic acid molecules to be enriched and nucleic acid molecules to be consumed. As shown in the figure, the sample solution comprises a starting library of nucleic acid molecules, the starting library of nucleic acid molecules comprising double-stranded nucleic acid molecules for enrichment and double-stranded nucleic acid molecules for consumption. Although the sample nucleic acid molecules are shown as double-stranded, in an embodiment, the sample nucleic acid molecules comprise single-stranded sample nucleic acid molecules or a combination of single-stranded and double-stranded sample nucleic acid molecules. The double-stranded nucleic acid molecules used for enrichment are shown to contain universal adapter nucleic acid sequences a, a*, b and b*, and target nucleic acid sequences c and c*. The double-stranded nucleic acid molecules used for consumption are shown to contain universal adapter nucleic acid sequences a, a*, b and b*, and nucleic acid sequences d and d* that are different from the target nucleic acid sequences c and c*. The universal adapter nucleic acid sequences a, a*, b and b* on both the sample nucleic acid molecules used for enrichment and for consumption are shown to contain common features, schematically shown here as ellipses. As described herein with respect to Figure 1F As discussed further, such common features are amenable to enzymatic degradation under certain conditions, such as where the universal adaptor nucleic acid sequence is single-stranded.

[0064] The method of the present invention is suitable for enriching many sample solutions comprising nucleic acid molecules. In embodiments, the sample solution is selected from WGS library, WES library, ATAC-seq library, ChIP-seq library, WTS library, Bisulfite-seq library, RNA-seq library, single cell RNA-seq library, DNA data storage library or any other library with universal adapters at both ends. The mixture of DNA molecules can be pre-amplified or unamplified, enzymatically produced or chemically synthesized. Universal adapters (domain a and domain b*) can include DNA and / or RNA nucleotides. As further discussed herein, at least one ribonucleotide can be guanine. In embodiments, universal adapter nucleic acid sequences are present on all or substantially all nucleic acid molecules in the library.

[0065] In an embodiment, the sample solution comprises a double-stranded or single-stranded sample nucleic acid molecule, such as a double-stranded or single-stranded sample nucleic acid molecule from a WGS library, a WES library, an ATAC-seq library, a CHIP-seq library, a WTS library, a Bisulfite-seq library, an RNA-seq library, etc., which comprises a 3' modification configured to prevent or limit self-annealing and extension. In an embodiment, such a 3' modification includes a dideoxynucleotide (ddNTP), a reverse 3'dT, or a nucleotide sequence (e.g., adenine, thymine, or uracil) that reduces binding energy. In one embodiment, the starting sample solution comprises a double-stranded sample nucleic acid molecule, such as a WGS library, a WES library, an ATAC-seq library, a CHIP-seq library, a WTS library, a Bisulfite-seq library, an RNA-seq library, etc., which is generated by using a PCR primer containing a poly-T or poly-A overhang at the 5' end.

[0066] In embodiments, the universal adaptor nucleic acid sequence is added by PCR, transposition, reverse transcription, ligation, chemical synthesis, or other known methods of adding adaptors to DNA sequences, such as discussed further herein with respect to the kits of the invention.

[0067] In an embodiment, the universal adapter nucleic acid sequence includes a nucleic acid sequence adjacent to the 3' end or the 5' end that is configured not to bind to itself, such as in a hairpin configuration, thereby avoiding self-priming. In an embodiment, the universal adapter nucleic acid molecule comprises a poly-T sequence, a poly-A sequence, or a combination thereof. See, e.g. Figure 6 and 7 .

[0068] In embodiments, the nucleotides in the sample solution include ribonucleotides or deoxynucleotides. In embodiments, such nucleotides include nucleotides selected from locked nucleic acids, peptide nucleic acids, 2'-O-methyl RNA, 2'-O:-methoxyethyl RNA, thiophosphate-modified nucleic acids, and the like. Therefore, in embodiments, the degradation enzymes further discussed herein, such as RNase T1, are replaced by degradation enzymes capable of selectively cleaving modified ribonucleotides or deoxynucleotides in single-stranded conformations.

[0069] As above, in embodiments, the method comprises introducing into the sample solution one or more capture primer nucleic acid molecules that are complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules in a plurality of sample nucleic acid molecules. Figure 1B Schematically shows an embodiment of the present invention Figure 1A The sample solution further comprises a capture primer nucleic acid molecule c'.

[0070] As above, the capture primer nucleic acid molecule is complementary or partially complementary to the target nucleic acid sequence. In an embodiment, the capture primer nucleic acid molecule is partially complementary to the target nucleic acid sequence. In an embodiment, the capture primer nucleic acid molecule comprises a plurality of bases that are not complementary to the target nucleic acid sequence, for example, in the range of 1 to 5. In an embodiment, the capture primer nucleic acid molecule is greater than or equal to 90% complementary to the target nucleic acid sequence. However, such partially complementary capture primer nucleic acid molecules are configured to bind to the target nucleic acid sequence, for example, according to the annealing temperature and / or other reaction conditions described herein.

[0071] In embodiments, the method comprises maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules. Figure 1C Schematically shows the process of enriching and depleting nucleic acid molecules after unzipping according to an embodiment of the present invention. Figure 1B In an embodiment, the melting temperature is greater than or equal to 95°C. At the melting temperature of the plurality of sample nucleic acid molecules, the temperature of the sample solution is sufficient to completely or partially destroy the Watson-Crick bonds between the sample nucleic acid molecules, thereby increasing the number of single-stranded or partially single-stranded sample nucleic acids in the sample solution. As shown in the figure, such melting exposes the target nucleic acid sequences c and c* and the nucleic acid sequences d and d* to bind to other nucleic acid sequences such as the capture primer nucleic acid molecule c'.

[0072] In embodiments, the method comprises maintaining the sample solution near or below the annealing temperature of the capture primer nucleic acid molecule, the annealing temperature being suitable for annealing the capture primer nucleic acid molecule to the target nucleic acid sequence. Such annealing temperature is generally suitable for annealing at least a portion of the capture primer nucleic acid molecule to the target nucleic acid sequence. In embodiments, the annealing temperature is in the range of about 50°C to about 72°C. Figure 1DSchematically shows the process of annealing the capture primer nucleic acid molecule c' to the target sequence c* of the nucleic acid molecule to be enriched according to an embodiment of the present invention. Figure 1C In the illustrated embodiment, one of the capture primer nucleic acid molecules c' binds to a target nucleic acid sequence c* of the sample nucleic acid molecules to be enriched.

[0073] In embodiments, capture primer nucleic acid molecules are configured to be mainly single-stranded at an annealing temperature. In this respect, capture primer nucleic acid molecules are single-stranded at most times at an annealing temperature, and are therefore configured to be incorporated into a target nucleic acid sequence at most times. In embodiments, capture primer nucleic acid molecules are configured to be mainly at least partially double-stranded at an annealing temperature. In this respect, the configuration of capture primer nucleic acid molecules is suitable for not being incorporated into a target nucleic acid sequence at most times at an annealing temperature. Therefore, the combination of such double-stranded capture primer nucleic acid molecules with a target nucleic acid sequence has higher selectivity than single-stranded capture primer nucleic acid molecules generally.

[0074] In embodiments, the capture primer nucleic acid molecule also comprises a second capture primer nucleic acid molecule that is complementary or partially complementary to the first capture primer nucleic acid molecule. Such double-stranded capture primer nucleic acid molecules are usually double-stranded at the annealing temperature, and therefore, are less frequently configured to be bound to the target nucleic acid sequence. In this respect, such double-stranded capture primer nucleic acid molecules are configured to selectively be more highly bound to the target nucleic acid sequence.

[0075] In an embodiment, the capture primer nucleic acid molecule is complementary or partially complementary to a second target nucleic acid sequence of one or more second sample nucleic acid molecules in the plurality of sample nucleic acid molecules, wherein the second target nucleic acid sequence is different from the target nucleic acid sequence. In this regard, by maintaining the sample solution at or near the annealing temperature of the capture primer nucleic acid molecule, the capture primer nucleic acid molecule can be bound to each target nucleic acid sequence. Figure 1E and 1F As further discussed, sample nucleic acid molecules comprising respective target sequences that are complementary or partially complementary to capture primer nucleic acid molecules can be enzymatically extended and protected from degradation.

[0076] In embodiments, the capture primer nucleic acid molecule comprises a phosphorothioate bond. In embodiments, the phosphorothioate bond is disposed between a base at the 3' end of the capture primer nucleic acid molecule and a base immediately adjacent to the base at the 3' end. Such a phosphorothioate bond is configured to resist 3' exonuclease activity, such as those present in proofreading polymerases.

[0077] As above, the sample nucleic acid molecule comprises a universal adapter nucleic acid sequence. In an embodiment, the universal adapter nucleic acid sequence of a plurality of sample nucleic acid molecules comprises an adapter tag nucleic acid sequence. In an embodiment, the adapter tag nucleic acid sequence defines a unique nucleic acid sequence. Such a unique sequence can be used to determine the source of the sample nucleic acid molecule, such as the source of a cell, tissue or suspension, wherein such a unique nucleic acid sequence has a sequence different from another adapter tag nucleic acid sequence used to label sample nucleic acid molecules in other samples, such as other cells, tissues or cell suspensions.

[0078] Such adapter tag nucleic acid sequences are suitable for counting multiple nucleic acid molecules in a sample, for example, by sequencing a sample solution. In an embodiment, each adapter tag nucleic acid molecule comprises a number of degenerate bases suitable for counting amplified sample nucleic acid molecules after a nucleic acid amplification reaction.

[0079] In embodiments, the annealing temperature of the capture primer nucleic acid molecule and the second target nucleic acid sequence is relatively close to the annealing temperature of the capture primer nucleic acid molecule and the target nucleic acid sequence, thereby allowing at least some of the capture primer nucleic acid molecules to bind to the second target nucleic acid sequence by maintaining the sample solution at the annealing temperature of the capture primer nucleic acid molecule and the target nucleic acid sequence. Therefore, in embodiments, the capture primer nucleic acid molecule and the second target nucleic acid sequence have a second annealing temperature in the range of about 1°C to about 5°C of the annealing temperature.

[0080] In embodiments, the sample solution is maintained at a temperature close to, but not necessarily exactly at, the annealing temperature. In this regard, the binding specificity of the capture primer nucleic acid molecules varies, thereby allowing the capture primer nucleic acid molecules to bind to, for example, many target nucleic acid sequences having relatively similar sequences, and thus enriching many different sample nucleic acid molecules. Therefore, in embodiments, maintaining the sample solution near or below the annealing temperature of the capture primer nucleic acid molecules includes maintaining the sample solution at a temperature in the range of about 1°C to about 5°C of the annealing temperature of the capture primer nucleic acid molecules.

[0081] As above, in embodiments, the method of the present invention comprises enzymatically extending a capture primer nucleic acid molecule annealed to a target nucleic acid sequence of one or more sample nucleic acid molecules. In embodiments, enzymatically extending the capture primer nucleic acid molecule comprises introducing an extension enzyme into the sample solution, the extension enzyme being configured to extend the capture primer nucleic acid molecule annealed to the target nucleic acid sequence. Figure 1E Schematically shows the following steps after enzymatic extension of a capture primer nucleic acid molecule c' annealed to a target sequence c* according to an embodiment of the present invention. Figure 1DAs shown, the nucleic acid sequence annealed to the target nucleic acid sequence c* is shown to be extended to additionally bind to the universal adapter nucleic acid sequence b*. As further discussed herein, by binding to the universal adapter nucleic acid sequence, the extended capture primer nucleic acid molecule inhibits enzymatic degradation of the double-stranded sample nucleic acid molecule.

[0082] The extension enzyme may include any enzyme configured to enzymatically extend a capture primer nucleic acid molecule annealed to another nucleic acid molecule. In an embodiment, the extension enzyme is selected from a polymerase, a reverse transcriptase, and a combination thereof.

[0083] In embodiments, enzymatic extension of the capture primer nucleic acid molecule includes maintaining the sample solution near the extension temperature of the extension enzyme, and the extension temperature is suitable for enzymatic extension of the capture primer nucleic acid molecule annealed to the target nucleic acid sequence by the extension enzyme. Such an extension temperature can be the same as or different from the annealing temperature. In embodiments, the extension temperature is in the range of about 68°C to about 72°C.

[0084] The method of the present invention comprises enzymatically degrading specific nucleic acid molecules in a sample solution to provide an enriched sample solution having a higher proportion of sample nucleic acid molecules comprising a target nucleic acid sequence than the sample solution. In an embodiment, such enzymatic degradation comprises enzymatic degradation of single-stranded sample nucleic acid molecules. Figure 1D and 1E As discussed, the sample nucleic acid molecules comprising a nucleic acid sequence complementary or partially complementary to the capture primer nucleic acid molecule can generally be double-stranded. In this regard, by enzymatic degradation of single-stranded nucleic acid molecules, for example in conjunction with other steps, such as the step of amplifying complete sample nucleic acid molecules, the sample solution is enriched with such nucleic acid molecules comprising the target nucleic acid sequence.

[0085] In embodiments, enzymatic degradation of single-stranded sample nucleic acid molecules includes introducing a degradation enzyme into a sample solution, the degradation enzyme being configured to degrade single-stranded nucleic acid molecules comprising a universal adapter nucleic acid sequence. In embodiments, after enzymatic extension of the capture primer nucleic acid molecules, the degradation enzyme is introduced into the sample solution. In embodiments, wherein before enzymatic extension of the capture primer nucleic acid molecules, the degradation enzyme is introduced into the sample solution. In such embodiments, the degradation enzyme may be inactive at, for example, the extension temperature, and therefore, the single-stranded nucleic acid molecules are not degraded or substantially not degraded at the extension temperature. On the contrary, in embodiments, the degradation enzyme is active at a temperature lower than the extension temperature.

[0086] In embodiments, enzymatic degradation of single-stranded sample nucleic acid molecules comprises maintaining the temperature of the sample solution at a degradation temperature of the degradation enzyme. In embodiments, the degradation temperature is below the annealing temperature. In embodiments, the degradation temperature is below the extension temperature. In embodiments, the degradation temperature is less than or equal to about 60°C.

[0087] In embodiments, the degradation temperature is the active temperature of the degradation enzyme. Therefore, by keeping the sample solution at or near the degradation temperature, the degradation enzyme is active, such as active in degrading single-stranded nucleic acid molecules. In embodiments, the degradation enzyme is inactive at a temperature selected from an extension temperature, a melting temperature, an annealing temperature, and a combination thereof. In this regard, for example, before enzymatic extension of the capture primer nucleic acid molecules annealed with the target nucleic acid sequence, the degradation enzyme does not enzymatically degrade or does not enzymatically degrade the single-stranded nucleic acid molecules in the sample solution substantially.

[0088] In embodiments, the degradative enzyme is active at a degradation temperature after being inactive at a temperature above the degradation temperature, such as the extension temperature. In this regard, in embodiments, the degradative enzyme is configured to preferentially or selectively degrade sample nucleic acid molecules, such as single-stranded sample nucleic acid molecules, after being inactive at a temperature above the degradation temperature. Without wishing to be bound by theory, it is believed that the degradative enzyme is inactive above the active temperature, for example, when the degradative enzyme presents an inactive conformation, and when the degradative enzyme is in an active configuration when the temperature of the sample solution is maintained within the active range, the degradation further becomes active.

[0089] In embodiments, enzymatically degrading the single-stranded sample nucleic acid molecule comprises degrading a portion of a universal adaptor nucleic acid sequence disposed on the single-stranded sample nucleic acid molecule. Figure 1F Schematically shows the process of enzymatically degrading single-stranded sample nucleic acid molecules according to an embodiment of the present invention. Figure 1E In the illustrated embodiment, the degrading enzyme is shown to have enzymatically degraded a portion of the single-stranded nucleic acid molecule comprising the universal adapter sequence b*, which previously included the target portion of the universal adapter nucleic acid sequence (shown here as an oval). This is in contrast to the double-stranded sample nucleic acid, which comprises the target nucleic acid sequence c* and has been enzymatically extended by the extension enzyme. In this regard, the double-stranded sample nucleic acid is shown to have an intact universal adapter nucleic acid sequence b*.

[0090] In embodiments, the universal adapter nucleic acid sequence is completely single-stranded. In this regard, the universal adapter nucleic acid sequence does not base pair with other nucleic acid sequences, such as nucleic acid sequences on separate nucleic acid molecules. In embodiments, the universal adapter nucleic acid sequence is only partially single-stranded. In embodiments, the universal adapter nucleic acid sequence is single-stranded at one or more nucleotides that are configured to be enzymatically degraded by a degrading enzyme when single-stranded.

[0091] Enzymatic degradation of single-stranded sample nucleic acid molecules can include multiple forms of degradation, and the degradation forms are configured to, for example, render the degraded sample nucleic acid unsuitable for nucleic acid amplification reactions, such as those comprising universal adapter nucleic acid molecules. In embodiments, enzymatic degradation of single-stranded sample nucleic acid molecules includes cutting the backbone of the universal adapter nucleic acid molecules of the single-stranded sample nucleic acid molecules. In embodiments, enzymatic degradation of single-stranded sample nucleic acid molecules includes digesting portions of the universal adapter nucleic acid molecules of the single-stranded sample nucleic acid molecules.

[0092] As above, in embodiments, the degrading enzyme is configured to enzymatically degrade single-stranded nucleic acid molecules, such as single-stranded sample nucleic acid molecules. In embodiments, the degrading enzyme is a ribonuclease. In embodiments, the degrading enzyme is an endonuclease. In embodiments, the endonuclease is an endoribonuclease. In embodiments, the endoribonuclease is selected from RNase T1, RNase A and combinations thereof.

[0093] In an embodiment, the degrading enzyme is RNase T1. In an embodiment, the degrading enzyme corresponds to SEQ ID NO. 14. In an embodiment, the sequence homology of the degrading enzyme to SEQ ID NO. 14 is greater than 90%, greater than 95%, or greater than 99%. In an embodiment, the universal adapter nucleic acid sequence comprises a riboguanine. In an embodiment, the universal adapter nucleic acid sequence comprises a plurality of riboguanines. RNase T1 selectively degrades single-stranded riboguanines, and therefore, in the case where the universal adapter nucleic acid sequence comprises one or more riboguanines, the RNase T1 degrading enzyme is configured to degrade the universal adapter nucleic acid sequence, for example, when the sample solution is maintained at the active temperature of RNase T1.

[0094] In an embodiment, the degrading enzyme is RNase A. In an embodiment, the degrading enzyme corresponds to SEQ ID NO.15. In an embodiment, the sequence homology of the degrading enzyme to SEQ ID NO.15 is greater than 90%, greater than 95% or greater than 99%. In an embodiment, the universal adapter nucleic acid sequence comprises a base selected from ribocytosine, ribouracil and a combination thereof. In an embodiment, the universal adapter nucleic acid sequence comprises a plurality of ribocytosines, a plurality of ribouracils and a combination thereof. RNase A selectively degrades single-stranded ribocytosine and ribouracil (e.g., at a salt concentration greater than 300 mM), and therefore, in the case where the universal adapter nucleic acid sequence comprises one or more ribocytosines and / or ribouracils, the RNase A degrading enzyme is configured to degrade the universal adapter nucleic acid sequence, for example, when the sample solution is maintained at the active temperature of RNase A.

[0095] In an embodiment, the method of the present invention comprises repeated enzymatic extension of capture primer nucleic acid molecules and enzymatic degradation of single-stranded sample nucleic acid molecules. By repeating enzymatic extension and enzymatic degradation, the extension enzyme, capture primer nucleic acid molecules and degradation enzyme can be used additionally one or more times to selectively degrade sample nucleic acid molecules that do not contain the target nucleic acid sequence. As above, in an embodiment, such degradation comprises degradation of universal adapter nucleic acid sequences, which can be subsequently used in nucleic acid amplification reactions. As described herein with respect to Fig. 1I and 1J As further discussed, sequences containing the entire universal adaptor nucleic acid sequence are preferentially enriched.

[0096] In an embodiment, the method further comprises maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecules, e.g., after enzymatically extending the capture primer nucleic acid molecules and enzymatically degrading the single-stranded sample nucleic acid molecules. In this regard, the sample solution comprising the sample nucleic acid molecules having enzymatically degraded or intact universal adapter nucleic acid sequences is single-stranded and is therefore configured for further enzymatic extension and degradation. Figure 1G Schematically shows an embodiment according to the present invention, Figure 1F The nucleic acid molecules in the sample solution are melted.

[0097] In embodiments, methods of the invention include purifying a plurality of sample nucleic acid molecules in an enriched sample solution. Figure 1H Schematically shows the process of removing the capture primer nucleic acid molecules according to an embodiment of the present invention. Figure 1G Such purification may include, for example, purification with SPRI beads or the like. In an embodiment, purifying the plurality of sample nucleic acid molecules in the enriched sample solution comprises removing a reagent selected from the group consisting of capture primer nucleic acid molecules, enzymes, and combinations thereof from the enriched sample solution. Such purification of the sample solution may, for example, simplify sequencing data based on the sample solution by reducing the number of nucleic acid molecules present in the sample solution, thereby reducing the amount of sequencing data based on the sample solution, in particular reducing the amount of sequencing data not related to the target nucleic acid sequence.

[0098] In embodiments, the methods of the invention include amplifying sample nucleic acid molecules after enzymatic degradation of single-stranded nucleic acid molecules. Thus, in embodiments, the methods include introducing a plurality of amplification primer nucleic acid molecules into the enriched sample solution. In embodiments, the amplification primer nucleic acid molecules in the plurality of amplification primer nucleic acid molecules are complementary to a universal adapter nucleic acid sequence. Fig. 1I Schematically shows Figure 1H The sample solution further comprises polymerase chain reaction (PCR) primers a* and b. As shown in the figure, according to an embodiment of the present invention, the PCR primers are complementary to the universal adapter sequences a* and b of the sample nucleic acid molecules in the sample solution.

[0099] In an embodiment, the method includes performing a nucleic acid amplification reaction on a plurality of sample nucleic acid molecules in the enriched sample solution using a plurality of amplification primer nucleic acid molecules to provide an amplified enriched sample solution. Figure 1J Schematically shows the steps of amplifying the sample nucleic acid molecules in the sample solution by PCR according to an embodiment of the present invention. Fig. 1I As shown in the figure, the sample solution contains a greater proportion of sample nucleic acid molecules containing target sequences c and c* than sample nucleic acid molecules containing nucleic acid sequences d and d*.

[0100] As discussed above and Figure 1J As shown in , because at least some of the universal adapter nucleic acid sequences of the sample nucleic acid molecules are degraded, these degraded sample nucleic acid molecules will not participate in the nucleic acid amplification reaction, and thus the amplified enriched sample solution will contain a lower proportion of such sample nucleic acid molecules. In this regard, in an embodiment, performing a nucleic acid amplification reaction on a plurality of sample nucleic acid molecules in the enriched sample solution does not amplify or substantially does not amplify sample nucleic acid molecules that have been degraded by a degrading enzyme.

[0101] In embodiments, the method comprises performing one or more enzymatic reactions on the amplified enriched sample in solution to prepare an enriched sample solution for sequencing, such as next generation sample preparation. Thus, in embodiments, the method of the invention comprises performing a reaction on the amplified enriched sample solution, the reaction being selected from nucleic acid fragmentation reaction, enzymatic end repair, A-tailing, adapter ligation, polymerase chain reaction, and combinations thereof.

[0102] In an embodiment, the method of the present invention includes sequencing the nucleic acid molecules in the enriched sample solution. In an embodiment, sequencing the nucleic acid molecules in the enriched sample solution includes generating sample nucleic acid information based on the multiple sample nucleic acid molecules in the enriched sample solution. As above, in certain embodiments, the universal adapter nucleic acid molecule includes an adapter tag nucleic acid molecule. In an embodiment, sequencing the nucleic acid molecules in the enriched sample solution includes generating adapter tag nucleic acid sequence information based on the adapter tag nucleic acid sequence.

[0103] Consumption method

[0104] In an embodiment, the present invention provides a method for depleting a target nucleic acid sequence. In an embodiment, the method comprises (a) introducing a capture primer nucleic acid molecule complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules in the multiple sample nucleic acid molecules into a sample solution comprising a plurality of sample nucleic acid molecules, each of the sample nucleic acid molecules comprising a universal adapter nucleic acid sequence, the universal adapter nucleic acid sequence comprising ribonucleotides; (b) enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) enzymatically cleaving the double-stranded ribonucleic acid molecules of the sample nucleic acid molecules to provide a sample solution depleted of sample nucleic acid molecules having a lower proportion of sample nucleic acid molecules comprising the target nucleic acid sequence than the sample solution.

[0105] A method for depleting a target nucleic acid sequence according to an embodiment of the present invention will now be described. In this regard, attention is directed to Figures 2A-2J , which schematically illustrates a method for depleting a target nucleic acid sequence according to an embodiment of the present invention.

[0106] Figure 2A A sample solution is schematically shown, the sample solution comprising nucleic acid molecules to be enriched and nucleic acid molecules to be consumed. As shown in the figure, the sample solution comprises a starting library of nucleic acid molecules, the starting library of nucleic acid molecules comprising double-stranded nucleic acid molecules for enrichment and double-stranded nucleic acid molecules for consumption. The double-stranded nucleic acid molecules for enrichment are shown to contain universal adapter nucleic acid sequences a, a*, b and b*, and target nucleic acid sequences c and c*. The double-stranded nucleic acid molecules for consumption are shown to contain universal adapter nucleic acid sequences a, a*, b and b*, and target nucleic acid sequences d and d* that are different from nucleic acid sequences c and c*. The universal adapter nucleic acid sequences a, a*, b and b* on both the sample nucleic acid molecules for enrichment and for consumption are shown to contain common features, schematically shown here as ellipses. As described herein Figure 2F As discussed further, such common features lend themselves to enzymatic degradation under certain conditions, such as when the universal adaptor nucleic acid sequence is double-stranded.

[0107] The method of the present invention is suitable for enriching many sample solutions comprising nucleic acid molecules. In embodiments, the sample solution is selected from WGS library, WES library, ATAC-seq library, ChIP-seq library, WTS library, Bisulfite-seq library, RNA-seq library, single cell RNA-seq library, DNA data storage library or any other library with universal adapters at both ends. The mixture of DNA molecules can be pre-amplified or unamplified, enzymatically produced or chemically synthesized. Universal adapters (domain a and domain b*) can include DNA and / or RNA nucleotides. As further discussed herein, at least one ribonucleotide can be guanine. In embodiments, universal adapter nucleic acid sequences are present on all or substantially all nucleic acid molecules in the library.

[0108] In an embodiment, the sample solution comprises a double-stranded or single-stranded sample nucleic acid molecule, such as a double-stranded or single-stranded sample nucleic acid molecule from a WGS library, a WES library, an ATAC-seq library, a CHIP-seq library, a WTS library, a Bisulfite-seq library, an RNA-seq library, etc., which comprises a 3' modification configured to prevent or limit self-annealing and extension. In an embodiment, such a 3' modification includes a dideoxynucleotide (ddNTP), a reverse 3'dT, or a nucleotide sequence (e.g., adenine, thymine, or uracil) that reduces binding energy. In one embodiment, the starting sample solution comprises a double-stranded sample nucleic acid molecule, such as a WGS library, a WES library, an ATAC-seq library, a CHIP-seq library, a WTS library, a Bisulfite-seq library, an RNA-seq library, etc., which is generated by using a PCR primer containing a poly-T or poly-A overhang at the 5' end.

[0109] In embodiments, the universal adaptor nucleic acid sequence is added by PCR, transposition, reverse transcription, ligation, chemical synthesis, or other known methods of adding adaptors to DNA sequences, such as discussed further herein with respect to the kits of the invention.

[0110] In an embodiment, the universal adapter nucleic acid sequence includes a nucleic acid sequence adjacent to the 3' end or the 5' end that is configured not to bind to itself, such as in a hairpin configuration, thereby avoiding self-priming. In an embodiment, the universal adapter nucleic acid molecule comprises a poly-T sequence, a poly-A sequence, or a combination thereof. See, e.g. Figure 6 and 7 .

[0111] In embodiments, the nucleotides in the sample solution include ribonucleotides or deoxynucleotides. In embodiments, such nucleotides include nucleotides selected from locked nucleic acids, peptide nucleic acids, 2'-O-methyl RNA, 2'-O:-methoxyethyl RNA, thiophosphate-modified nucleic acids, etc. Therefore, in embodiments, a degradative enzyme, such as RNase HII, is replaced by a degradative enzyme that is configured to selectively cut a modified ribonucleotide or deoxynucleotide of a double-stranded conformation. In embodiments, the sample nucleic acid molecule includes methylated DNA, and the degradative enzyme includes a restriction enzyme that specifically cuts methylated (or hemimethylated) double-stranded DNA.

[0112] As described above, in embodiments, the method includes introducing into the sample solution one or more capture primer nucleic acid molecules that are complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules in a plurality of sample nucleic acid molecules. Figure 2B Schematically shows an embodiment of the present invention Figure 2A The sample solution further comprises capture primer nucleic acid molecules d'1 and d'2*. As shown in the figure, the capture primer nucleic acid molecules d'1 and d'2* are complementary or partially complementary to the target nucleic acid sequences d* and d on the sample nucleic acid molecules for depletion, but not complementary or partially complementary to the target nucleic acid sequences d* and d on the sample nucleic acid molecules for enrichment.

[0113] In an embodiment, the capture primer nucleic acid molecule is complementary or partially complementary to the target nucleic acid sequence. In an embodiment, the capture primer nucleic acid molecule is partially complementary to the universal adapter nucleic acid sequence. In an embodiment, the capture primer nucleic acid molecule comprises a number of bases that are not complementary to the universal adapter nucleic acid sequence, for example in the range of 1 to 5. In an embodiment, the capture primer nucleic acid molecule is greater than or equal to 90% complementary to the universal adapter sequence. However, such partially complementary capture primer nucleic acid molecules are configured to bind to the target nucleic acid sequence, for example according to the annealing temperature and / or other reaction conditions described herein.

[0114] In embodiments, the method comprises maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules. Figure 2C Schematically shows the steps of: Figure 2B In an embodiment, the melting temperature is greater than or equal to 95°C. At the melting temperature of the plurality of sample nucleic acid molecules, the temperature of the sample solution is sufficient to completely or partially destroy the Watson-Crick bonds between the sample nucleic acid molecules, thereby increasing the number of single-stranded or partially single-stranded sample nucleic acids in the sample solution. As shown in the figure, such melting exposes the target nucleic acid sequences d and d* and the nucleic acid sequences c and c* to bind to other nucleic acid sequences such as the capture primer nucleic acid molecules d'1 and d'2*.

[0115] In embodiments, the method includes maintaining the sample solution near or below the annealing temperature of the capture primer nucleic acid molecule, wherein the annealing temperature is suitable for annealing the capture primer nucleic acid molecule to the target nucleic acid sequence. Such an annealing temperature is generally suitable for annealing at least a portion of the capture primer nucleic acid molecule to the target nucleic acid sequence. In embodiments, the annealing temperature is in the range of about 50°C to about 72°C. Figure 2D Schematically shows the process of annealing capture primer nucleic acid molecules d'1 and d'2* to target sequences d* and d' of sample nucleic acid molecules to be consumed according to an embodiment of the present invention. Figure 2C In the illustrated embodiment, capture primer nucleic acid molecules d'1 and d'2* bind to target nucleic acid sequences d* and d of the sample nucleic acid molecules to be consumed.

[0116] In embodiments, capture primer nucleic acid molecules are configured to be mainly single-stranded at an annealing temperature. In this respect, capture primer nucleic acid molecules are single-stranded at most times at an annealing temperature, and are therefore configured to be incorporated into a target nucleic acid sequence at most times. In embodiments, capture primer nucleic acid molecules are configured to be mainly at least partially double-stranded at an annealing temperature. In this respect, the configuration of capture primer nucleic acid molecules is suitable for not being incorporated into a target nucleic acid sequence at most times at an annealing temperature. Therefore, the combination of such double-stranded capture primer nucleic acid molecules with a target nucleic acid sequence has higher selectivity than single-stranded capture primer nucleic acid molecules generally.

[0117] In embodiments, the capture primer nucleic acid molecule also comprises a second capture primer nucleic acid molecule that is complementary or partially complementary to the first capture primer nucleic acid molecule. Such double-stranded capture primer nucleic acid molecules are usually double-stranded at the annealing temperature, and therefore, are less configured to be bound to the target nucleic acid sequence. In this respect, such double-stranded capture primer nucleic acid molecules are configured to selectively be more highly bound to the target nucleic acid sequence.

[0118] In an embodiment, the capture primer nucleic acid molecule is complementary or partially complementary to a second target nucleic acid sequence of one or more second sample nucleic acid molecules in the plurality of sample nucleic acid molecules, wherein the second target nucleic acid sequence is different from the target nucleic acid sequence. In this regard, by maintaining the sample solution at or near the annealing temperature of the capture primer nucleic acid molecule, the capture primer nucleic acid molecule can be bound to various target nucleic acid sequences. Figure 2E and 2F As further discussed, sample nucleic acid molecules comprising various target sequences that are complementary or partially complementary to capture primer nucleic acid molecules can be enzymatically extended and labeled for degradation.

[0119] In embodiments, the capture primer nucleic acid molecule comprises a phosphorothioate bond. In embodiments, the phosphorothioate bond is disposed between a base at the 3' end of the capture primer nucleic acid molecule and a base immediately adjacent to the base at the 3' end. Such a phosphorothioate bond is configured to resist 3' exonuclease activity, such as those present in proofreading polymerases.

[0120] As above, the sample nucleic acid molecule comprises a universal adapter nucleic acid sequence. In an embodiment, the universal adapter nucleic acid sequence of a plurality of sample nucleic acid molecules comprises an adapter tag nucleic acid sequence. In an embodiment, the adapter tag nucleic acid sequence defines a unique nucleic acid sequence. Such a unique sequence can be used to determine the source of the sample nucleic acid molecule, such as the source of a cell, tissue or suspension, wherein such a unique nucleic acid sequence has a sequence different from another adapter tag nucleic acid sequence used to label sample nucleic acid molecules in other samples, such as other cells, tissues or cell suspensions.

[0121] Such adapter tag nucleic acid sequences are suitable for counting multiple nucleic acid molecules in a sample, for example, by sequencing a sample solution. In an embodiment, each adapter tag nucleic acid molecule comprises a number of degenerate bases suitable for counting amplified sample nucleic acid molecules after a nucleic acid amplification reaction.

[0122] In embodiments, the annealing temperature of the capture primer nucleic acid molecule and the second target nucleic acid sequence is relatively close to the annealing temperature of the capture primer nucleic acid molecule and the target nucleic acid sequence, thereby allowing at least some of the capture primer nucleic acid molecules to bind to the second target nucleic acid sequence by maintaining the sample solution at the annealing temperature of the capture primer nucleic acid molecule and the target nucleic acid sequence. Therefore, in embodiments, the capture primer nucleic acid molecule and the second target nucleic acid sequence have a second annealing temperature in the range of about 1°C to about 5°C of the annealing temperature.

[0123] In embodiments, the sample solution is maintained at a temperature close to, but not necessarily exactly at, the annealing temperature. In this regard, the binding specificity of the capture primer nucleic acid molecules varies, allowing the capture primer nucleic acid molecules to bind to, for example, many target nucleic acid sequences having relatively similar sequences, and thus consuming many different sample nucleic acid molecules. Therefore, in embodiments, maintaining the sample solution near or below the annealing temperature of the capture primer nucleic acid molecules includes maintaining the sample solution at a temperature in the range of about 1°C to about 5°C of the annealing temperature of the capture primer nucleic acid molecules.

[0124] As described above, in embodiments, the method includes enzymatically extending a capture primer nucleic acid molecule that anneals to a target nucleic acid sequence of one or more sample nucleic acid molecules. Figure 2E Schematically illustrates the following steps after enzymatic extension of capture primer nucleic acid molecules d'1 and d'2* annealed to target sequences d* and d Figure 2DAs shown, capture primer nucleic acid molecules d'1 and d'2* anneal to target sequences d* and d on the sample nucleic acid molecules to be consumed. As also shown, the nucleic acid sequences annealed to the target nucleic acid sequences d and d* are shown to be extended to additionally bind to universal adapter nucleic acid sequences a and b*. As further discussed herein, by binding to the universal adapter nucleic acid sequences a and b*, the extended capture primer nucleic acid molecules activate enzymatic degradation of the double-stranded sample nucleic acid molecules.

[0125] The extension enzyme may include any enzyme configured to enzymatically extend a capture primer nucleic acid molecule annealed to another nucleic acid molecule. In an embodiment, the extension enzyme is selected from a polymerase, a reverse transcriptase, and a combination thereof.

[0126] In embodiments, enzymatic extension of the capture primer nucleic acid molecule comprises maintaining the sample solution near the extension temperature of the extension enzyme, wherein the extension temperature is suitable for enzymatic extension of the capture primer nucleic acid molecule annealed to the target nucleic acid sequence by the extension enzyme. Such an extension temperature may be the same as or different from the annealing temperature. In embodiments, the annealing temperature is in the range of about 50°C to about 72°C.

[0127] As above, the method of this embodiment includes enzymatically cleaving the double-stranded ribonucleic acid molecules of the sample nucleic acid molecules. Figure 2F Schematically shows the process of enzymatically degrading a double-stranded nucleic acid molecule according to an embodiment of the present invention. Figure 2E In the illustrated embodiment, the universal adapter nucleic acid sequences a and b* that bind to the enzymatically extended capture primer nucleic acid molecules are degraded. In this regard, the oval shape of the capture primer nucleic acid molecules is shown to be degraded. Figure 2F As further discussed, such degradation can include cleaving or degrading the backbone of the universal adaptor nucleic acid sequence of the double-stranded sample nucleic acid molecule.

[0128] In the illustrated embodiment, the degrading enzyme is shown to have enzymatically degraded a portion of a double-stranded nucleic acid molecule comprising universal adapter sequences a and b*, including the target portion of the universal adapter nucleic acid sequence (shown here as an oval). Sample nucleic acid molecules comprising target nucleic acid sequences d and d* have enzymatically degraded universal adapter sequences a and b*. This is in contrast to single-stranded sample nucleic acids comprising nucleic acid sequences c and c*, which have complete universal adapter sequences. In this regard, single-stranded sample nucleic acids are shown to have complete universal adapter nucleic acid sequences.

[0129] The enzymatic degradation of double-stranded sample nucleic acid molecules can include multiple forms of degradation, and the degradation forms are configured to, for example, make the degraded sample nucleic acid unsuitable for nucleic acid amplification reactions, such as those comprising universal adapter nucleic acid molecules. In an embodiment, enzymatic degradation of double-stranded sample nucleic acid molecules includes cutting the backbone of the universal adapter nucleic acid molecules of the double-stranded sample nucleic acid molecules. In an embodiment, enzymatic degradation of double-stranded sample nucleic acid molecules includes degrading portions of universal adapter nucleic acid sequences disposed on the double-stranded sample nucleic acid molecules. In an embodiment, enzymatic cleavage of double-stranded sample nucleic acid molecules includes cutting the backbone of the universal adapter nucleic acid sequences of the double-stranded sample nucleic acid molecules. In an embodiment, enzymatic cleavage of double-stranded sample nucleic acid molecules includes digesting portions of the universal adapter nucleic acid sequences of the double-stranded sample nucleic acid molecules.

[0130] In embodiments, enzymatic degradation of double-stranded sample nucleic acid molecules comprises maintaining the temperature of the sample solution at a degradation temperature of the degradation enzyme. In embodiments, the degradation temperature is below the annealing temperature. In embodiments, the degradation temperature is below the extension temperature. In embodiments, the degradation temperature is less than or equal to about 60°C.

[0131] In embodiments, the degradation temperature is the active temperature of the degradation enzyme. Therefore, by keeping the sample solution at or near the degradation temperature, the degradation enzyme is active, such as active in degrading double-stranded nucleic acid molecules. In embodiments, the degradation enzyme is inactive at a temperature selected from an extension temperature, a melting temperature, an annealing temperature, and a combination thereof. In this regard, for example, before enzymatic extension of the capture primer nucleic acid molecules annealed with the target nucleic acid sequence, the degradation enzyme does not enzymatically degrade or does not enzymatically degrade the double-stranded nucleic acid molecules in the sample solution substantially.

[0132] In embodiments, the degradative enzyme is active at a degradation temperature after being inactive at a temperature above the degradation temperature, such as the extension temperature. In this regard, in embodiments, the degradative enzyme is configured to preferentially or selectively degrade sample nucleic acid molecules, such as double-stranded sample nucleic acid molecules, after being inactive at a temperature above the degradation temperature. Without wishing to be bound by theory, it is believed that the degradative enzyme is inactive above the active temperature, for example when the degradative enzyme presents an inactive conformation, and when the degradative enzyme is in an active configuration when the temperature of the sample solution is maintained within the active range, the degradation further becomes active.

[0133] As above, in embodiments, the degrading enzyme is configured to enzymatically degrade double-stranded nucleic acid molecules, such as double-stranded sample nucleic acid molecules. In embodiments, the degrading enzyme is not a restriction endonuclease. In embodiments, the degrading enzyme is a ribonuclease. In embodiments, the degrading enzyme is an endonuclease. In embodiments, the endonuclease is an endoribonuclease. In embodiments, the endoribonuclease is selected from RNase HII, RNase H, RNase III and combinations thereof.

[0134] In an embodiment, the degrading enzyme is RNase HII. In an embodiment, the degrading enzyme corresponds to SEQ ID NO. 16. In an embodiment, the sequence homology of the degrading enzyme to SEQ ID NO. 16 is greater than 90%, greater than 95% or greater than 99%.

[0135] In an embodiment, the degrading enzyme is RNase H. In an embodiment, the degrading enzyme corresponds to SEQ ID NO. 17. In an embodiment, the sequence homology of the degrading enzyme to SEQ ID NO. 17 is greater than 90%, greater than 95%, or greater than 99%.

[0136] In an embodiment, the degrading enzyme is RNase III. In an embodiment, the degrading enzyme corresponds to SEQ ID NO. 18. In an embodiment, the sequence homology of the degrading enzyme to SEQ ID NO. 18 is greater than 90%, greater than 95% or greater than 99%.

[0137] In an embodiment, the method of the present invention includes repeated enzymatic extension of capture primer nucleic acid molecules and enzymatic degradation of double-stranded sample nucleic acid molecules. By repeating enzymatic extension and enzymatic degradation, the extension enzyme, capture primer nucleic acid molecules and degradation enzyme can be used additionally one or more times to selectively degrade sample nucleic acid molecules that do not contain target nucleic acid sequences, such as target sequences d and d*. As above, in an embodiment, such degradation includes degradation of universal adapter nucleic acid sequences, which can be subsequently used in nucleic acid amplification reactions. As described herein with respect to Fig.2I and 2J As further discussed, nucleic acid sequences containing an intact universal adaptor nucleic acid sequence are preferentially enriched. Thus, by enzymatically degrading additional sample nucleic acid sequences having a target nucleic acid sequence, sample nucleic acid molecules not having a target nucleic acid sequence are configured not to participate in such selective or preferential enrichment.

[0138] In embodiments, the method further comprises maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecules, e.g., after enzymatically extending the capture primer nucleic acid molecules and enzymatically degrading the double-stranded sample nucleic acid molecules. In this regard, the sample solution comprising the sample nucleic acid molecules having enzymatically degraded or intact universal adapter nucleic acid sequences is single-stranded and is therefore configured for subsequent binding to the capture primer nucleic acid molecules. Figure 2G Schematically shows an embodiment according to the present invention, Figure 2F The nucleic acid molecules in the sample solution are melted.

[0139] In embodiments, methods of the invention include purifying a plurality of sample nucleic acid molecules in a spent sample solution. Figure 2H Schematically shows the removal of capture primer nucleic acid molecules d'1 and d'2* according to an embodiment of the present invention. Figure 2G Such purification may include, for example, purification with SPRI beads or the like. In embodiments, purifying the plurality of sample nucleic acid molecules in the consumed sample solution includes removing a reagent selected from the group consisting of capture primer nucleic acid molecules, enzymes, and combinations thereof from the consumed sample solution. Such purification of the sample solution may, for example, simplify sequencing data based on the sample solution by reducing the number of nucleic acid molecules present in the sample solution, thereby reducing the amount of sequencing data based on the sample solution, in particular reducing the amount of sequencing data not related to the target nucleic acid sequence.

[0140] In embodiments, the method of the invention comprises amplifying a sample nucleic acid molecule after enzymatic degradation of a double-stranded nucleic acid molecule. Thus, in embodiments, the method comprises introducing a plurality of amplification primer nucleic acid molecules into the consumed sample solution. In embodiments, an amplification primer nucleic acid molecule in the plurality of amplification primer nucleic acid molecules is complementary to a universal adapter nucleic acid sequence. Fig.2I Schematically shows Figure 2H The sample solution further comprises polymerase chain reaction (PCR) primers a and b*. As shown in the figure, according to an embodiment of the present invention, the PCR primers are complementary to the universal adapter sequences a* and b of the nucleic acid molecules in the sample solution.

[0141] In embodiments, the method includes performing a nucleic acid amplification reaction on a plurality of sample nucleic acid molecules in a spent sample solution using a plurality of amplification primer nucleic acid molecules to provide an amplified spent sample solution. Figure 2J Schematically shows the steps of amplifying the nucleic acid molecules in a sample solution by PCR according to an embodiment of the present invention. Fig.2I As shown in the figure, the sample solution contains a greater proportion of sample nucleic acid molecules containing nucleic acid sequences c and c* than sample nucleic acid molecules containing target nucleic acid sequences d and d*.

[0142] As discussed above and Figure 2J As shown in , because at least some of the universal adapter nucleic acid sequences of the sample nucleic acid molecules are degraded, these degraded sample nucleic acid molecules will not participate in the nucleic acid amplification reaction, and thus the amplified consumed sample solution will contain a lower proportion of such sample nucleic acid molecules. In this regard, in embodiments, performing a nucleic acid amplification reaction on a plurality of sample nucleic acid molecules in the consumed sample solution does not amplify or substantially does not amplify sample nucleic acid molecules that have been degraded by the degrading enzyme. Therefore, Figure 2A Compared to the original sample solution shown, the amplified consumed sample solution contains a greater proportion of nucleic acid molecules comprising sequence c or c* than nucleic acid molecules comprising sequence d or d*.

[0143] In embodiments, the method comprises performing one or more enzymatic reactions on the amplified consumed sample in solution to prepare a consumed sample solution for sequencing, such as next generation sample preparation. Thus, in embodiments, the method of the invention comprises performing a reaction on the amplified consumed sample solution selected from the group consisting of nucleic acid fragmentation reaction, enzymatic end repair, A-tailing, adapter ligation, polymerase chain reaction, and combinations thereof.

[0144] In embodiments, the methods of the present invention include sequencing the nucleic acid molecules in the consumed sample solution. In embodiments, sequencing the nucleic acid molecules in the consumed sample solution includes generating sample nucleic acid information based on a plurality of sample nucleic acid molecules in the consumed sample solution. As above, in certain embodiments, the universal adapter nucleic acid molecule comprises an adapter tag nucleic acid molecule. In embodiments, sequencing the nucleic acid molecules in the consumed sample solution includes generating adapter tag nucleic acid sequence information based on the adapter tag nucleic acid sequence.

[0145] In an embodiment, the capture primer nucleic acid molecule is a blocked capture primer nucleic acid molecule. In this regard, attention is turned to Figures 3A-3J , in which a method according to an embodiment of the present invention is shown. Figures 3A-3D Similar to that described elsewhere in this paper Figures 1A-1D , except that the capture primer nucleic acid molecule includes a capture primer nucleic acid molecule d', which is a closed capture primer nucleic acid molecule. In this regard, in an embodiment, the closed capture primer nucleic acid molecule d' is configured to block the enzymatic extension of the closed capture primer nucleic acid molecule d' by an extension enzyme at the 3' end. As shown in the figure, the sample solution also includes a non-closed capture primer nucleic acid molecule a.

[0146] In embodiments, the blocked capture primer nucleic acid molecule comprises a reverse nucleic acid. In embodiments, the blocked capture primer nucleic acid molecule comprises one or more overhanging adenine or thymine at the 3' end.

[0147] like Figure 3EAs shown, in the enzymatic extension in which the closed capture primer nucleic acid molecule anneals to the target nucleic acid sequence d*, the extension enzyme cannot extend beyond the closed capture primer nucleic acid molecule, while on other sample nucleic acid molecules, the extension enzyme has successfully extended across the entire molecule that does not contain the target nucleic acid sequence d*, such as the sample nucleic acid molecule used for enrichment.

[0148] like Figure 3F As shown, the degrading enzyme has enzymatically degraded the single-stranded universal adapter molecule of the sample nucleic acid to be consumed. In this regard, due to the subsequent denaturation of the sample solution ( Figure 3G ),purification( Figure 3H ) and amplification ( Fig. 3I and 3J ), molecules containing the target nucleic acid sequence d* are consumed, and the sample solution shows a higher proportion of sample nucleic acid molecules having sequences c and c* compared to sample nucleic acid molecules having target nucleic acid sequences d and d*. Therefore, sample nucleic acid molecules having the target nucleic acid sequence in the sample solution are consumed.

[0149] According to an embodiment of the present invention, although the closed capture primer nucleic acid molecules are shown to consume sample nucleic acid molecules together with a degradation enzyme configured to degrade single-stranded nucleic acid molecules, the closed capture primer nucleic acid molecules can be used in combination with a degradation enzyme configured to degrade double-stranded sample nucleic acid molecules to enrich sample nucleic acid molecules having a target nucleic acid sequence complementary to the closed capture primer nucleic acid molecules.

[0150] Reagent test kit

[0151] On the other hand, the present invention provides a kit comprising reagents for enriching and / or depleting target nucleic acid sequences, such as target nucleic acid sequences present in a complex sample solution, wherein the complex sample solution contains nucleic acid molecules that do not contain the target nucleic acid sequence.

[0152] Enrichment kit

[0153] In an embodiment, the present invention provides a kit for enriching sample nucleic acid molecules comprising a target nucleic acid sequence. In an embodiment, the kit comprises a capture primer nucleic acid molecule complementary or partially complementary to the target sequence; and a degradation enzyme configured to degrade single-stranded nucleic acid molecules.

[0154] As above, the test kit comprises a capture primer nucleic acid molecule. In embodiments, the capture primer nucleic acid molecule is fully complementary to the target nucleic acid sequence. In embodiments, the capture primer nucleic acid molecule is partially complementary to one or more target nucleic acid molecules. As further discussed herein, the capture primer nucleic acid molecule can be at least partially complementary to many target nucleic acid sequences, and therefore, according to the reaction conditions adopted by the test kit of the present invention, the test kit of the present invention is configured to enrich the sample nucleic acid molecules with many different target nucleic acid sequences.

[0155] As this article about Figure 1D As further discussed, the capture primer nucleic acid molecule can be single-stranded, at least partially double-stranded, or double-stranded, for example at the annealing temperature between the capture primer nucleic acid molecule and its target nucleic acid sequence.

[0156] In embodiments, the capture primer nucleic acid molecule comprises a phosphorothioate bond. In embodiments, the phosphorothioate bond is disposed between a base at the 3' end of the capture primer nucleic acid molecule and a base immediately adjacent to the base at the 3' end. Such a phosphorothioate bond is configured to resist 3' exonuclease activity, such as those present in proofreading polymerases.

[0157] In embodiments, the kit further comprises a plurality of universal adapter nucleic acid molecules configured to be coupled to sample nucleic acid molecules.As further discussed herein with respect to the methods of the invention, the universal adapter nucleic acid molecules are suitable for use in nucleic acid amplification reactions.

[0158] In embodiments, the universal adapter nucleic acid molecule comprises riboguanine, e.g., wherein the degrading enzyme is RNase T1. In embodiments, the universal adapter nucleic acid molecule comprises ribocytosine, ribouracil, or a combination thereof, e.g., wherein the degrading enzyme is RNase A.

[0159] In embodiments, the universal adaptor nucleic acid molecule comprises a nucleic acid sequence adjacent to the 3' end or the 5' end that is configured not to bind to itself, such as in a hairpin configuration, thereby avoiding self-priming. In embodiments, the universal adaptor nucleic acid molecule comprises a poly-T sequence, a poly-A sequence, or a combination thereof.

[0160] In an embodiment, the kit further comprises a reagent for coupling the universal adapter nucleic acid molecule to the sample nucleic acid molecule. In an embodiment, the kit comprises a reagent selected from the following: a transposase loaded with an oligonucleotide comprising a universal adapter nucleic acid molecule; a restriction endonuclease; an oligonucleotide or oligonucleotide complex comprising a universal adapter nucleic acid molecule; an oligonucleotide or oligonucleotide complex comprising a T7 promoter; an antibody or antibody fragment against a transcription factor; and a combination thereof.

[0161] The kit of the present embodiment comprises a degradation enzyme. In the embodiment, the degradation enzyme is configured to degrade a single-stranded nucleic acid molecule. In the embodiment, the degradation enzyme is configured to degrade a single-stranded nucleic acid molecule comprising a universal adapter nucleic acid molecule. In the embodiment, the degradation enzyme is a ribonuclease. In the embodiment, the degradation enzyme is an endonuclease. In the embodiment, the endonuclease is an endoribonuclease. In the embodiment, the endoribonuclease is selected from RNase T1, RNase A and a combination thereof.

[0162] In an embodiment, the degrading enzyme is RNase T1. In an embodiment, the degrading enzyme corresponds to SEQ ID NO. 14. In an embodiment, the degradation is greater than 90%, greater than 95%, or greater than 99% homology to SEQ ID NO. 14. In an embodiment, the universal adapter nucleic acid sequence comprises a riboguanine. In an embodiment, the universal adapter nucleic acid sequence comprises a plurality of riboguanines. RNase T1 selectively degrades single-stranded riboguanines, and therefore, in the case where the universal adapter nucleic acid sequence comprises one or more riboguanines, the RNase T1 degrading enzyme is configured to degrade the universal adapter nucleic acid sequence, for example, when the sample solution is maintained at the active temperature of RNase T1.

[0163] In an embodiment, the degrading enzyme is RNase A. In an embodiment, the degrading enzyme corresponds to SEQ ID NO.15. In an embodiment, the sequence homology of the degrading enzyme to SEQ ID NO.15 is greater than 90%, greater than 95% or greater than 99%. In an embodiment, the universal adapter nucleic acid sequence comprises a base selected from ribocytosine, ribouracil and a combination thereof. In an embodiment, the universal adapter nucleic acid sequence comprises a plurality of ribocytosines, a plurality of ribouracils and a combination thereof. RNase A selectively degrades single-stranded ribocytosine and ribouracil (e.g., at a salt concentration greater than 300 mM), and therefore, in the case where the universal adapter nucleic acid sequence comprises one or more ribocytosines and / or ribouracils, the RNase A degrading enzyme is configured to degrade the universal adapter nucleic acid sequence, for example, when the sample solution is maintained at the active temperature of RNase A.

[0164] In embodiments, the degradative enzyme is inactive for degrading single-stranded nucleic acid molecules above the active temperature range; and after being inactive, it is active for degrading single-stranded nucleic acid molecules within the active temperature range. As further discussed herein, in embodiments, the degradative enzyme is inactive at elevated temperatures, such as at the enzymatic extension temperature, but is active once the temperature of the sample solution decreases after being elevated.

[0165] In embodiments, the kit further comprises an extendase configured to extend the capture primer nucleic acid molecule annealed to the target nucleic acid sequence. In embodiments, the extendase is selected from the group consisting of a polymerase, a reverse transcriptase, and a combination thereof.

[0166] In an embodiment, the kit also includes instructions for enriching a target nucleic acid sequence, such as a target nucleic acid sequence in a sample comprising a sample nucleic acid molecule. In an embodiment, the kit includes instructions for enriching a sample nucleic acid molecule comprising a target nucleic acid sequence. In an embodiment, the instructions include: (a) introducing a capture primer nucleic acid molecule complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules in a sample solution comprising a plurality of sample nucleic acid molecules, each of the sample nucleic acid molecules comprising a universal adapter nucleic acid sequence; (b) enzymatically extending a capture primer nucleic acid molecule annealed to a target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) enzymatically degrading single-stranded sample nucleic acid molecules to provide a sample solution having a higher proportion of sample nucleic acid molecules comprising a target nucleic acid sequence than the sample solution. In an embodiment, the instructions also include repeating steps (b) and (c) one or more times for the enriched sample solution. In an embodiment, the instructions also include maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecules.

[0167] In an embodiment, the instructions for enzymatically extending capture primer nucleic acid molecules include: maintaining the temperature of the sample solution at or above the melting temperature of the multiple sample nucleic acid molecules; introducing an extension enzyme into the sample solution, wherein the extension enzyme is configured to extend the capture primer nucleic acid molecules that are annealed to the target nucleic acid sequence; and maintaining the sample solution near or below the annealing temperature of the capture primer nucleic acid molecules, wherein the annealing temperature is suitable for annealing the capture primer nucleic acid molecules to the target nucleic acid sequence; and maintaining the sample solution near the extension temperature of the extension enzyme, wherein the extension temperature is suitable for enzymatic extension of the capture primer nucleic acid molecules that are annealed to the target nucleic acid sequence by the extension enzyme.

[0168] In an embodiment, the instructions for enzymatically degrading single-stranded sample nucleic acid molecules include: introducing a degradation enzyme into the sample solution, wherein the degradation enzyme is configured to degrade single-stranded nucleic acid molecules comprising a universal adaptor nucleic acid sequence; and maintaining the temperature of the sample solution at the degradation temperature of the degradation enzyme.

[0169] In embodiments, the instructions further include instructions for coupling the universal adaptor molecules to sample nucleic acid molecules in the sample solution.

[0170] Consumable kit

[0171] In an embodiment, the present invention provides a kit for consuming sample nucleic acid molecules comprising a target nucleic acid sequence. In an embodiment, the kit comprises a capture primer nucleic acid molecule complementary or partially complementary to the target sequence; and a degradation enzyme configured to degrade double-stranded nucleic acid molecules.

[0172] As above, the test kit comprises a capture primer nucleic acid molecule. In embodiments, the capture primer nucleic acid molecule is fully complementary to the target nucleic acid sequence. In embodiments, the capture primer nucleic acid molecule is partially complementary to one or more target nucleic acid molecules. As further discussed herein, the capture primer nucleic acid molecule can be at least partially complementary to many target nucleic acid sequences, and therefore, according to the reaction conditions adopted by the test kit of the present invention, the test kit of the present invention is configured to enrich the sample nucleic acid molecules with many different target nucleic acid sequences.

[0173] As this article about Figure 2D As further discussed, the capture primer nucleic acid molecule can be single-stranded, at least partially double-stranded, or double-stranded, for example at the annealing temperature between the capture primer nucleic acid molecule and its target nucleic acid sequence.

[0174] In embodiments, the capture primer nucleic acid molecule comprises a phosphorothioate bond. In embodiments, the phosphorothioate bond is disposed between a base at the 3' end of the capture primer nucleic acid molecule and a base immediately adjacent to the base at the 3' end. Such a phosphorothioate bond is configured to resist 3' exonuclease activity, such as those present in proofreading polymerases.

[0175] In embodiments, the kit further comprises a plurality of universal adapter nucleic acid molecules configured to be coupled to sample nucleic acid molecules.As further discussed herein with respect to the methods of the invention, the universal adapter nucleic acid molecules are suitable for use in nucleic acid amplification reactions.

[0176] In embodiments, the universal adaptor nucleic acid molecule comprises a nucleic acid sequence adjacent to the 3' end or the 5' end that is configured not to bind to itself, such as in a hairpin configuration, thereby avoiding self-priming. In embodiments, the universal adaptor nucleic acid molecule comprises a poly-T sequence, a poly-A sequence, or a combination thereof.

[0177] In an embodiment, the kit further comprises a reagent for coupling the universal adapter nucleic acid molecule to the sample nucleic acid molecule. In an embodiment, the kit comprises a reagent selected from the following: a transposase loaded with an oligonucleotide comprising a universal adapter nucleic acid molecule; a restriction endonuclease; an oligonucleotide or oligonucleotide complex comprising a universal adapter nucleic acid molecule; an oligonucleotide or oligonucleotide complex comprising a T7 promoter; an antibody or antibody fragment against a transcription factor; and a combination thereof.

[0178] The kit of the present embodiment comprises a degradation enzyme. In an embodiment, the degradation enzyme is configured to cut a double-stranded nucleic acid molecule comprising a universal adapter nucleic acid molecule. In an embodiment, the degradation enzyme is configured to degrade a double-stranded nucleic acid molecule comprising a universal adapter nucleic acid molecule. In an embodiment, the degradation enzyme is a ribonuclease. In an embodiment, the degradation enzyme is an endonuclease. In an embodiment, the endonuclease is an endoribonuclease. In an embodiment, the degradation enzyme is not a restriction endonuclease. In an embodiment, the degradation enzyme is a ribonuclease. In an embodiment, the degradation enzyme is an endonuclease. In an embodiment, the endoribonuclease is an endoribonuclease. In an embodiment, the endoribonuclease is selected from RNase HII, RNase H, RNase III and a combination thereof.

[0179] In an embodiment, the degrading enzyme is RNase HII. In an embodiment, the degrading enzyme corresponds to SEQ ID NO. 16. In an embodiment, the sequence homology of the degrading enzyme to SEQ ID NO. 16 is greater than 90%, greater than 95% or greater than 99%.

[0180] In embodiments, the degrading enzyme is RNase H. In embodiments, the degrading enzyme corresponds to SEQ ID NO. 17. In embodiments, the sequence homology of the degrading enzyme to SEQ ID NO. 17 is greater than 90%, greater than 95%, or greater than 99%.

[0181] In an embodiment, the degrading enzyme is RNase III. In an embodiment, the degrading enzyme corresponds to SEQ ID NO. 18. In an embodiment, the sequence homology of the degrading enzyme to SEQ ID NO. 18 is greater than 90%, greater than 95% or greater than 99%.

[0182] In embodiments, the kit further comprises an extendase configured to extend the capture primer nucleic acid molecule annealed to the target nucleic acid sequence. In embodiments, the extendase is selected from the group consisting of a polymerase, a reverse transcriptase, and a combination thereof.

[0183] In an embodiment, the kit further comprises instructions for consuming a target nucleic acid sequence, such as a target nucleic acid sequence in a sample comprising a sample nucleic acid molecule. In an embodiment, the instructions comprise instructions for performing a consumption method of the present invention. In an embodiment, the instructions comprise: (a) introducing a capture primer nucleic acid molecule complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules in a sample solution comprising a plurality of sample nucleic acid molecules, each of the sample nucleic acid molecules comprising a universal adapter nucleic acid sequence, the universal adapter nucleic acid sequence comprising a ribonucleotide; (b) enzymatically extending a capture primer nucleic acid molecule annealed to a target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) enzymatically cleaving a double-stranded ribonucleic acid molecule of the sample nucleic acid molecule to provide a sample solution having a lower proportion of sample nucleic acid molecules comprising a target nucleic acid sequence than the sample solution. In an embodiment, the instructions further comprise repeating steps (b) and (c) one or more times for the consumed sample solution. In an embodiment, the instructions further comprise maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecule.

[0184] In an embodiment, the instructions for enzymatically extending capture primer nucleic acid molecules include maintaining the temperature of the sample solution at or above the melting temperature of the multiple sample nucleic acid molecules; introducing an extension enzyme into the sample solution, wherein the extension enzyme is configured to extend the capture primer nucleic acid molecules that anneal to the target nucleic acid sequence; and maintaining the sample solution near or below the annealing temperature of the capture primer nucleic acid molecules, wherein the annealing temperature is suitable for annealing the capture primer nucleic acid molecules to the target nucleic acid sequence; and maintaining the sample solution near the extension temperature of the extension enzyme, wherein the extension temperature is suitable for enzymatic extension of the capture primer nucleic acid molecules that anneal to the target nucleic acid sequence by the extension enzyme.

[0185] In an embodiment, the instructions for enzymatically cleaving double-stranded sample nucleic acid molecules include: introducing a degradation enzyme into the sample solution, wherein the degradation enzyme is configured to cleave double-stranded nucleic acid molecules comprising a universal adaptor nucleic acid sequence; and maintaining the temperature of the sample solution at the degradation temperature of the degradation enzyme.

[0186] In an embodiment, the instructions further include: introducing a plurality of amplification primer nucleic acid molecules into a consumed sample solution, wherein the amplification primer nucleic acid molecules in the plurality of amplification primer nucleic acid molecules are complementary to a universal adapter nucleic acid sequence; and performing a nucleic acid amplification reaction on the plurality of sample nucleic acid molecules in the consumed sample solution having the plurality of amplification primer nucleic acid molecules.

[0187] In embodiments, the instructions further include instructions for coupling the universal adaptor molecules to sample nucleic acid molecules in the sample solution. Example

[0188] Example 1: Example results of an enrichment strategy using selected probes:

[0189] By amplifying sequences from plasmids (AmpR: 421 bp and Hygro: 774 bp), two different amplicons of different lengths with universal adaptors were generated. Primers BC 0328 and BC 0330 were used to generate the AmpR amplicon ( Figure 6 Primers BC_0332 and BC_0334 were used to generate the Hygro amplicon ( Figure 4 ).

[0190] Equal amounts of both amplicons (0.2 ng each) were added to a 20 uL reaction.

[0191] To enrich for the AmpR amplicon, we used the following mix, where BC_306_amp_capture is an oligonucleotide complementary to the AmpR amplicon but not to the Hygro amplicon.

[0192] Table 1:

[0193]

[0194]

[0195] To enrich for the Hygro amplicon, we used the following mix, where BC_301_hygro_capture is an oligonucleotide complementary to the Hygro amplicon but not to the AmpR amplicon.

[0196] Table 2:

[0197] Components 20uL reaction 10x Standard Taq Buffer 2 10mM DNTP 0.4 Amp+Hygro Amplicon Mix (0.4 ng total) 1 Taq DNA polymerase 0.1 BC_0301_hygro_capture 0.4 10x diluted RNase T1 1 Nuclease-free H2O 15.1 Total volume 20

[0198] The samples were then cycled under the following conditions:

[0199] Thermal cycle the samples for 1 or 3 cycles according to the following protocol:

[0200] 1.95℃-30s

[0201] 2.58℃-20s

[0202] 3.68℃-20s

[0203] 4.37℃ or 42C or 50C-15min

[0204] The samples were then immediately placed on ice.

[0205] 2uL of each reaction was then added to the 25uL qPCR reaction with universal primers. Once the reaction began to reach a plateau, it was removed from the qPCR and electrophoresed on a 1.25% agarose gel. The results were as follows Figure 8 shown.

[0206] Top row cluster left to right:

[0207] 1.100 base pair ladder (New England Biolabs)

[0208] 2. Amp capture, 1 cycle, step 4, at 37°C

[0209] 3. Amp capture, 1 cycle, step 4, at 42°C

[0210] 4. Amp capture, 1 cycle, step 4, at 50°C

[0211] 5.Hygro capture, 1 cycle, step 4, at 37°C

[0212] 6.Hygro capture, 1 cycle, step 4, at 42°C

[0213] 7.Hygro capture, 1 cycle, step 4, at 50°C

[0214] 8. Control: DNA only

[0215] Bottom row from left to right:

[0216] 9.100 base pair ladder (New England Biolabs)

[0217] 10. Amp capture, 3 cycles, step 4, at 37°C

[0218] 11. Amp capture, 3 cycles, step 4, at 42°C

[0219] 12. Amp capture, 3 cycles, step 4, at 50°C

[0220] 13.Hygro capture, 3 cycles, step 4, at 37°C

[0221] 14.Hygro capture, 3 cycles, step 4, at 42°C

[0222] 15.Hygro capture, 3 cycles, step 4, at 50°C

[0223] 16. Control: Only DNA

[0224] Oligonucleotide sequence:

[0225] See Figure 5 : AmpR_amplicon sequence.pdf

[0226] See Figure 4 : Hygro_amplicon sequence.pdf

[0227] BC_0108_TSO_PCR AAGCAGTGGTATCAACGCAGAGT(SEQ ID NO.12)

[0228] BC_0062_Primer_Bind CAGACGTGTGCTCTTCCGATCT(SEQ ID NO.13)

[0229] BC_0328_amp_fwd__3ribo

[0230] AAGCAGTGGTATCAACrGCArGAGTrGAATGGGTACCAAACGACGAGCGTGACA(SEQ ID NO.1)

[0231] BC_0330_amp_rev_3ribo

[0232] GTGACTGGAGTTCAGACrGTGTrGCTCTTCCrGATCTCCAATGCTTAATCAGTGAGGCACC(SEQ IDNO.2)

[0233] BC_0306_Amp_capture ACGGGGAGTCAGGCAACTATGGATGA(SEQ ID NO.19)

[0234] BC_0359_amp_ribo_dT_fwd

[0235] TTTTTTTTTTAAGCAGTGGTATCAACrGCArGAGTrGAATGGGTACCAAACGACGAGCGTGACA(SEQID NO.20)

[0236] BC_0360_amp_ribo_dT_rev

[0237] TTTTTTTTTCAGACrGTGTrGCTCTTCCrGATCTCCAATGCTTAATCAGTGAGGCACC(SEQ IDNO.21)

[0238] BC_0332_hygro_fwd_3ribo

[0239] AAGCAGTGGTATCAACrGCArGAGTrGAATGGGCCCGCTGTTCTGCAGCC(SEQ ID NO.3)

[0240] BC_0334_hygro_rev_3ribo

[0241] GTGACTGGAGTTCAGACrGTGTrGCTCTTCCrGATCTATTCCTTTGCCCTCGGACG(SEQ ID NO.4)

[0242] BC_0301_hygro_capture AGAAGTACTCGCCGATAGTGGAAACCGA(SEQ ID NO.22)

[0243] Figure 8 The results of the gel images in Figure 2 show the enrichment of the desired target molecule under various conditions. Lanes 2-4 and 10-12 show the enrichment of AmpR molecules. Lanes 5-7 and 13-15 show the enrichment of Hygro molecules. Enrichment occurs over the entire temperature range of the degradation step (37°C-50°C). The gel also shows that multiple cycles of melting the nucleic acid, annealing the capture primer, extending the capture primer, and degrading single-stranded riboguanine can result in equal or higher fold enrichment compared to a single cycle (lanes 10-12 compared to lanes 4-6, and lanes 13-15 compared to lanes 5-7).

[0244] Embodiment 2:

[0245] In this example, a single-cell RNA sequencing library (from expanded primary T cells) was enriched for specific sequences that matched portions of the following genes: ACTB (ATGGCCCAGTCCTCTCCCAA, SEQ ID NO.5), GAPDH (AGGAGTAAGACCCCTGGACCAC, SEQ ID NO.6), TRAC (AGAACCCTGACCCTGCCG, SEQ ID NO.7), TRBC1 (CTGAAAAACGTGTTCCCACCCGAG, SEQ ID NO.8), and TRBC2 (ACCTGAACAAGGTGTTCCCACC, SEQ ID NO.9).

[0246] TRAC corresponds to the constant region of the T cell receptor alpha chain, while TRBC1 and TRCB2 correspond to two possible constant regions of the T cell receptor beta chain. The T cell receptor alpha and beta chains are generated by VJ and VDJ recombination, resulting in a high diversity of possible sequences of each. However, by enriching for nucleic acid sequences containing a portion of the TRAC sequence, all or nearly all nucleic acid sequences encoding the T cell receptor alpha chain can be enriched, and similarly, by enriching for nucleic acid sequences containing a portion of TRBC1 or TRBC2, all or nearly all nucleic acid sequences encoding the T cell receptor beta chain can be enriched.

[0247] Single-cell RNA sequencing libraries of amplified cDNA were generated according to the published SPLiT-seq method. 1 ng of amplified cDNA was amplified for 11 PCR cycles using primers BC_385 and BC_386 to introduce riboguanosine to each 5' end of the double-stranded DNA molecule. The resulting PCR product was purified with SPRI magnetic beads (Kapa PureBeads) using a 2:1 ratio of magnetic beads to PCR product according to the manufacturer's instructions. The concentration of the resulting purified PCR product was measured using the Qubit dsDNA HS Assay Kit.

[0248] In total, 12 different enrichment changes were compared. Three different polymerase mixes were tested, two different polymerase extension times were tested, and two RNase T1 concentrations were tested (3 x 2 x 2 = 12 combinatorial changes).

[0249] Variation 1 (Hot Start Taq in 1x Standard Taq Buffer, 30s polymerase extension, 100u RNase T1)

[0250] Variation 2 (Hot-start Taq in 1x standard Taq buffer, 120s polymerase extension, 100u RNase T1)

[0251] Variation 3 (Hot Start Taq in 1x Standard Taq Buffer, 30s polymerase extension, 20u RNase T1)

[0252] Variation 4 (Hot Start Taq in 1x Standard Taq Buffer, 120 s polymerase extension, 20 u RNase T1)

[0253] Variation 5 (OneTaq Hot Start in 1x OneTaq Standard Reaction Buffer, 30s polymerase extension, 100u RNase T1)

[0254] Variation 6 (OneTaq Hot Start in 1x OneTaq Standard Reaction Buffer, 120s polymerase extension, 100u RNase T1)

[0255] Variation 7 (OneTaq Hot Start in 1x OneTaq Standard Reaction Buffer, 30s polymerase extension, 20u RNase T1)

[0256] Variation 8 (OneTaq Hot Start in 1x OneTaq Standard Reaction Buffer, 120s polymerase extension, 20u RNase T1)

[0257] Variation 9 (Deep Vent Exo- in 1x ThermoPol reaction buffer, 30s polymerase extension, 100u RNase T1)

[0258] Variation 10 (Deep Vent Exo- in 1x ThermoPol reaction buffer, 120s polymerase extension, 100u RNase T1)

[0259] Variation 11 (Deep Vent Exo- in 1x ThermoPol reaction buffer, 30s polymerase extension, 20u RNase T1)

[0260] Variation 12 (Deep Vent Exo- in 1x ThermoPol reaction buffer, 120s polymerase extension, 20u RNase T1)

[0261] Prepare each reaction with:

[0262] (2uL 10x standard Taq buffer / 4uL OneTaq standard reaction buffer / 2uL ThermoPol reaction buffer), 1.6uL 2.5mM dNTP, (0.1uL hot start Taq polymerase / 0.1uL Hot start DNA polymerase / 0.1uLDeep (exo-) DNA polymerase), 1uL of combined capture primers (10uM in total, 2uM each), (11.3 / 13.3uL water), 1uL of amplified cDNA (from PCR using BC 385 and BC 386), and 1uL of RNase T1 (diluted to 100u / uL or 20u / uL). Primers BC_0344ACTB_probe (SEQ ID NO.5), BC_0343_GAPDH_probe (SEQ ID NO.6), BC_0391_TRAC_probe (SEQ ID NO.7), BC_0392TRBC1_probe (SEQ ID NO.8), BC_0393_TRBC2_probe (SEQ ID NO.9) were used as combined capture primers.

[0263] Change 1, 3, 5, 7 to cycle as follows:

[0264] a. 95C for 30 s, b. 95C for 30 s, c. 53C for 20 s, d. 68C for 30 s, e. 37C for 15 min, f. Repeat steps be for another two cycles (three cycles including the first cycle).

[0265] Variations 2, 4, 6, and 8 are cycled as follows:

[0266] a. 95C for 30 s, b. 95C for 30 s, c. 53C for 20 s, d. 68C for 2 min, e. 37C for 15 min, f. Repeat steps be for another two cycles (three cycles including the first cycle).

[0267] Variations 9 and 11 loop as follows:

[0268] a. 95C for 30 s, b. 95C for 30 s, c. 55C for 20 s, d. 72C for 30 s, e. 37C for 15 min, f. Repeat steps be for another two cycles (three cycles including the first cycle).

[0269] Variations 10 and 12 loop as follows:

[0270] a. 95C for 30 s, b. 95C for 30 s, c. 55C for 20 s, d. 72C for 2 min, e. 37C for 15 min, f. Repeat steps be for another two cycles (three cycles including the first cycle).

[0271] All 12 reactions were then purified using a singlesided SPRI cleanup (Kapa Pure Beads) according to the manufacturer's instructions (2x bead to PCR product ratio). Each of the 12 purified reactions was then amplified by PCR using primers BC 0062 (SEQ ID NO. 12) and BC 0108 TSO PCR (SEQ ID NO. 12). Amplified PCR products were then prepared for next generation sequencing on an Illumina sequencer by fragmentation, end repair (including A tailing), adapter ligation, and PCR using primers for the added indexed Illumina adapters (P7 and P5).

[0272] The original amplified cDNA library (without any enrichment) was also prepared for next generation sequencing using the same method (fragmentation, end repair (including A-tailing), adapter ligation, and PCR with primers that added indexed Illumina adapters (P7 and P5)).

[0273] All 13 libraries (12 enriched variations and the original non-enriched library) were sequenced together on an Illumina NextSeq. The resulting libraries were demultiplexed according to the index added during the final PCR.

[0274] Then, the fold change enrichment of each of the 12 enriched changes relative to the non-enriched library was calculated for each of the 5 sequences expected to be enriched: ACTB (ATGGCCCAGTCCTCTCCCAA, SEQ ID NO.5), GAPDH (AGGAGTAAGACCCCTGGACCAC, SEQ ID NO.6), TRAC (AGAACCCTGACCCTGCCG, SEQ ID NO.7), TRBC 1 (CTGAAAAACGTGTTCCCACCCGAG, SEQ ID NO.8), and TRBC2 (ACCTGAACAAGGTGTTCCCACC, SEQ ID NO.9).

[0275] Table 3: Fold change enrichment:

[0276]

[0277]

[0278] The results in Table 3 show the enrichment of the desired target molecules under various conditions. For each of the five target sequences, nucleic acids containing a given sequence were enriched under different experimental conditions. The concentration of RNase T1, the type of polymerase, and the polymerase extension time can be adjusted to result in different fold enrichments of the target sequences.

[0279] While illustrative embodiments have been shown and described, it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention.

Claims

1. A method for depleting a target nucleic acid sequence, the method comprising: (a) introducing a capture primer nucleic acid molecule that is complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules in the plurality of sample nucleic acid molecules into a sample solution comprising a plurality of sample nucleic acid molecules, each of the sample nucleic acid molecules comprising a universal adapter nucleic acid sequence comprising ribonucleotides; (b) enzymatically extending a capture primer nucleic acid molecule that anneals to a target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) enzymatically cleaving the double-stranded ribonucleic acid molecules of the sample nucleic acid molecules to provide a depleted sample solution having a lower proportion of sample nucleic acid molecules comprising the target nucleic acid sequence than the sample solution.

2. The method of claim 1, wherein enzymatically extending the capture primer nucleic acid molecule comprises: maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules; introducing an extendase into the sample solution, the extendase being configured to extend the capture primer nucleic acid molecule annealed to the target nucleic acid sequence; and Maintaining the sample solution at or below the annealing temperature of the capture primer nucleic acid molecules, the annealing temperature being suitable for annealing the capture primer nucleic acid molecules to the target nucleic acid sequence; and The sample solution is maintained near the extension temperature of the extendase, which is suitable for enzymatic extension of the capture primer nucleic acid molecules annealed to the target nucleic acid sequence by the extendase.

3. The method of claim 2, wherein the elongation enzyme is selected from the group consisting of a polymerase, a reverse transcriptase, and a combination thereof.

4. The method of any one of claims 2 and 3, wherein enzymatically cleaving the double-stranded sample nucleic acid molecules comprises: introducing a degradation enzyme into the sample solution, the degradation enzyme being configured to degrade double-stranded RNA molecules comprising a universal adaptor nucleic acid sequence; and The temperature of the sample solution is maintained at the degradation temperature of the degrading enzyme.

5. The method of claim 4, wherein the degradation enzyme is introduced into the sample solution after enzymatic extension of the capture primer nucleic acid molecule.

6. The method of claim 4, wherein the degradation enzyme is introduced into the sample solution prior to enzymatic extension of the capture primer nucleic acid molecule. The method of claim 4 , wherein the degradation temperature is below the annealing temperature.

8. The method of claim 4, wherein the degradation temperature is below the extension temperature.

9. The method of claim 4, wherein the degradation temperature is an activity temperature of the degradation enzyme.

10. The method of any one of claims 4-9, wherein the degradative enzyme is a ribonuclease.

11. The method of any one of claims 4-9, wherein the degradative enzyme is an endonuclease.

12. The method of claim 11, wherein the endonuclease is an endoribonuclease.

13. The method of claim 12, wherein the endoribonuclease is selected from the group consisting of RNase HII, RNase H, RNase III, and combinations thereof.

14. The method of any one of claims 4-12, wherein the degrading enzyme is RNase HII.

15. The method of any one of claims 1-14, wherein the capture primer nucleic acid molecule is a blocked capture primer nucleic acid molecule, wherein the blocked capture primer nucleic acid molecule is configured to block enzymatic extension of the blocked capture primer nucleic acid molecule at the 3' end by an extendase.

16. The method of any one of claims 4-15, wherein enzymatically cleaving the double-stranded sample nucleic acid molecule comprises degrading a portion of a universal adaptor nucleic acid sequence disposed on the double-stranded sample nucleic acid molecule.

17. The method of claim 16, wherein enzymatically cleaving the double-stranded sample nucleic acid molecule comprises cleaving the backbone of the universal adaptor nucleic acid molecule of the double-stranded sample nucleic acid molecule.

18. The method of claim 16, wherein enzymatically cleaving the double-stranded sample nucleic acid molecule comprises digesting a portion of the universal adaptor nucleic acid molecule of the double-stranded sample nucleic acid molecule.

19. The method of any one of claims 1-18, wherein the capture primer nucleic acid molecule is complementary or partially complementary to a second target nucleic acid sequence of one or more second sample nucleic acid molecules of the plurality of sample nucleic acid molecules, wherein the second target nucleic acid sequence is different from the target nucleic acid sequence.

20. The method of any one of claims 2-19, wherein maintaining the sample solution at about or below the annealing temperature of the capture primer nucleic acid molecules comprises maintaining the sample solution at a temperature in the range of about 1°C to about 5°C of the annealing temperature of the capture primer nucleic acid molecules.

21. The method of any one of claims 19 and 20, wherein the capture primer nucleic acid molecule and the second target nucleic acid sequence have a second annealing temperature within the range of about 1°C to about 5°C of the annealing temperature.

22. The method of any one of claims 1-21, further comprising repeating steps (b) and (c) one or more times on the spent sample solution.

23. The method of claim 22, further comprising maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecules.

24. The method of any one of claims 1-23, further comprising: introducing a plurality of amplification primer nucleic acid molecules into the spent sample solution, wherein an amplification primer nucleic acid molecule in the plurality of amplification primer nucleic acid molecules is complementary to the universal adaptor nucleic acid sequence; and A nucleic acid amplification reaction is performed on the plurality of sample nucleic acid molecules in the spent sample solution having the plurality of amplification primer nucleic acid molecules to provide an amplified spent sample solution.

25. The method of claim 24, wherein performing a nucleic acid amplification reaction on the plurality of sample nucleic acid molecules in the consumed sample solution does not amplify or substantially does not amplify sample nucleic acid molecules that have been degraded by a degradative enzyme.

26. The method of any one of claims 1-25, further comprising subjecting the amplified consumed sample solution to a reaction selected from the group consisting of nucleic acid fragmentation reaction, enzymatic end repair, A-tailing, adapter ligation, polymerase chain reaction, and combinations thereof.

27. The method of any one of claims 1-26, further comprising purifying the plurality of sample nucleic acid molecules in the spent sample solution.

28. The method of claim 27, wherein purifying the plurality of sample nucleic acid molecules in the spent sample solution comprises removing a reagent selected from the group consisting of capture primer nucleic acid molecules, enzymes, and combinations thereof from the spent sample solution.

29. The method of any one of claims 1-28, further comprising sequencing the nucleic acid molecules in the consumed sample solution.

30. The method of any one of claims 1-29, wherein the universal adaptor nucleic acid sequence of the plurality of sample nucleic acid molecules comprises an adaptor tag nucleic acid sequence.

31. The method of claim 30, wherein the adapter tag nucleic acid sequence defines a unique nucleic acid sequence.

32. The method of any one of claims 29-31, wherein sequencing the nucleic acid molecules in the consumed sample solution comprises generating sample nucleic acid information based on the plurality of sample nucleic acid molecules in the consumed sample solution.

33. The method of claim 32, wherein sequencing the nucleic acid molecules in the spent sample solution comprises generating adapter tag nucleic acid sequence information based on the adapter tag nucleic acid sequence.

34. The method of any one of claims 1-33, wherein the capture primer nucleic acid molecule comprises a phosphorothioate bond.

35. The method of claim 34, wherein the phosphorothioate bond is disposed between a base at the 3' end and a base immediately adjacent to the base at the 3' end of the capture primer nucleic acid molecule.

36. The method of any one of claims 1-35, wherein the capture primer nucleic acid molecule is configured to be predominantly single-stranded at an annealing temperature.

37. The method of any one of claims 1-35, wherein the capture primer nucleic acid molecule is configured to be predominantly at least partially double-stranded at an annealing temperature.

38. The method of any one of claims 1-37, wherein the capture primer nucleic acid molecule is partially complementary to the target nucleic acid sequence, and wherein the capture primer nucleic acid molecule comprises a plurality of bases in the range of 1 to 5 that are not complementary to a universal adapter nucleic acid sequence.

39. The method of any one of claims 1-38, wherein the capture primer nucleic acid molecule is partially complementary to the target nucleic acid sequence, and wherein the capture primer nucleic acid molecule is greater than or equal to 90% complementary to a universal adapter sequence.

40. The method of any one of claims 1-39, wherein the capture primer nucleic acid molecule further comprises a second capture primer nucleic acid molecule that is complementary or partially complementary to the first capture primer nucleic acid molecule.

41. A kit comprising: a capture primer nucleic acid molecule that is complementary or partially complementary to the target sequence; and A degradative enzyme configured to degrade double-stranded nucleic acid molecules.

42. The kit of claim 41, wherein the degradative enzyme is a ribonuclease.

43. The kit of claim 41, wherein the degradative enzyme is an endonuclease.

44. The kit of claim 43, wherein the endonuclease is an endoribonuclease.

45. The kit of claim 44, wherein the endoribonuclease is selected from the group consisting of RNase HII, RNase H, RNase III, and combinations thereof.

46. ​​The kit of any one of claims 41-45, wherein the degrading enzyme is RNase HII.

47. The kit of any one of claims 41-46, wherein the capture primer nucleic acid molecule is a blocked capture primer nucleic acid molecule, wherein the blocked capture primer nucleic acid molecule is configured to block enzymatic extension of the blocked capture primer nucleic acid molecule at the 3' end by an extendase.

48. The kit of any one of claims 41-47, wherein the degrading enzyme: is inactive in degrading double-stranded nucleic acid molecules above the active temperature range; and After being inactive, it is active for degrading double-stranded nucleic acid molecules within the active temperature range.

49. The kit of any one of claims 41-48, further comprising a plurality of universal adaptor nucleic acid molecules configured to couple to sample nucleic acid molecules.

50. The kit of any one of claims 41-49, further comprising a reagent selected from the following: a transposase loaded with an oligonucleotide comprising a universal adapter nucleic acid molecule; a restriction endonuclease; an oligonucleotide or an oligonucleotide complex comprising a universal adapter nucleic acid molecule; an oligonucleotide or an oligonucleotide complex comprising a T7 promoter; an antibody or an antibody fragment against a transcription factor; and a combination thereof.

51. The kit of claim 50, wherein the degrading enzyme is configured to cleave a double-stranded nucleic acid molecule comprising the universal adaptor nucleic acid molecule.

52. The kit of any one of claims 41-51, further comprising instructions for depleting the target nucleic acid sequence, the instructions comprising: (a) introducing a capture primer nucleic acid molecule that is complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules in the plurality of sample nucleic acid molecules into a sample solution comprising a plurality of sample nucleic acid molecules, each of the sample nucleic acid molecules comprising a universal adapter nucleic acid sequence comprising ribonucleotides; (b) enzymatically extending a capture primer nucleic acid molecule that anneals to a target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) enzymatically cleaving the double-stranded ribonucleic acid molecules of the sample nucleic acid molecules to provide a depleted sample solution having a lower proportion of sample nucleic acid molecules comprising the target nucleic acid sequence than the sample solution.

53. The kit of claim 52, wherein the instructions for enzymatically extending the capture primer nucleic acid molecule comprise: maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules; introducing an extendase into the sample solution, the extendase being configured to extend the capture primer nucleic acid molecule annealed to the target nucleic acid sequence; Maintaining the sample solution at or below the annealing temperature of the capture primer nucleic acid molecules, the annealing temperature being suitable for annealing the capture primer nucleic acid molecules to the target nucleic acid sequence; and The sample solution is maintained near the extension temperature of the extendase, which is suitable for enzymatic extension of the capture primer nucleic acid molecules annealed to the target nucleic acid sequence by the extendase.

54. The kit of any one of claims 52 and 53, wherein the instructions for enzymatically cleaving double-stranded sample nucleic acid molecules comprise: introducing a degradation enzyme into the sample solution, the degradation enzyme being configured to cleave a double-stranded nucleic acid molecule comprising a universal adaptor nucleic acid sequence; and The temperature of the sample solution is maintained at the degradation temperature of the degrading enzyme.

55. The kit of any one of claims 52-54, wherein the instructions further comprise repeating steps (b) and (c) one or more times for the spent sample solution.

56. The kit of claim 55, wherein the instructions further comprise maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecules.

57. The kit of any one of claims 52-56, wherein the instructions further comprise: introducing a plurality of amplification primer nucleic acid molecules into the spent sample solution, wherein an amplification primer nucleic acid molecule in the plurality of amplification primer nucleic acid molecules is complementary to the universal adaptor nucleic acid sequence; and A nucleic acid amplification reaction is performed on the plurality of sample nucleic acid molecules in the consumed sample solution having the plurality of amplification primer nucleic acid molecules.

58. The kit of any one of claims 52-57, wherein the instructions further include the following instructions: The universal adaptor molecules are coupled to the sample nucleic acid molecules in the sample solution.

59. The kit of any one of claims 41-58, further comprising an extension enzyme configured to extend a capture primer nucleic acid molecule annealed to the target nucleic acid sequence.

60. The kit of any one of claims 41-59, wherein the elongation enzyme is selected from the group consisting of a polymerase, a reverse transcriptase, and combinations thereof.

Images