A primer-probe combination, kit, and application for rapid detection of Methylomonas in cold spring water at constant temperature

Abstract

The present invention discloses a primer-probe combination, a kit and an application for the constant temperature rapid detection of Methylomonas in cold spring water. The primers are shown in SEQ ID NO.2 and SEQ ID NO.3, and the fluorescent probe is 5'-CCGTCCGCCACTCGTCATCTGGAGCAAGC(FAM-dT)C(THF)AA(BHQ1-dT)GTTACCGTT CGACT-C3-spacer-3'. The primer-probe combination of the present invention is used to perform real-time fluorescent recombinase polymerase amplification on the sample to be tested, and the test results can be obtained within 10 minutes at 39°C. The detection equipment is small and easy to carry, providing a more convenient detection means for the field and places with scarce resources. In addition, the detection sensitivity of the kit of the present invention is 10 times that of qPCR, and the reaction speed is faster than qPCR.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a primer-probe combination, kit, and application for the rapid isothermal detection of high abundance methylmona in a type of cold spring water. Background Technology

[0002] Methylmonas is an important microbial group in cold seeps. As a typical methanogenic bacterium, it plays a vital role as a chemoautotroph in the cold seep water. The Methylmonas group also reflects, to some extent, the methane concentration in the in-situ environment. Deep-sea experimental equipment is an important tool for effectively conducting deep-sea scientific experiments and verifying related cutting-edge technologies at sea. Based on this equipment, we can detect some microbial groups in situ. Establishing effective microbial detection methods and applying them to deep-sea equipment has significant application value for studying deep-sea ecosystems and revealing extreme life processes.

[0003] Currently, qPCR is a common method for detecting specific microorganisms. However, conventional qPCR methods are complex and require high temperatures, leading to rapid energy consumption and hindering long-term observation. Therefore, considering the unique environmental conditions of cold seeps, we need to establish a simple, rapid, and low-energy detection method that can be used as an effective technology for future deep-sea experimental platforms. Currently, RPA technology, due to its ease of operation, high specificity, and sensitivity, has been applied to the detection of various nucleic acid viruses, and its low reaction temperature and short reaction time meet the requirement of low energy consumption. Summary of the Invention

[0004] The purpose of this invention is to overcome the technical problems of high complexity, slow reaction and high energy consumption in existing PCR technology, which limit its application in resource-scarce environments, and to provide a primer and probe combination, kit and application for isothermal rapid detection of a class of high-abundance methylmona in cold spring water.

[0005] The primer-probe combination kit of the present invention can be used to detect environmental samples and can quickly identify a class of highly abundant methylmona in cold seep environments.

[0006] To achieve the above-mentioned objectives of the present invention, the present invention adopts the following technical solution:

[0007] The first objective of this invention is to provide a primer-probe combination for rapid isothermal detection of Methylmonas bacteria in cold spring water, comprising an RPA primer pair and a fluorescent probe; the sequence of the RPA primer pair is as follows:

[0008] Forward primer: 5'-ATTGAACGCTGGTGGTATGCTTAACACATG-3';

[0009] Reverse primer: 5'-ATTCCTACGCGTTACTCACCCGTCCGCCACTCGTC-3';

[0010] The sequence of the fluorescent probe is as follows: 5'-CCGTCCGCCACTCGTCATCTGGAGCAAGC(FAM-dT)C(THF)AA(BHQ1-dT)GTTACCGTTCGACT-C3-spacer-3'.

[0011] In the above fluorescent probe sequence, C at position 29 is a FAM-dT modified base; A at position 32 is a BHQ1-dT modified base.

[0012] The second objective of this invention is to provide the application of the above-mentioned primer-probe combination in the preparation of a kit for the rapid detection of Methylmonas in cold spring water at constant temperature.

[0013] The third objective of this invention is to provide a kit for the rapid detection of Methylmonas bacteria in cold spring water at a constant temperature, which includes the primer-probe combination described above.

[0014] Preferably, the kit further comprises a fluorescent basic buffer, magnesium acetate, and ultrapure water.

[0015] The fourth objective of this invention is to provide the application of the above-described primer-probe combination or the above-described kit in the rapid detection of Methylmonas in cold spring water at constant temperature.

[0016] The application described is in the rapid isothermal detection of whether a type of highly abundant methylmona bacteria is present in cold seep environmental samples.

[0017] Preferably, the constant temperature is 39°C.

[0018] The fifth objective of this invention is to provide a method for rapid detection of Methylmonas bacteria in cold spring water at a constant temperature, comprising the following steps:

[0019] a. Collect water samples from the cold spring to be tested and extract total environmental DNA;

[0020] b. Using the DNA from step a as a template, perform real-time fluorescent recombinase polymerase amplification using the primer-probe combination described above or the kit described above to obtain the amplification product.

[0021] c. If a fluorescent signal is present, the sample to be tested contains the target methylmona; if no fluorescent signal is present, the sample to be tested does not contain methylmona.

[0022] Preferably, the reaction system for real-time fluorescent recombinase polymerase amplification is as follows: 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 0.8 μL of 10 μM probe, 25 μL of fluorescent basal buffer, 12.7 μL of ultrapure water, 5 μL of DNA template, and 2.5 μL of magnesium acetate solution, totaling 50 μL.

[0023] Preferably, the reaction conditions for the real-time fluorescent recombinase polymerase amplification are: reaction at 39°C for 10 min.

[0024] Preferably, the concentration of the DNA is 100-150 ng / μL.

[0025] The present invention has the following beneficial effects:

[0026] 1. The real-time RPA (real-time fluorescent recombinase polymerase amplification) technology established by this kit can obtain detection results within 10 minutes at 39℃. The process is simple and energy consumption is low, providing a more convenient detection method for field and resource-scarce areas.

[0027] 2. The detection sensitivity of the kit of the present invention is 10 times that of qPCR. The detection of this kit is more sensitive than that of qPCR, and the reaction speed is also faster than that of qPCR. Attached Figure Description

[0028] Figure 1 From left to right: methyF1 and methyR1 (Methy_M1), methyF2 and methyR2 (Methy_M2), methyF3 and methyR3 (Methy_M3), methyF4 and methyR4 (Methy_M4), 2k marker, methyF1 and methyR1 (negative control), methyF2 and methyR2 (negative control), methyF3 and methyR3 (negative control), methyF4 and methyR4 (negative control).

[0029] Figure 2 These are the amplification curves of RPA using the combination of forward primer methyF1, reverse primer methyR1, and probe probe_methy1.

[0030] Figure 3 This is the amplification curve of RPA under 5-fold serial dilution of DNA using the forward primer methyF1, reverse primer methyR1, and probe probe_methy1. To concentrate fluorescence collection, 20 cycles were set, each cycle lasting 30 seconds, for a total of 10 minutes. Undiluted DNA was 100 ng / μL, and 5-fold dilution was 20 ng / μL. 2Diluted 5 times to 4 ng / μL 3 Diluted 5 times to 0.8 ng / μL 4 The concentration was diluted to 0.16 ng / μL. The experimental results show that RPA exhibited fluorescence signal in the first cycle, and a clear curve appeared after 10 minutes of 20 cycles.

[0031] Figure 4 This is the amplification curve of qPCR using a combination of forward primer methyF1 and reverse primer methyR1, under 5-fold serial dilutions of DNA. To concentrate fluorescence collection, 20 cycles were performed, each cycle lasting 30 seconds, for a total of 10 minutes. Undiluted DNA was 100 ng / μL, and 5-fold dilutions were 20 ng / μL. 2 Diluted 5 times to 4 ng / μL 3 Diluted 5 times to 0.8 ng / μL 4 It was diluted 1-2 times to 0.16 ng / μL. Detailed Implementation

[0032] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0033] Example 1:

[0034] 1. Primer design: Design the required primers and probes.

[0035] The RPA primer set was designed with four pairs of primers and probes, based on different target fragments of 16S rRNA.

[0036] The 16S rRNA sequence is as follows (SEQ ID NO.1, this sequence is the most abundant Methylmonas sequence obtained from full-length amplicon sequencing data of cold seep bottom water):

[0037]

[0038] The sequences of the four primer pairs are shown below:

[0039] The target fragment size is 100bp:

[0040] Forward primer methyF1: ATTGAACGCTGGTGGTATGCTTAACACATG (SEQ ID NO.2) Reverse primer methyR1: ATTCCTACGCGTTACTCACCCGTCCGCCACTCGTC (SEQ ID NO.3) Target fragment size is 100bp:

[0041] Forward primer methyF2: CTCCTACGGGAGGCAGCAGTGGGGAATATTGGA (SEQ ID NO.4) Reverse primer methyR2: AAGTGCTTTACAACCCTCAGGCCTTCTTCACACAC (SEQ ID NO.5)

[0042] The target fragment size is 116bp:

[0043] Forward primer methyF3: GCGGTGGAGCATGTGGTTTAATTCGATGCA (SEQ ID NO.6) Reverse primer methyR3: GCAGCACCTGTATCTAAGCTCCCGAAGGCACCAAT (SEQ ID NO.7)

[0044] The target fragment size is 115bp:

[0045] Forward primer methyF4: AATGGCCGGTACAGAGGGCTGCAAACTCGC (SEQ ID NO.8) Reverse primer methyR4: GATTACTAGCGATTCCGACTTCATGCAGTC (SEQ ID NO.9)

[0046] The sequences of the four probes are shown below:

[0047] probe_methy1:

[0048] CCGTCCGCCACTCGTCATCTGGAGCAAGC(FAM-dT)C(THF)AA(BHQ1-dT)GTTACCGTTCGACT-C3-spacer

[0049] probe_methy2:

[0050] TCAGGCCTTCTTCACACACGTGGTATTGC(FAM-dT)G(THF)A(BHQ1-dT)CAGGCTTG CGCCCA-C3-spacer

[0051] probe_methy3:

[0052] AACGCGAAGAACCTTACCTACCCTTGACA(FAM-dT)A(THF)(BHQ1-dT)AAGAACTTT CCAGA-C3-spacer

[0053] probe_methy4:

[0054] GCAGACTGCAATCCGGACTAAGACCGGCT(FAM-dT)(THF)C(BHQ1-dT)GAGATTCGC TTACT-C3-spacer

[0055] To verify the amplification effects of 4 pairs of primers, the corresponding template sequences were synthesized, and the template sequences are as follows:

[0056] Methy_M1: ATTGAACGCTGGTGGTATGCTTAACACATGCAAGTCGAACGGTAACATT GGAGCTTGCTCCAGATGACGAGTGGCGGACGGGTGAGTAACGCGTAGGAATCTGCCTA GTA(SEQ ID NO.10)

[0057] Methy_M2: ACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATG GGCGCAAGCCTGATCCAGCAATACCACGTGTGTGAAGAAGGCCTGAGGGTTGTAAAGC ACTTTCAATTGGGA(SEQ ID NO.11)

[0058] Methy_M3: GCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAG AACCTTACCTACCCTTGACATACTAAGAACTTTCCAGAGATGGATTGGTGCCTTCGGGAGCTTAGATACAGGTGCTGCATGGCTGTCG(SEQ ID NO.12)

[0059] Methy_M4: CACGTGCTACAATGGCCGGTACAGAGGGCTGCAAACTCGCGAGAGTAA GCGAATCTCAGAAAGCCGGTCTTAGTCCGGATTGCAGTCTGCAACTCGACTGCATGAAGTCGGAATCGCTAGTAATCGCGAATCAGA (SEQ ID NO. 13)

[0060] 2. Establish a non-fluorescent RPA reaction system

[0061] Real-time RPA reactions were performed using the basic nucleic acid amplification reagent (catalog number S001ZC) from Hangzhou Zhongce Biotechnology Co., Ltd., in a volume of 50 μL. The RPA reaction system for each reaction tube consisted of: 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 0.8 μL of 10 μM probe, 25 μL of A Buffer (basal buffer) provided by the kit, 12.7 μL of ultrapure water, 5 μL of the designed DNA template (5 μL of ultrapure water for the negative control), and 2.5 μL of B Buffer (magnesium acetate solution) provided by the kit, for a total of 50 μL.

[0062] Add the reactants to each reaction tube in the following order: 12.7 μL ultrapure water, 25 μL A Buffer, 5 μL DNA template, 2 μL 10 μM forward primer, 2 μL 10 μM reverse primer, 0.8 μL 10 μM probe, and 2.5 μL B Buffer. Then place the reaction tubes in a PCR instrument and incubate at 39 °C for 10 min.

[0063] After the reaction was completed, 50 μL of Tris saturated phenol:chloroform:isoamyl alcohol (volume ratio 25:24:1) extraction buffer (product number P1012) produced by Beijing Solarbio Science & Technology Co., Ltd. was added to the detection unit tube. After shaking, the mixture was centrifuged at 12,000 rpm / min for 5 min. 8 μL of the supernatant was taken and mixed with 2 μL of 6× loading buffer (product number 9156) produced by Ltakara before electrophoresis detection.

[0064] Figure 1From left to right: methyF1 and methyR1 (Methy_M1), methyF2 and methyR2 (Methy_M2), methyF3 and methyR3 (Methy_M3), methyF4 and methyR4 (Methy_M4), 2k marker, methyF1 and methyR1 (negative control), methyF2 and methyR2 (negative control), methyF3 and methyR3 (negative control), and methyF4 and methyR4 (negative control). Electrophoresis results showed that the methyF1 and methyR1 primer pair had the best amplification effect, while the other primers (negative control) all showed obvious products. Subsequent fluorescent RPA was performed using the methyF1 and methyR1 primer pair.

[0065] 3. Establish a real-time fluorescent RPA reaction system

[0066] Real-time RPA reactions were performed using nucleic acid amplification reagent (fluorescent type) (catalog number S002ZC) from Hangzhou Zhongce Biotechnology Co., Ltd., in a volume of 50 μL. Primer pairs methyF1 and methyR1, probe probe_methy1, and template Methy_M1 were used. The RPA reaction system for each tube was as follows: 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 0.8 μL of 10 μM probe, 25 μL of A Buffer (fluorescent basal buffer) provided by the kit, 12.7 μL of ultrapure water, 5 μL of DNA template, and 2.5 μL of B Buffer (magnesium acetate solution) provided by the kit, for a total of 50 μL.

[0067] Add the reactants to each reaction tube in the following order: 12.7 μL ultrapure water, 25 μL A Buffer, 5 μL DNA template, 2 μL 10 μM forward primer, 2 μL 10 μM reverse primer, 0.8 μL 10 μM probe, and 2.5 μL B Buffer. Then place the reaction tubes in a fluorescence analyzer equipped with a miniature optical detector and react at 39 °C for 10 min.

[0068] 4. Stability and sensitivity tests

[0069] The stability of RPA was tested, and the combination of forward primer methyF1, reverse primer methyR1, and probe probe_methy1 produced a stable and specific amplification curve. Figure 2 The negative control was tested after adding reagents according to the kit instructions: 1 tube of reaction powder, 25 μL of A Buffer, 4 μL of C Buffer, 13.5 μL of pure water, 5 μL of negative control, 2.5 μL of B Buffer, and a total volume of 50 μL.

[0070] For sensitivity testing, the synthesized template Methy_M1 (sample template concentration 100 ng / μL) DNA was serially diluted 5 times. 1 5 2 5 3 5 4 Then, using the forward primer methyF1, the reverse primer methyR1, and the probe probe_methy1, RPA testing was performed, and stable RPA amplification fluorescence signals were detected in all cases. Figure 3 ).

[0071] Figure 3 This is the amplification curve of RPA under 10-fold serial dilution of DNA using the forward primer methyF1, reverse primer methyR1, and probe probe_methy1. To concentrate fluorescence collection, 20 cycles were set, each cycle lasting 30 seconds, for a total of 10 minutes. Undiluted DNA was 100 ng / μL, and 5-fold diluted DNA was 20 ng / μL. 2 Diluted 5 times to 4 ng / μL 3 Diluted 5 times to 0.8 ng / μL 4 The concentration was diluted to 0.16 ng / μL. The experimental results show that RPA exhibited fluorescence signal in the first cycle, and a clear curve appeared after 10 minutes of 20 cycles, with a detection limit of 0.16 ng / μL.

[0072] To compare the sensitivity of RPA and traditional qPCR, qPCR amplification was performed on templates serially diluted 5-fold using Novizan Biosciences' ChamQ Blue Universal SYBR qPCR Master Mix (catalog number Q312-02) according to the instructions. Stable RPA amplification fluorescence signals were detected in all cases. Figure 4 ).

[0073] Figure 4 This is the amplification curve of qPCR using a 5-fold serial dilution of DNA with the forward primer methyF1 and the reverse primer methyR1. The results show that the low-concentration qPCR only begins to show fluorescence after 10-15 cycles, and its sensitivity is significantly lower than that of RPA.

[0074] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer-probe combination for rapid detection of Methylmonas bacteria in cold spring water at a constant temperature, characterized in that, It includes an RPA primer pair and a fluorescent probe; the sequence of the RPA primer pair is as follows: Forward primer: 5'-ATTGAACGCTGGTGGTATGCTTAACACATG-3'; Reverse primer: 5'-ATTCCTACGCGTTACTCACCCGTCCGCCACTCGTC-3'; The sequence of the fluorescent probe is as follows: 5'-CCGTCCGCCACTCGTCATCTGGAGCAAGC(FAM-dT)C(THF)AA(BHQ1-dT)GTTACCGTTCGACT-C3-spacer-3'.

2. The application of the primer-probe combination according to claim 1 in the preparation of a kit for the rapid detection of Methylmonas in cold spring water at constant temperature.

3. A kit for rapid detection of Methylmonas bacteria in cold spring water at a constant temperature, characterized in that, It includes the primer-probe combination as described in claim 1.

4. The reagent kit according to claim 3, characterized in that, The kit also includes a fluorescent basic buffer, magnesium acetate, and ultrapure water.

5. The application of the primer-probe combination of claim 1 or the kit of claim 3 or 4 in the rapid detection of Methylmonas in cold spring water at constant temperature.

6. The application according to claim 5, characterized in that, The constant temperature is 39℃.

7. A method for rapid detection of Methylmonas bacteria in cold spring water at a constant temperature, characterized in that, Includes the following steps: a. Collect water samples from the cold spring to be tested and extract total environmental DNA; b. Using the DNA from step a as a template, perform real-time fluorescent recombinase polymerase amplification using the primer-probe combination described in claim 1 or the kit described in claim 3 or 4 to obtain the amplification product; c. If a fluorescent signal is present, the sample to be tested contains the target methylmona; if no fluorescent signal is present, the sample to be tested does not contain methylmona.

8. The method according to claim 7, characterized in that, The reaction system for real-time fluorescent recombinase polymerase amplification is as follows: 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 0.8 μL of 10 μM probe, 25 μL of fluorescent basal buffer, 12.7 μL of ultrapure water, 5 μL of DNA template, and 2.5 μL of magnesium acetate solution, totaling 50 μL.

9. The method according to claim 7 or 8, characterized in that, The reaction conditions for the real-time fluorescent recombinase polymerase amplification were: 39°C for 10 min.

10. The method according to claim 7 or 8, characterized in that, The concentration of the DNA is 100-150 ng / μL.

Images