New diagnosis and treatment marker CD36 for age-related cognitive hypofunction and application

Abstract

The invention particularly relates to a novel diagnosis and treatment marker for age-related cognitive hypofunction and application of the novel diagnosis and treatment marker, in particular to application of CD36 in diagnosis and treatment of age-related cognitive hypofunction. Bioinformatics analysis and exploration prove that the CD36 has good correlation with the age-related cognitive hypofunction, in-vivo and in-vitro experiments prove that the CD36 is closely related to the progress of the age-related cognitive hypofunction, a new diagnosis and treatment marker is provided for clinical diagnosis and treatment of the age-related cognitive hypofunction, and the application has important clinical significance.

Description

Technical Field

[0001] The present invention specifically relates to new diagnostic and therapeutic markers for age-related cognitive impairment and their applications, and specifically relates to the application of CD36 in diagnostic or therapeutic products for age-related cognitive impairment. Background Art

[0002] Aging is an inevitable stage in the life process. As we age, the brain gradually enters the aging process. Cognitive function is an important part of brain function and is inevitably affected by aging, showing various forms of decline in memory, language ability, attention, judgment, and executive function, which greatly affects the quality of daily life and is an important risk factor for various neurodegenerative diseases including Alzheimer's disease (AD). These diseases not only bring huge burdens to families and society, but also pose a severe public health challenge. Since age-related cognitive impairment is a multidimensional and multifaceted complex process, it is an important and arduous task to explore the specific pathogenesis of age-related cognitive impairment and find effective methods to prevent and treat age-related cognitive impairment. CD36 belongs to the class B scavenger receptor family and is a highly glycosylated transmembrane glycoprotein expressed in a variety of cells, including microglia, microvascular endothelial cells, astrocytes, and neurons, and is involved in a variety of physiological and pathological processes, including immune inflammatory responses, angiogenesis, lipid metabolism, and atherosclerosis. The present invention uses bioinformatics methods, C57 common mice, and in vitro experimental studies to explore the role of neuronal CD36 in the development and progression of age-related cognitive impairment. The role of CD36 in the diagnosis and treatment of age-related cognitive impairment provides an experimental basis and research direction for subsequent in-depth research, and is expected to provide new strategies for the diagnosis and treatment of age-related cognitive impairment. Summary of the invention

[0003] One object of the present invention is to provide an application of CD36 in the preparation of a product for diagnosing or predicting prognosis of age-related cognitive impairment. In order to achieve the above technical purpose, the present invention first studies the expression of CD36 in the posterior cingulate gyrus of brain tissue of elderly people with Alzheimer's disease and healthy control people, and finds that the expression of CD36 in the posterior cingulate gyrus of brain tissue of elderly people with Alzheimer's disease increases; further, we observed the changes in CD36 and cognitive function of C57 mice with age. The results showed that with age, the expression of CD36 in the brain increased, the number of neurons decreased, and cognitive function declined. Further in vitro cell experiments were carried out, and it was found that the expression of CD36 increased after aging of mouse hippocampal neuronal cells (HT22), and after CD36KO (HT22KO cells) of HT22 cells, the aging-associated secretory phenotype (SASP) showed significant improvement. According to the above research results, CD36 can be preliminarily used as a marker for age-related cognitive impairment, which can be used for the diagnosis or prognosis prediction of age-related cognitive impairment. The present invention provides the use of CD36 in the preparation of age-related cognitive impairment diagnosis or prognosis prediction products. Furthermore, the present invention provides the use of a reagent for detecting CD36 expression in the preparation of a product for diagnosing age-related cognitive impairment or predicting prognosis. The reagent includes a reagent for detecting the expression amount of CD36, the reagent includes a nucleic acid that binds to CD36 or its DNA sequence, and the nucleic acid includes a PCR amplification primer used when using SYBR Green, TaqMan probe, molecular beacon, double hybridization probe or composite probe to detect the expression amount of CD36. Furthermore, the age-related cognitive impairment diagnosis or prognosis prediction product includes a chip, a test strip or a kit. The chip includes a reagent for detecting the expression of CD36, the reagent includes a nucleic acid that binds to CD36 or its DNA sequence, and the nucleic acid includes a probe that can detect the expression of CD36. The kit includes an antibody against a certain peptide segment when using Western blot, ELISA, chemiluminescence or immunofluorescence to detect the expression amount of CD36 protein. The present invention also provides the use of CD36 in screening and preparing a pharmaceutical composition for treating age-related cognitive impairment. The present invention also provides a pharmaceutical composition for treating age-related cognitive impairment, wherein the pharmaceutical composition comprises an agent or compound that inhibits CD36 expression. The pharmaceutical composition of the present invention can be administered as a medicine alone or together with other drugs. The pharmaceutical composition of the present invention can be prepared into various preparations as required, including but not limited to tablets, solutions, granules, patches, ointments, capsules, aerosols or suppositories for transdermal, mucosal, nasal, buccal, sublingual or oral administration. The administration route of the pharmaceutical composition of the present invention is not limited, as long as it can exert the desired therapeutic effect or preventive effect. In some cases, it can be administered systemically, and in some cases it can be administered locally. The dosage of the pharmaceutical composition of the present invention is not limited as long as the desired therapeutic effect or preventive effect is obtained, and can be appropriately determined based on symptoms, gender, age, etc. The dosage of the therapeutic pharmaceutical composition or preventive pharmaceutical composition of the present invention can be used, for example, for the treatment of a disease. The present invention has discovered a marker for diagnosing and treating age-related cognitive impairment, and provides a new use of CD36 in the preparation of a method or product for diagnosing or predicting prognosis of age-related cognitive impairment. It provides a new target for the diagnosis and treatment of clinical age-related cognitive impairment. BRIEF DESCRIPTION OF THE DRAWINGS

[0004] Figure 1 This is the analysis of CD36 expression in the posterior cingulate gyrus of brain tissue in different groups of people, *P<0.05. Figure 2 The above are the analysis diagrams of CD36 expression and cognitive function of C57 mice with age; A is the result of immunofluorescence staining of C57 mice, B is the change diagram of Y-maze of mice, and C is the change diagram of novel object recognition (NOR), *P<0.05. Figure 3 These are the expressions of mRNA related to mouse hippocampal neuron cells (HT22); A is the expression of CD36 after senescence of HT22 cells, and B is the expression of SASP after senescence of HT22 KO cells, *P<0.05. DETAILED DESCRIPTION

[0005] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. Those skilled in the art should understand that these specific embodiments and examples are used to illustrate the present invention, not to limit the present invention. Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by technicians in the field to which the present invention belongs. If there is a conflict, this specification takes precedence. Unless otherwise specifically stated, the various raw materials, reagents, instruments and equipment used in the present invention can be purchased on the market or can be obtained by existing methods. The following will be combined with examples and experimental data to describe the application of CD36 in the diagnosis or treatment of age-related cognitive impairment in diagnostic or therapeutic products. Example 1: Bioinformatics analysis of human populations Gene chips (GSE5281) were collected from the GEO database, including 74 normal controls and 87 elderly patients with Alzheimer's disease. The posterior cingulate gyrus of brain tissue plays an important role in cognition, including 13 normal controls and 9 elderly patients with Alzheimer's disease. Differential expression analysis was performed using R language, and a box plot was made of the expression of CD36 in the posterior cingulate gyrus of brain tissue of the two groups of people. Example 2: Animal Experiment (1) C57BL6 / J mice C57BL6 / J mice were obtained from the Experimental Animal Center of Chongqing Medical University. All experimental animals were adaptively raised under standard diet and water conditions (24-25°C, humidity 60±5%, 12 h light / darkness) and handled in accordance with the Chongqing Medical University Laboratory Animal Management Regulations and NIH Laboratory Animal Protection Principles. (2) Animal brain tissue collection: Anesthetize the mouse, peel off the epidermis on the back of the mouse, cut it open along the rear end of the mouse head approximately behind the foramen magnum, carefully insert the curved front part of the elbow forceps into the foramen magnum, pry the skull to the left and right sides to completely expose the mouse's brain, insert the front end of the elbow forceps into the front end of the mouse's brain, slowly peel off the brain tissue, embed it in OCT, quickly freeze it in a -20℃ refrigerator, and then transfer it to a -80℃ refrigerator for later experiments. Example 3: Y-maze The mouse was placed with its back facing up in the A arm of the Y-maze and used as the starting point for observation for 8 minutes. In the alternation task, the mouse visited three arms in sequence (without repetition, i.e., ABC, ACB, BAC, BCA, CAB, and CBA), which was counted as one alternation. The autonomous alternation rate was calculated as the number of consecutive different alternations / (total number - 2)*100%. Example 4: New Object Recognition The mouse was placed in a corner at the same distance from the two objects and allowed to adapt to the environment for 5 minutes (the time spent exploring the two objects was recorded); after 4 hours, one of the objects was replaced and the mouse was placed in the device again to explore the two objects for 5 minutes (the time spent exploring the two objects was recorded); the cognitive index (RI) calculation formula was: RI = new object exploration time / (new object exploration time + old object exploration time) * 100% Example 5: Immunofluorescence staining of brain tissue The brain tissue was frozen, embedded and cut into 20 μm sections. The sections were fixed with 4% paraformaldehyde for 10 min, rinsed with PBS, and dried; incubated with 0.3% Triton-100 for 5 min, rinsed with PBS, and dried; the 5X antigen retrieval solution was diluted to 1X, incubated for 5 min, rinsed with PBS 3 times, and dried; 5% BSA was prepared with PBS to block at room temperature for 1 h, and then the primary antibody was diluted with 5% BSA at a dilution ratio of 1:100, and incubated at 4°C overnight; the primary antibody was aspirated, rinsed with PBS 3 times, and the corresponding secondary antibody was diluted with PBS at a dilution ratio of 1:200 to dry; the secondary antibody was incubated at room temperature and away from light for 1 h, washed with PBS, dried, and sealed with an anti-fluorescence quencher containing DAPI; fixed coverslips were stored at 4°C away from light. Example 6: Cell experiment Cell experiments (1) HT22 cell culture HT22 cells were cultured in DMEM medium, with 10% fetal bovine serum and 1% penicillin-streptomycin mixed solution added to the medium. The cell culture conditions were set at 37°C in an incubator with saturated humidity and 5% carbon dioxide concentration. After culturing HT22 cells for about 48 hours, the cells were replaced with a medium and passaged every 3-4 days. (2) HT22 cell treatment HT22 KO cells were transfected with lentiviral vectors to knock out CD36. Cell senescence was induced by etoposide (ETO) or doxorubicin (DOX) at a final concentration of 2 μM or 0.5 μM, respectively. The cells were incubated in a medium containing drugs for two days. After two days, etoposide or doxorubicin was removed, and the cells were washed with PBS and added with a fresh DMEM medium mixture to recover for 4 days, with the medium changed halfway. (3) Cryopreservation of HT22 cells When freezing cells, transfer the cell culture medium to a centrifuge tube, centrifuge at 800 rpm for 3 minutes, remove the supernatant after centrifugation, and then add cell freezing solution to resuspend the cells. The components of the cell freezing solution include fetal bovine serum and DMSO, with a volume ratio of 9:1. Transfer the freezing solution containing cells to a sterile cryopreservation tube, then transfer it to a cryopreservation box, and then transfer it to a -80℃ refrigerator overnight. The next day, the frozen cells are placed in a liquid nitrogen tank for long-term storage for later recovery and reuse. (4) HT22 cell recovery The experimental operation was carried out strictly in accordance with the principle of "slow freezing and fast thawing" for cell cryopreservation and recovery. When the cells were recovered, the cells were quickly removed from the liquid nitrogen and quickly transferred to a 37°C water bath. The cell cryopreservation tube was continuously shaken to melt the cell cryopreservation solution in the shortest time. The recovered cell cryopreservation solution was then added to a centrifuge tube and centrifuged at 800 rpm for 3 minutes. The supernatant after centrifugation was removed and the HT22 cell pellet was resuspended with fresh and clean cell culture medium. The resuspended cells were transferred to a cell culture dish and cultured in a 37°C incubator to complete the cell recovery. Example 7: RNA extraction from HT22 cells (1) Cell lysis: After washing with PBS three times, add 1 ml of RNAiso Plus directly to the 6-well plate and pipette repeatedly to transfer the cells completely to an enzyme-free EP tube. Let the tube stand at room temperature for 5-10 min to fully lyse the cells. Centrifuge at 4°C, 12,000 g, and centrifuge for 15 min. Remove the supernatant and record the amount. (2) Extract RNA: Add 1 / 5 volume of chloroform to the supernatant, mix by inversion for 15 seconds, and let stand at room temperature for 5-10 minutes; centrifuge at 4°C, 12,000 g, and remove the supernatant and record the amount. (3) Precipitating RNA: Add an equal amount of isopropanol to the supernatant, gently invert and mix, and let stand at room temperature for 10 min; centrifuge at 4°C, 12,000 g for 10 min, discard the supernatant and keep the precipitate. (4) Cleaning RNA: Dilute anhydrous ethanol to 75% ethanol with DEPC water, take 1 ml and add it to the precipitate. Invert the EP tube upside down to thoroughly wash the RNA precipitate; centrifuge at 4°C, 12,000 g for 10 min, discard the supernatant and keep the precipitate. (5) Dissolving RNA: After the precipitate is dried naturally, add an appropriate amount of sterile DEPC water to dissolve the RNA. Use a nucleic acid meter to measure the RNA content and store at -80°C for future use. Example 8: mRNA reverse transcription and QRT-PCR detection (1) RT-PCR (Reverse Transcription PCR) After extraction, RNA reverse transcription and other further operations must be performed on ice. The experimental reaction system for reverse transcription of mRNA into cDNA is as follows: 5X PrimeScript RT Master Mix 4μl Total RNA 1μl RNase Free ddH2O 15ul The reaction conditions were as follows: 37°C for 15 min, 85°C for 5 s, and terminated by cooling at 4°C. (2) Real-Time PCR analysis and detection, The Real-Time PCR reaction system is as follows: 2x SP qPCR Mix 10μl PCR forward primer 0.25 μl PCR reverse primer 0.25 μl DEPC water 8.5 μl DNA template 1μl Total 20μl The reaction conditions were as follows: 94°C pre-denaturation for 1 min, 94°C denaturation for 10 s, 54°C annealing for 10 s, 72°C extension for 10 s, 39 cycles, and the Ct value of each sample and internal reference was recorded. The calculation formula is as follows: Relative quantification of target gene = 2 －△△Ct . (3) Primer sequence: Gene name Primer sequence (5' to 3' direction) 36B4 upstream primer AGATTCGGGATATGCTGTTGGC 36B4 downstream primer TCGGGTCCTAGACCAGTGTTC CD36 upstream primer ATGGGCTGTGATCGGAACTG CD36 downstream primer TTTGCCACGTCATCTGGGTTT IL-6 upstream primer TAGTCCTTCCTACCCCAATTTCC IL-6 downstream primer TTGGTCCTTAGCCACTCCTTC CCL2 upstream primer CCCACTCACCTGCTGCTACT CCL2 downstream primer TCTGGACCCATTCCTTCTTG In summary, the present application found through bioinformatics methods that CD36 is significantly more expressed in the posterior cingulate gyrus of brain tissue of elderly Alzheimer's patients than in normal controls. C57BL6 / J mice were also found to have increased CD36 expression and cognitive impairment with age. Further cell experiments found that CD36 KO could reduce the expression of aging-related secretory phenotypes, indicating that CD36 can be used as a potential biological marker for diagnosing age-related cognitive impairment. Finally, it should be noted that the terms "comprises", "includes" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device that includes a series of elements includes not only those elements, but also other elements that are not explicitly listed, or also includes elements that are inherent to such process, method, article or device. Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they are aware of the basic creative concepts. Therefore, the attached claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention. Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. The use of reagents for detecting CD36 levels in the preparation of products for diagnosing, predicting and treating the progression, staging and prognosis of age-related cognitive impairment.

2. The use according to claim 1, characterized in that: The reagents include reagents for detecting CD36 gene levels, or reagents for detecting CD36 protein levels.

3. The use according to claim 2, characterized in that: The reagents for detecting CD36 gene levels include probes for specific gene recognition, primers for specific gene amplification, or primers for specific SNP site detection; the reagents for detecting CD36 protein levels include specific chemiluminescence detection reagents, specific immunofluorescence detection reagents, specific antibodies for CD36 protein, or specific binding reagents.

4. Application of CD36 in screening pharmaceutical compositions for treating age-related cognitive impairment.

5. Application of CD36 in the preparation of a pharmaceutical composition for the treatment of age-related cognitive impairment.

6. A pharmaceutical composition for treating age-related cognitive impairment, characterized in that: The pharmaceutical composition includes an agent or compound that regulates CD36 expression.

Images