Whole-cell biosensor for high-throughput detection and screening of cell envelope targeted antibiotics

Abstract

The invention discloses a whole-cell biosensor for high-throughput detection and screening of cell envelope targeted antibiotics. A sensing module in the sensor is derived from a promoter of an ABC transporter coding gene sco3089 in streptomyces coelicolor M1146; and the report module is derived from a luciferase coding gene cluster luxCDABE of the photobacterium. The sensing module and the report module are coupled to a chromosome of streptomyces coelicolor M1146, and the whole-cell biosensor WHY04 capable of sensitively sensing various cell envelope targeted antibiotics is obtained. According to the present invention, four representative cell envelope targeting antibiotics such as bacitracin, flavomycin, polymyxin E and vancomycin are adopted as examples, and based on the Hill model, the dose-effect relationship of WHY04 is represented and quantified by using the nonlinear least square method; the biosensor disclosed by the invention has an extremely low background response value and high detection sensitivity, can realize high-throughput screening and semi-quantitative detection of the cell envelope targeted antibiotics, and provides a more convenient tool and method for research in the fields of life science, medical diagnosis, environmental monitoring and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of synthetic biology and bioengineering, and in particular relates to a whole-cell biosensor for high-throughput detection and screening of cell envelope-targeted antibiotics. Background Art

[0002] In the process of human evolution and development, there has been a tug-of-war between disease and infection. It was not until the advent of antibiotics that people found a weapon to fight bacterial infections. The emergence of antibiotics has completely changed modern medicine and extended the average life expectancy of humans by at least 23 years.

[0003] The cell envelope includes the cell wall and the cell membrane below it. The cell envelope is mainly composed of lipopolysaccharide, peptidoglycan, lipoteichoic acid, teichoic acid and polysaccharide, etc. It has the functions of protecting cells, communicating with the external environment, maintaining cell morphological stability and cell rigidity, as well as cell metabolism, growth and division. It is precisely because of the important role played by the cell envelope in bacterial physiological activities that the cell envelope is one of the most important targets for antibiotics. For example, β-lactam antibiotics, bacitracin antibiotics, nucleoside antibiotics, lipopeptide antibiotics, polymyxin antibiotics, glycopeptide antibiotics, etc. all mainly act on the cell envelope. However, the irrational use of antibiotics can easily lead to a large amount of residues in food, animals, and the environment, so the problem of antibiotic residues has attracted more and more attention. For example, glycopeptide antibiotics represented by vancomycin have been listed as banned antibiotic additives in many countries. The Ministry of Health of my country also strictly prohibits the use of vancomycin for veterinary use and lists it as "non-food substances that may be illegally added." Adding zinc salt to bacitracin culture medium to generate a more stable bacitracin zinc complex is often used as a special antibiotic feed additive for livestock and poultry. A small amount of addition can promote the growth of livestock and poultry, but excessive addition will cause the problem of feed additive residues. These antibiotics are difficult to metabolize and degrade in animals, so after entering the human body through the food chain, they will pose a potential risk to human health. Therefore, how to quickly, conveniently and highly sensitively detect cell envelope-targeted antibiotics from complex sample matrices such as food and environment is one of the difficulties in preventing the abuse of cell envelope-targeted antibiotics. At present, the main methods for its detection include high-performance liquid chromatography (HPLC) and high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS). Although these methods integrate specificity and high sensitivity, they all require cumbersome pretreatment processes according to the complexity of the sample matrix, and require expensive detection equipment, well-trained inspectors, difficult operation, and high operating costs. They are not suitable for high-throughput screening and semi-quantitative detection of cell envelope-targeted antibiotic residues.

[0004] Whole-cell biosensors use specific recognition elements in cells as biosensors to detect specific biological molecules. Due to their low detection cost, low operating difficulty, high sensitivity and strong specificity, whole-cell biosensors have broad application prospects in biology, medicine, agriculture, animal husbandry and other fields. According to the different characteristics of the substances to be detected, how to choose the appropriate sensing module and reporting module is one of the difficulties in the design of whole-cell biosensors. In addition, the output signal response value (effect) of most whole-cell biosensors is not in a strict linear relationship with the input signal value (dose), and the dose-effect relationship of the biosensor cannot be characterized by the traditional linear regression model. Therefore, based on the characteristics of the experimental data, choosing a suitable mathematical model for data fitting is also one of the technical difficulties. Characterizing and quantifying the dose-effect curve through an appropriate mathematical model, so as to qualitatively analyze and quantitatively detect cell envelope-targeted antibiotics, is challenging but of great significance. Summary of the invention

[0005] The object of the present invention is to provide a whole-cell biosensor for high-throughput detection and screening of cell envelope-targeted antibiotics, thereby solving the problems existing in the above-mentioned prior art.

[0006] In order to achieve the above object, the present invention provides the following technical solution:

[0007] In the first aspect, the present invention provides a whole-cell biosensor for high-throughput detection and screening of cell envelope-targeted antibiotics, the biosensor comprising a sensing module and a reporting module; wherein the sensing module comprises the promoter region of the ABC transporter encoding gene sco3089 derived from Streptomyces coelicolor M1146; and the reporting module comprises the luciferase encoding gene cluster luxCDABE derived from Photorhabdus luminescens.

[0008] As an embodiment of the present invention, the promoter Psco3089 of the ABC transporter encoding gene sco3089 is derived from Streptomyces coelicolor M1146, and the DNA sequence is shown in SEQ ID NO.1.

[0009] As an embodiment of the present invention, the luciferase encoding gene cluster luxCDABE is derived from Photorhabdus luminescens, and the DNA sequence is shown in SEQ ID NO. 2. The luciferase encoding gene cluster luxCDABE is derived from Photorhabdus luminescens, and the sequence is codon optimized to improve the translation efficiency and expression level of its protein in Streptomyces coelicolor M1146.

[0010] In a second aspect, the present invention also provides a method for preparing a whole-cell biosensor for high-throughput detection and screening of cell envelope-targeted antibiotics, the method comprising coupling the sensing module with the reporting module and integrating them into the chromosome of Streptomyces coelicolor M1146, so that the constructed chassis host strain (WHY04) can sensitively sense the cell envelope-targeted antibiotics in the environment, accompanied by bioluminescence.

[0011] As an embodiment of the present invention, the method comprises the following steps:

[0012] S1, a plasmid for coupling the sensor module with the reporter module was constructed in Escherichia coli, named plasmid psco3089-lux;

[0013] S2. After enzyme digestion and sequencing verification, the plasmid psco3089-lux is transferred into Streptomyces coelicolor M1146 through inter-genus conjugation of Escherichia coli and Streptomyces. The chassis host strain is obtained by antibiotic screening and PCR verification, which is the whole-cell biosensor for high-throughput detection and screening of cell envelope-targeted antibiotics described in the present invention.

[0014] As an embodiment of the present invention, the plasmid psco3089-lux is a plasmid pSET152 multiple cloning site into which a total of four fragments are inserted, namely: the t0 terminator from λ phage, the tetracycline resistance gene screening marker, the promoter region of the ABC transporter encoding gene sco3089 contained in the sensing module, and the codon-optimized gene reporter module luciferase encoding gene cluster luxCDABE. The present invention is modified on the basis of the plasmid pVanHAX-lux constructed in the laboratory before (i.e., the t0 terminator, the PvanHAX promoter, and the codon-optimized luciferase encoding gene cluster luxCDABE are introduced into the multiple cloning site of the pSET152 plasmid, and the full sequence of the plasmid is shown in SEQ ID NO.8). The specific operation is as follows: using the plasmid containing the tetracycline resistance gene screening marker as a template, the tetracycline resistance gene screening marker fragment is amplified by primers T-tet-px-forlux-1-F / R; using the genomic DNA of Streptomyces coelicolor M1146 as a template, the Psco3089 promoter fragment is amplified by primers T-lux-3089-2-F / R. Note that when designing primers, a 20bp overlapping fragment needs to be designed at the junction of the two fragments, so that the tetracycline resistance gene screening marker and the Psco3089 promoter can be fused by overlapping PCR technology using primers T-tet-px-forlux-1-F and T-lux-3089-2-R to obtain the DNA fragment tet-Psco3089. The two ends of the DNA fragment tet-Psco3089 need to be PCR amplified by primers to introduce additional 39bp left and right homologous arms, so as to facilitate the homologous recombination of the DNA fragment with the pVanHAX-lux plasmid to be replaced in the Escherichia coli GB08-red host. By further using tetracycline antibiotics to screen the recombinants for resistance, the recombinant strain containing the target plasmid psco3089-lux can be successfully screened.

[0015] Among them, pSET152 is a commonly used plasmid for conjugal transfer between Escherichia coli and Streptomyces, which contains all the elements required for conjugative transfer and was reported in the literature Bierman M, Logan R, O'Brien K, Seno ET, Rao RN, Schoner BE. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 1992; 116(1): 43-49. doi: 10.1016 / 0378-1119(92)90627-2.

[0016] The tetracycline resistance gene screening marker sequence is shown in SEQ ID NO.3, and the primers used to amplify the fragment are:

[0017] Forward primer T-tet-px-forlux-1-F: 5′-GTTGCCGCCGGGCGTTTTTTATTGGTGAGAATCCAAGCACGCCGGCTTCCATTCA GGTC-3′, SEQ ID NO. 4;

[0018] Reverse primer T-tet-px-forlux-1-R: 5′-CGTTGTGGACAACAAGCCAG-3′, SEQ ID NO. 5;

[0019] The promoter sequence of Psco3089 is shown in SEQ ID NO.1. The primers used to amplify the fragment are:

[0020] Forward primer T-lux-3089-2-F: 5′-CTGGCTTGTTGTCCACAACGCGGGCGGGACGGCCGATGTT-3′, SEQ ID NO.6;

[0021] Reverse primer T-lux-3089-2-R: 5′-GACCTGGCCGTTGATGATGAACGAGATCTTCTTCGTCATGGGAAGGGCGCTCCTG TCGG-3′, SEQ ID NO. 7;

[0022] The whole-cell biosensor of the present invention can sensitively sense cell capsule-targeted antibiotics in the environment, and is accompanied by bioluminescence. Taking the four commonly used cell capsule-targeted antibiotics, bacitracin, flavonoids, polymyxin E and vancomycin, as examples, when different concentrations of bacitracin, flavonoids, polymyxin E and vancomycin antibiotic standards act on the chassis host WHY04, the bioluminescence intensity produced by the host is nonlinearly correlated with the four different concentrations of antibiotic standards, and this type of dose-effect curve conforms to the Hill model. On this basis, the present invention further uses the nonlinear least squares method encapsulated by the scipy.optimize module in Python to highly fit the dose-effect curve of the whole-cell biosensor WHY04, further accurately characterizes and quantifies the dose-effect relationship, and establishes a scientific, accurate and convenient method for detecting the content of cell capsule-targeted antibiotics. And the sensor background response value is extremely low, no other chemical reaction reagents need to be added, short time consumption, low cost, and high specificity, and it is easy to achieve high-throughput screening and semi-quantitative detection of cell capsule-targeted antibiotics.

[0023] The Hill model equation is:

[0024]

[0025] Where x represents the concentration of the antibiotic standard; a represents the background response value, that is, the bioluminescent signal value detected when there is no antibiotic standard; k represents the maximum output bioluminescent signal value; n represents the Hill coefficient; K M represents the concentration of the antibiotic standard when the output bioluminescent signal value is half of the maximum output bioluminescent signal value; f(x) and LU represent the output bioluminescent signal value. The Hill model was reported in the literature Goutelle S, Maurin M, Rougier F, et al. The Hill equation: a review of its capabilities in pharmacological modelling. Fundam Clin Pharmacol. 2008; 22(6): 633-648. doi: 10.1111 / j.1472-8206.2008.00633.x.

[0026] The whole-cell biosensor WHY04 provided by the present invention has a dose-effect relationship corresponding to treatment with different types and concentrations of antibiotics for 4 hours. It is found that the luminescence intensity of WHY04 is extremely low when there is no antibiotic, but it is significantly increased after contacting the antibiotic for 4 hours, indicating that the whole-cell biosensor of the present invention has the advantages of extremely low background response value and short time consumption. The present invention uses the nonlinear least squares method encapsulated by the scipy.optimize module in Python to successfully simulate and calculate the Hill model equation corresponding to the dose-effect relationship after treatment with different types and concentrations of antibiotics for 4 hours, laying a solid theoretical foundation for high-throughput screening and semi-quantitative detection of cell envelope-targeted antibiotics.

[0027] Taking the four common cell envelope targeting antibiotics bacitracin, flavonoids, polymyxin E and vancomycin as examples, combined with the dose-effect curve corresponding to the biosensor WHY04, the sample to be tested is added to WHY04. By measuring the bioluminescence intensity of WHY04, it is possible to determine whether the sample contains the corresponding antibiotics that act on the cell envelope or to perform a semi-quantitative analysis of the concentration of relevant antibiotics in the sample.

[0028] Therefore, in a third aspect, the present invention provides a whole-cell biosensor for high-throughput detection and screening of cell envelope-targeted antibiotics in detecting cell envelope-targeted antibiotics. The cell envelope-targeted antibiotics are active compounds that can induce the promoter (Psco3089) of the ABC transporter encoding gene sco3089 in Streptomyces coelicolor M1146 to initiate transcription, including but not limited to vancomycin, teicoplanin, A47934, ampicillin, bacitracin, polymyxin B, polymyxin E, flavomycin, daptomycin, etc.

[0029] In a fourth aspect, the biosensor described in the present invention can specifically recognize cell envelope-targeted antibiotics including but not limited to vancomycin, teicoplanin, A47934, ampicillin, bacitracin, polymyxin B, polymyxin E, flavonoids, daptomycin, and the like.

[0030] In a fifth aspect, the present invention provides a method for semi-quantitative detection of cell envelope-targeted antibiotics using a whole-cell biosensor for high-throughput detection and screening of cell envelope-targeted antibiotics, the method comprising the following steps:

[0031] A1. Based on the biosensor and cell envelope-targeted antibiotic standard solutions of different concentrations, the dose-response curve is highly fitted using the Hill model and the nonlinear least squares method encapsulated by the scipy.optimize module in Python to obtain a fitting function;

[0032] The Hill model equation is:

[0033]

[0034] Where x represents the concentration of the antibiotic standard; a represents the background response value, that is, the bioluminescent signal value detected when there is no antibiotic standard; k represents the maximum output bioluminescent signal value; n represents the Hill coefficient; K M It indicates the concentration of the antibiotic standard when the output bioluminescent signal value is half of the maximum output bioluminescent signal value; f(x) and LU indicate the output bioluminescent signal value;

[0035] A2. Add the sample to be tested into the biosensor, measure the bioluminescence intensity; substitute into the fitting function to calculate and obtain the concentration of the corresponding antibiotic in the sample to be tested.

[0036] The dose-effect curve was further fitted using the nonlinear least squares method encapsulated by the scipy.optimize module in Python, including the following steps:

[0037] B1. Using Python, the experimental data x and f(x) are input data and stored in arrays respectively;

[0038] B2. Customize the function func so that its mathematical expression is consistent with the mathematical expression of the Hill model, and customize the four parameters: a, k, n and K M ;

[0039] B3. Using the least squares method, use the curve_fit function in scipy.optimize to solve the optimal values ​​of the four parameters in the custom function func in step B2, and then calculate the best fitting function.

[0040] In a sixth aspect, the present invention provides a Streptomyces coelicolor M1146-WHY04, whose deposit number is CGMCC NO. 27690. The chromosome of the strain is integrated with the aforementioned sensing module and reporting module.

[0041] The chassis host Streptomyces coelicolor M1146-WHY04 involved in the present invention has been deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration (No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with a Latin name of Streptomyces coelicolor M1146-WHY04, a preservation date of June 25, 2023, and a preservation number of CGMCC NO.27690.

[0042] Previously developed whole-cell biosensors have certain disadvantages, such as high background response values, low detection specificity, the need for additional chemical reaction reagents, and the inability to accurately quantitatively characterize the dose-effect relationship in the sensor. These limitations greatly limit the potential application of whole-cell biosensors in the field of biotechnology.

[0043] Compared with the prior art, the present invention has the following beneficial effects:

[0044] The whole-cell biosensor WHY04 for high-throughput detection and screening of cell envelope-targeted antibiotics described in the present invention has an extremely low background response value, does not require the addition of other chemical reaction reagents, is time-saving, low-cost, and has high specificity, and is easy to achieve high-throughput screening and semi-quantitative detection of cell envelope-targeted antibiotics. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0046] Figure 1is a schematic diagram of plasmid psco3089-lux;

[0047] Figure 2 This is the dose-effect curve of the whole-cell biosensor WHY04 treated with different types and concentrations of antibiotics for 4 hours. DETAILED DESCRIPTION

[0048] The present invention is described in detail below in conjunction with examples. The following examples will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, some adjustments and improvements can be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention. The experimental methods for which specific conditions are not specified in the following implementation cases are in accordance with conventional conditions or the recommended conditions of the manufacturer.

[0049] Example 1. Preparation of whole-cell biosensor WHY04 for high-throughput detection and screening of cell envelope-targeted antibiotics

[0050] S1, construction of plasmid psco3089-lux for coupling the sensor module with the reporter module in Escherichia coli;

[0051] Figure 1 Figure 2 is a schematic diagram of plasmid psco3089-lux. Figure 1 As shown, the plasmid psco3089-lux is a plasmid pSET152 multiple cloning site into which a total of four fragments are inserted, namely: the t0 terminator from λ phage, the tetracycline resistance gene screening marker, the promoter region of the ABC transporter encoding gene sco3089 contained in the sensing module, and the codon-optimized gene reporter module luciferase encoding gene cluster luxCDABE. The present invention is modified on the basis of the plasmid pVanHAX-lux constructed in the laboratory before (i.e., the t0 terminator, the PvanHAX promoter, and the codon-optimized luciferase encoding gene cluster luxCDABE are introduced into the multiple cloning site of the pSET152 plasmid).

[0052] Firstly, the plasmid containing the tetracycline resistance gene selection marker was used as a template, and the tetracycline resistance gene selection marker fragment was amplified by primers T-tet-px-forlux-1-F / R; the genomic DNA of Streptomyces coelicolor M1146 was used as a template, and the Psco3089 promoter fragment was amplified by primers T-lux-3089-2-F / R. Note that when designing primers, a 20 bp overlapping fragment needs to be designed at the junction of the two fragments to facilitate the use of primers T-tet-px-forlux-1-F and T-lux-3089-2-R through overlapping PCR technology (PCR reaction system: 2×Phanta Max Buffer, 25μL; dNTP Mix, 1μL; upstream primer, 2μL; downstream primer, 2μL; Phanta Max Super-Fidelity DNA Polymerase, 1μL; template DNA, 1μL; ddH2O, 18μL; PCR reaction kit is from Nanjing Novozymes Biotechnology Co., Ltd., product number: P505) to fuse the tetracycline resistance gene screening marker with the Psco3089 promoter to obtain the DNA fragment tet-Psco3089 (sequence see SEQID NO.9). The two ends of the DNA fragment tet-Psco3089 already contain additional 39bp left and right homology arms (the left and right homology arm sequences are indicated in the primers below as underlined), which facilitates the homologous recombination of the DNA fragment with the pVanHAX-lux plasmid to be replaced in the E. coli GB08-red host. By further using tetracycline antibiotics to screen the recombinants for resistance, the recombinant strain containing the target plasmid psco3089-lux can be successfully screened. In order to verify the correctness of the construction of the plasmid psco3089-lux, the target plasmid was double-digested with NheI and BcuI restriction endonucleases. If the digested fragments of 3,373bp, 4,599bp and 5,241bp were obtained, it means that the plasmid psco3089-lux was constructed correctly.

[0053] Among them, pSET152 is a commonly used plasmid for conjugal transfer between Escherichia coli and Streptomyces, which contains all the elements required for conjugative transfer and was reported in the literature Bierman M, Logan R, O'Brien K, Seno ET, Rao RN, Schoner BE. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 1992; 116(1): 43-49. doi: 10.1016 / 0378-1119(92)90627-2.

[0054] The tetracycline resistance gene screening marker sequence is shown in SEQ ID NO.3, and the primers used to amplify the fragment are:

[0055] Forward primer T-tet-px-forlux-1-F: 5′- GTTGCCGCCGGGCGTTTTTTATTGGTGAGAATCCAAG CA CGCCGGCTTCCATTCA GGTC-3′, SEQ ID NO.4;

[0056] Reverse primer T-tet-px-forlux-1-R: 5′-CGTTGTGGACAACAAGCCAG-3′, SEQ ID NO. 5;

[0057] The promoter sequence of Psco3089 is shown in SEQ ID NO.1. The primers used to amplify the fragment are:

[0058] Forward primer T-lux-3089-2-F: 5′-CTGGCTTGTTGTCCACAACGCGGGCGGGACGGCCGATGTT-3′, SEQ ID NO. 6;

[0059] Reverse primer T-lux-3089-2-R: 5′- GACCTGGCCGTTGATGATGAACGAGATCTTCTTCGTCAT GGGAAGGGCGCTCCTG TCGG-3′, SEQ ID NO.7;

[0060] S2. The plasmid psco3089-lux constructed in step S1 is integrated into Streptomyces coelicolor M1146 by inter-genus transfer of Escherichia coli and Streptomyces, and the chassis host WHY04 is obtained by antibiotic screening and PCR verification, which is the whole-cell biosensor for high-throughput detection and screening of cell envelope-targeted antibiotics described in the present invention.

[0061] The plasmid psco3089-lux constructed in step S1 was introduced into the host ET12567 / pUZ8002 by calcium transformation method. The strain ET12567 / pUZ8002 was reported in the literature Paget MS, Chamberlin L, Atrih A, Foster SJ, Buttner MJ. Evidence that the extracytoplasmic function sigma factor sigmaE is required for normal cell wall structure in Streptomyces coelicolor A3(2). J Bacteriol. 1999; 181(1): 204-211. doi: 10.1128 / JB.181.1.204-211.1999. The transformant was cultured overnight at 37°C in LB culture medium containing chloramphenicol (50 μg / mL), kanamycin (50 μg / mL), apramycin (50 μg / mL) and tetracycline (5 μg / mL). The overnight culture was transferred to LB culture medium containing chloramphenicol (50 μg / mL), kanamycin (50 μg / mL), apramycin (50 μg / mL) and tetracycline (5 μg / mL) at a ratio of 10% and cultured for 3 hours. The cells were then washed twice with fresh LB culture medium without antibiotics to fully remove the antibiotics in the culture. At the same time, about 10 fresh spores of Streptomyces coelicolor M1146 were prepared. 8 After rinsing with TES solution 2-3 times, spores were suspended with 0.5 mL TES solution, heat-shocked in a 50°C water bath for 10 min, quickly cooled to room temperature, and then an equal volume of 2× spore pre-germination culture medium (formula: Difco yeast extract 1%, Difco casamino acid 1%, CaCl2 0.1M (5M stock solution needs to be prepared, separately sterilized at high temperature and added to the yeast extract / casamino acid solution)) was added, and then cultured at 37°C for 2.5 hours for spore pre-germination. Spores were collected by centrifugation, and the spores were rinsed twice with LB culture medium without antibiotics, and then the spores were resuspended in an appropriate amount of LB culture medium, fully shaken on a mixer to break up the spores, and then the spores were cultured according to 10 7 :10 8After mixing with Escherichia coli cells at a donor-acceptor ratio, the mixture was evenly spread on a MS solid culture medium without antibiotics (formula: 20g agar, 20g mannitol and 20g soybean cake powder, distilled water to 1L, and pH adjusted to 7.0). After the plate was blown dry, it was transferred to a 30℃ incubator and cultured for 17 hours. The plate was taken out and covered with 1.5mL sterile water containing apramycin (1mg), tetracycline (100μg) and nalidixic acid (1mg) on ​​the MS solid culture medium plate. After the plate was blown dry, it was transferred to a 30℃ incubator for culture. Generally, single colony conjugates can be seen growing on the plate after 4 to 5 days.

[0062] Example 2. Dose-effect curve characterization of whole-cell biosensor WHY04 for high-throughput detection and screening of cell envelope-targeted antibiotics

[0063] The application method takes representative cell envelope-targeted antibiotics "bacitracin, flavonoids, polymyxin E and vancomycin" as an example, and specifically includes the following steps:

[0064] S1. Inoculate WHY04 spores into TSBY liquid medium (formula: 30 g Oxoiid tryptic soy broth powder, 103 g sucrose, 5 g Difco yeast extract, distilled water to 1 L, pH 7.2), culture at 220 rpm, 30°C for 36 h, then transfer to 20 mL TSBY liquid medium at a ratio of 5%, and continue to culture at 220 rpm, 30°C until OD600 is about 0.3;

[0065] S2, preparing standard stock solutions containing different concentrations of bacitracin, flavonoids, polymyxin E and vancomycin (0, 12.5, 25, 125, 250, 500, 1000, 2000 μg / mL);

[0066] S3. Evenly aspirate 480 μL of bacterial solution with an OD600 of about 0.3 from step S1 each time, add 20 μL of stock solution containing different concentrations of antibiotic standards, and prepare different antibiotic treatment samples with final concentrations of 0, 0.5, 1, 5, 10, 20, 40, and 80 μg / mL; after mixing, take 60 μL and add it to a 96-well white plate.

[0067] S4. After 4 h of antibiotic treatment, the bioluminescence intensity (Luminescence units, LU) of WHY04 produced under different concentrations of antibiotic induction conditions was measured using Spark multifunctional microplate reader;

[0068] S5. Based on the Hill model, the dose-response curve was highly fitted using the nonlinear least squares method encapsulated by the scipy.optimize module in Python to further characterize and quantify the dose-response relationship. The mathematical formula of the Hill model is:

[0069]

[0070] Where x represents the concentration of the antibiotic standard; a represents the background response value, that is, the bioluminescent signal value detected when there is no antibiotic standard; k represents the maximum output bioluminescent signal value; n represents the Hill coefficient; K M represents the concentration of the antibiotic standard when the output bioluminescent signal value is half of the maximum output bioluminescent signal value; f(x) and LU represent the output bioluminescent signal value; the Hill model was reported in the literature Goutelle S, Maurin M, Rougier F, et al. The Hill equation: a review of its capabilities in pharmacological modelling. Fundam Clin Pharmacol. 2008; 22(6): 633-648. doi: 10.1111 / j.1472-8206.2008.00633.x.

[0071] S6. In Python, the experimental data obtained in step S4 (different types and concentrations of antibiotics and corresponding bioluminescence intensities) are used as input data and stored in arrays;

[0072] S7. Customize the function func in Python so that its mathematical expression is consistent with the mathematical expression of the Hill model described in step S5, and customize the four parameters: a, k, n and K M ;

[0073] S8. Using the least squares method, use the curve_fit function in scipy.optimize to solve the optimal values ​​of the four parameters in the custom function func, and then calculate the best fitting function and perform plotting and visualization analysis.

[0074] The four parameters in the dose-effect curve of the whole-cell biosensor WHY04 obtained at 4 hours are shown in Table 1 below:

[0075] Table 1

[0076] antibiotic a k n <![CDATA[K M ]]> Bacitracin 4.09E-15 5212.34785 0.8461197 24.8464837 Flavomycin 18.5264663 300 1.26994434 23.2813452 Polymyxin E 12.802444 1603.00535 2.0975776 22.8403678 Vancomycin 3.47E-19 1004.70724 1.91150755 10.641067

[0077] Among them, the standard deviation corresponding to each parameter in Table 1 is calculated through the covariance matrix corresponding to each parameter, and the specific values ​​are shown in Table 2 below:

[0078] Table 2

[0079] antibiotic a k n <![CDATA[K M ]]> Bacitracin 89.2886418 759.73754 0.13119779 8.71042799 Flavomycin 11.869255 74.9334457 0.45419453 10.5331111 Polymyxin E 21.238113 79.2503774 0.23197652 1.55257263 Vancomycin 34.772515 77.9117031 0.44008832 1.38539496

[0080] Figure 2 This is the dose-effect curve of the whole-cell biosensor WHY04 treated with different types and concentrations of antibiotics for 4 hours. Figure 2 It can be seen that the bioluminescence intensity of the whole-cell biosensor WHY04 is nonlinearly related to the antibiotic induction concentration and conforms to the Hill model. The bioluminescence intensity of WHY04 has an extremely low response value when there is no inducing antibiotic, but it increases significantly after 4 hours of contact with inducing antibiotics, indicating that the whole-cell biosensor of the present invention has the advantages of extremely low background response value, short detection time and large dynamic response range.

[0081] Example 3: Application of the whole-cell biosensor WHY04 for high-throughput detection and screening of cell envelope-targeted antibiotics

[0082] This example takes representative cell envelope-targeted antibiotics "bacitracin, flavonoids, polymyxin E and vancomycin" as an example to further illustrate the application method of the biosensor WHY04. The specific application method includes the following steps:

[0083] S1. According to the WHY04 dose-effect curve characterization method described in Example 2, the dose-effect curve equation corresponding to WHY04 treated with different types of antibiotics for 4 hours was analyzed and calculated to obtain the dose-effect function relationship f(x) between the WHY04 bioluminescent signal value and the antibiotic concentration. The function relationship satisfies the following characteristics:

[0084]

[0085] Where x represents the concentration of the antibiotic standard; a represents the background response value, that is, the bioluminescent signal value detected when there is no antibiotic standard; k represents the maximum output bioluminescent signal value; n represents the Hill coefficient; K M It indicates the concentration of the antibiotic standard when the output bioluminescent signal value is half of the maximum output bioluminescent signal value; f(x) and LU indicate the output bioluminescent signal value;

[0086] S2. Add the sample to be tested into WHY04, measure the bioluminescence intensity of WHY04 corresponding to the treatment for 4 hours, and substitute this value as the dependent variable into the dose-effect function relationship expression f(x) obtained in step S1, and finally calculate the specific value of the independent variable x. The obtained x is the concentration of the corresponding antibiotic in the sample.

[0087] In summary, the whole-cell biosensor for high-throughput detection and screening of cell envelope-targeted antibiotics provided by the present invention includes a sensing module and a reporting module. Among them, the sensing module is composed of the promoter of the ABC transporter encoding gene sco3089 from Streptomyces coelicolor M1146; the reporting module is composed of the luciferase encoding gene cluster luxCDABE from Photobacterium luminescens. The present invention utilizes molecular biology techniques and genetic engineering means to couple the sensing module with the reporting module, and integrates it into the chromosome of Streptomyces coelicolor M1146, so that the constructed chassis host WHY04 can sensitively sense a series of cell envelope-targeted antibiotics, accompanied by bioluminescence. Taking the commonly used cell envelope-targeted representative drugs bacitracin, flavonoids, polymyxin E and vancomycin as examples, the luminescence intensity of WHY04 is extremely low in the absence of antibiotics, and significantly increases after contacting the cell envelope-targeted antibiotics for 4 hours, and the generated bioluminescence intensity is nonlinearly related to the antibiotic concentration, and this type of dose-response curve (dose-response curve) conforms to the Hill model. On this basis, the present invention uses the nonlinear least squares method encapsulated by the scipy.optimize module in Python to highly fit the dose-effect curve corresponding to the whole-cell biosensor WHY04, further characterizes and quantifies the dose-effect relationship, and establishes a scientific, accurate and convenient method for qualitative analysis and semi-quantitative detection of cell envelope-targeted antibiotics. The whole-cell biosensor constructed by the present invention has an extremely low background response value, does not require the addition of other chemical reaction reagents, does not require sample pretreatment, is time-consuming, low-cost, easy to operate, and has high specificity, and is easy to achieve high-throughput screening and semi-quantitative detection of cell envelope-targeted antibiotics.

[0088] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A whole-cell biosensor for high-throughput detection and screening of cell envelope-targeted antibiotics, characterized in that: The biosensor includes a sensing module and a reporting module; wherein the sensing module includes the promoter region of the ABC transporter encoding gene sco3089 derived from Streptomyces coelicolor M1146; and the reporting module includes the luciferase encoding gene cluster luxCDABE derived from Photorhabdus luminescens.

2. The whole-cell biosensor for high-throughput detection and screening of cell envelope-targeted antibiotics according to claim 1, characterized in that: The DNA sequence of the promoter Psco3089 of the ABC transporter encoding gene sco3089 is shown in SEQ ID NO.

1.

3. The whole-cell biosensor for high-throughput detection and screening of cell envelope-targeted antibiotics according to claim 1, characterized in that: The DNA sequence of the luciferase encoding gene cluster luxCDABE is shown in SEQ ID NO.

2.

4. A method for preparing a whole-cell biosensor for high-throughput detection and screening of cell envelope-targeted antibiotics according to claim 1, characterized in that: The method includes coupling the sensing module with the reporter module and integrating them into the chromosome of Streptomyces coelicolor M1146.

5. The preparation method according to claim 4, characterized in that: The method comprises the following steps: S1, a plasmid for coupling the sensor module with the reporter module was constructed in Escherichia coli, named plasmid psco3089-lux; S2. After restriction digestion and sequencing verification, the plasmid psco3089-lux was transferred into Streptomyces coelicolor M1146 through inter-genus conjugation of Escherichia coli and Streptomyces. After antibiotic screening and PCR verification, the chassis host strain WHY04 was obtained, which is the biosensor.

6. The preparation method according to claim 5, characterized in that: The plasmid psco3089-lux is constructed by inserting four fragments into the multiple cloning site of the plasmid pSET152, namely: the t0 terminator derived from λ phage, the tetracycline resistance gene screening marker, the promoter Psco3089 of the ABC transporter encoding gene sco3089 of the sensing module, and the reporter module luciferase encoding gene cluster luxCDABE.

7. A Streptomyces coelicolor M1146-WHY04, whose deposit number is CGMCCNO.27690.

8. Use of the whole-cell biosensor for high-throughput detection and screening of cell envelope-targeted antibiotics according to claim 1 or the strain according to claim 7 in detecting multiple cell envelope-targeted antibiotics.

9. A method for semi-quantitative detection of cell envelope targeted antibiotics using the whole-cell biosensor for high-throughput detection and screening of cell envelope targeted antibiotics as claimed in claim 1 or the strain as claimed in claim 7, characterized in that: The method comprises the following steps: A1. Based on the biosensor or strain and different concentrations of bacitracin, flavonoids, polymyxin E, and vancomycin standard solutions, the dose-response curve is fitted using the nonlinear least squares method encapsulated by the scipy.optimize module in Python based on the Hill model to obtain a fitting function; The Hill model equation is: Where x represents the concentration of the antibiotic standard; a represents the background response value, that is, the bioluminescent signal value detected when there is no antibiotic standard; k represents the maximum output bioluminescent signal value; n represents the Hill coefficient; K M It indicates the concentration of the antibiotic standard when the output bioluminescent signal value is half of the maximum output bioluminescent signal value; f(x) and LU indicate the output bioluminescent signal value; A2. Add the sample to be tested into the biosensor and measure the bioluminescence intensity signal value; substitute the value into the function obtained by fitting the corresponding antibiotic standard to calculate the concentration of the corresponding antibiotic in the sample to be tested.

Images