SNP molecular markers related to waist circumference on pig chromosome 4 and their applications

Abstract

This invention discloses a SNP molecular marker located on pig chromosome 4 that is associated with waist circumference and its application. The SNP molecular marker is located at position 134 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 22721111 bp on chromosome 4 in International Pig Reference Genome Version 11.1, where a C>T mutation exists. The SNP molecular marker provided by this invention is significantly correlated with the waist circumference trait in pigs. By identifying the genotype of this SNP molecular marker, the waist circumference trait in pigs can be identified. Furthermore, by selecting pigs with the CC genotype of the SNP molecular marker, the pig breeding process can be accelerated, achieving genetic improvement of pigs.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology and relates to a SNP molecular marker related to pig waist circumference and its application. The SNP molecular marker is located on pig chromosome 4. Background Technology

[0002] Currently, pig breeding focuses on large-weight, lean-type pigs, with the primary breeding goal being to produce lean-type breeding pigs suitable for large-weight market weight. Waist circumference is a crucial indicator for selecting and retaining large-weight, lean-type pigs for breeding. In actual production, pigs with larger waist circumferences often exhibit higher growth performance and better economic benefits. For decades, traditional breeding methods have been used to obtain superior breeding pigs with higher market weights. However, waist circumference is a complex quantitative trait, regulated by multiple genes. Furthermore, the waist circumference trait only meets measurement requirements after pigs have reached a certain age. Therefore, improving quantitative traits through traditional breeding methods cannot achieve early selection, is time-consuming, and yields minimal results. Summary of the Invention

[0003] The purpose of this invention is to provide a SNP molecular marker located on pig chromosome 4 that is related to waist circumference and its application.

[0004] According to one aspect of the present invention, a SNP molecular marker related to waist circumference is provided on pig chromosome 4, the site of which is located at position 134 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 22721111 bp on chromosome 4 of the International Pig Reference Genome Version 11.1. This site contains a C>T mutation (single base mutation, named: g.22721111C>T), the nucleotide type of which is C or T, and the genotype of the SNP molecular marker is CC, CT or TT.

[0005] The SNP molecular marker provided by this invention is significantly correlated with the waist circumference trait in pigs. Specifically, pigs with the CC genotype have a significantly larger waist circumference than pigs with the CT and TT genotypes. By identifying the single nucleotide polymorphism (SNP) of this SNP molecular marker and / or the genotype of this SNP molecular marker, the waist circumference trait in pigs can be identified. Furthermore, by selecting pigs with the CC genotype of the SNP molecular marker, the pig breeding process can be accelerated, achieving genetic improvement in pigs.

[0006] Therefore, the SNP molecular marker related to waist circumference on pig chromosome 4 provided by this invention can be applied to:

[0007] (1) Identify the characteristics of pig waist circumference;

[0008] (2) Prepare products for identifying the characteristics of pig waist circumference;

[0009] (3) Pig genetic improvement: pig genetic improvement is achieved by selecting pigs with the SNP molecular marker genotype CC.

[0010] (4) Prepare a product for assisting in the genetic improvement of pigs, the product being based on the identification of pig SNP molecular marker genotypes to assist in the genetic improvement of pigs.

[0011] In some embodiments, the pigs are preferably Duroc strains or their synthetic strains.

[0012] According to another aspect of the present invention, a primer pair is provided that can specifically amplify an amplified fragment containing the single nucleotide polymorphism at position 134 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3.

[0013] The primer pair provided by this invention can specifically amplify fragments containing the SNP molecular marker related to waist circumference on pig chromosome 4 provided by this invention. This can be used to identify whether the single nucleotide at position 134 from the 5' end in the nucleotide sequence shown in SEQ ID NO:1 is C or T. Therefore, the primer pair provided by this invention can be used to identify the genotype of the SNP molecular marker related to waist circumference on pig chromosome 4 and / or to prepare products for identifying the genotype related to waist circumference on pig chromosome 4.

[0014] According to a third aspect of the present invention, a kit is provided comprising primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3.

[0015] The applications of the primer pairs and kits provided by this invention include, but are not limited to:

[0016] (1) Identify the genotype of SNP molecular markers related to waist circumference located on chromosome 4 of pigs;

[0017] (2) Prepare products to identify the genotypes of SNP molecular markers related to waist circumference located on chromosome 4 of pigs;

[0018] (3) Identify the waist circumference trait in pigs. The identification of the waist circumference trait in pigs is achieved by identifying the genotype of the SNP molecular markers related to waist circumference located on chromosome 4 of pigs.

[0019] (4) Prepare a product for identifying the waist circumference trait in pigs, wherein the product is based on identifying the genotype of the SNP molecular markers related to waist circumference located on chromosome 4 of pigs to identify the waist circumference trait;

[0020] (5) Pig genetic improvement, based on the selection of pigs with the SNP molecular marker genotype CC located on chromosome 4 of pigs and related to waist circumference to achieve pig genetic improvement;

[0021] (6) Prepare a product for assisting in the genetic improvement of pigs, said product being based on the identification of SNP molecular marker genotypes on chromosome 4 of pigs that are associated with waist circumference to assist in the genetic improvement of pigs.

[0022] In some embodiments, the kit provided by the present invention may further include: dNTPs, DNA polymerase, and Mg. 2+ The components of a standard PCR reaction system, including PCR reaction buffer, can be directly referenced or adopted from the relevant components of commercially available PCR amplification kits.

[0023] According to a fourth aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps:

[0024] (1) Determine the genotype of the SNP molecular markers related to waist circumference located on chromosome 4 of pigs;

[0025] (2) Select individuals with the SNP molecular marker genotype CC and eliminate individuals with the genotypes CT and TT, and increase the frequency of the allele C at this locus generation by generation; thereby improving the waist circumference of offspring pigs and increasing the meat yield of offspring pigs.

[0026] In some implementations, step (1), determining the genotype of the pig's SNP molecular marker associated with waist circumference located on chromosome 4, includes the following steps:

[0027] Whole-genome DNA was extracted from pigs and amplified by PCR using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3. The amplified products were sequenced, and the genotype of the pig's SNP molecular marker related to waist circumference located on chromosome 4 was determined based on the sequencing results.

[0028] In some implementations, the pigs are Duroc breeds and their synthetic lines. Duroc, as the terminal sire for Duroc × Landrace × Large White commercial pigs, directly impacts the economic benefits of pig farms. Therefore, improving the waist circumference of the core group of Duroc pigs can significantly transfer the resulting advantages to offspring, enhancing the competitiveness of commercial pigs and thus improving the economic efficiency of the farm.

[0029] Compared with the prior art, the beneficial effects of the present invention include:

[0030] (1) This invention provides a SNP molecular marker related to waist circumference located on the nucleotide sequence of pig chromosome 4 and verifies its effect on pig waist circumference trait. It helps to establish a molecular marker-assisted selection breeding technology for rapid improvement of pig waist circumference trait, improve the breeding process of Duroc and its synthetic lines, so as to meet the needs of the breeding pig market, increase the price of breeding pigs, and reduce breeding costs.

[0031] (2) This invention provides a primer pair that can be used to identify SNP molecular markers related to waist circumference located on chromosome 4 of pigs. Through this primer pair, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select traits and accelerate the breeding process.

[0032] (3) This invention provides a method for pig genetic improvement by selecting the dominant allele of the SNP molecular marker related to waist circumference on chromosome 4 of pigs. By selecting the dominant allele of the SNP, the frequency of the dominant allele can be increased generation by generation, thereby increasing the waist circumference of breeding pigs and indirectly increasing the weight of breeding pigs, thus accelerating the progress of pig genetic improvement and effectively improving the economic benefits of breeding pigs. Specifically, all individuals with TT or CT type SNP molecular markers that affect the waist circumference trait of pigs are selected to be CC type individuals. Attached Figure Description

[0033] Figure 1 This is a genome-wide association (GWAS) diagram of waist circumference on chromosome 4 for the Canadian Duroc strain;

[0034] Figure 2 This is a graph showing the results of waist circumference phenotypic ratio analysis of pigs with different genotypes, where ns indicates P>0.05; ** This indicates that P < 0.01; *** This indicates that P < 0.001. Detailed Implementation

[0035] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0036] Example 1: Identification and Validation of SNP Loci Related to Pig Waist Circumference

[0037] (1) Experimental pig herd

[0038] The experimental pig herd used in this invention consisted of purebred Canadian Duroc pigs from the breeding pig division of Wens Foodstuff Group Co., Ltd., representing the core herd of the company, with detailed pedigree records. A total of 2080 Canadian Duroc pigs were selected from this resource group for this experiment. The pigs had free access to feed and water, and the feeding methods and rearing conditions remained consistent throughout the entire process, following conventional methods.

[0039] Phenotypic Measurement: The phenotypic measurement of pig waist circumference in this invention is performed accurately using a soft measuring tape according to the specified method, with an accuracy of cm. When the pig's live weight reaches 100±5 kg, it is fasted for 24 hours. Before measurement, the pig must be restrained until it stands naturally. The soft measuring tape is then gently placed against the body surface for measurement. The measurement method is as follows:

[0040] Waist circumference: The vertical circumference measured at the waist position (the area in front of the hind leg).

[0041] (2) Extraction of porcine genomic DNA

[0042] Ear tissue or tail tissue from piglets was collected from the above 2080 Duroc pigs and soaked in a 75% ethanol solution. The tissue was then stored at -20°C for later use.

[0043] Whole-genome DNA was extracted from pigs using the standard phenol-chloroform method. The concentration and OD ratio (OD260 / 280, OD260 / 230) of each sample were accurately determined using a NanoDrop 2000 / 2000C nucleic acid and protein analyzer. DNA samples that passed the NanoDrop 2000 / 2000C nucleic acid and protein analyzer test were diluted to approximately 50 ng / μL. 6 μL of the extracted DNA sample was then mixed with 2 μL of loading buffer and loaded onto a 1% (w / v) agarose gel. Electrophoresis was performed at 150 V for 25 min. The DNA integrity was observed and photographed using a UV spectrophotometer and gel imaging device.

[0044] (3) Detection of 50K SNP genotypes in the whole pig genome

[0045] DNA samples were sent to Neogene Biotech (Shanghai) Co., Ltd., where the pig whole genome 50K SNP chip (Illumina, USA) genotype was determined on the Illumina Beadstration platform according to the company's standard procedures.

[0046] To increase the SNP marker density and improve the success rate of identifying key mutation sites for waist circumference, this invention uses the SWIM website (http: / / 192.168.142.36:9088 / # / home) to fill the 50K SNP chip of the entire genome of the above-mentioned Canadian Duroc pigs. The genotypic filling data of all samples were quality controlled using PLINK software, removing individuals with a detection rate below 90%, a family Mendelian error rate above 0.1, a minimum allele frequency below 0.01, and a Hardy-Weinberg equilibrium significance level below 10. -6 The SNPs were analyzed, and ultimately, 11,388,559 valid genotype data for SNPs were obtained.

[0047] (4) Genome-wide association analysis (GWAS)

[0048] To eliminate the population stratification effect, this invention employs a linear mixed model with single-point regression analysis combined with GWAS analysis using the GenABEL software package in R. The analysis model utilizes the similarity of genomes among individuals to correct for the stratification effect. Given the assumption that the number of independent haplotype frames (ISFFs) is substantially the same in pigs and humans, this invention references the significance threshold in the human genome, setting the significance threshold for the association between SNPs and waist circumference traits to 1 × 10⁻⁶. -6 .

[0049] GWAS analysis results are as follows Figure 1 As shown.

[0050] from Figure 1 It is known that in the Canadian Duroc line, there is a significant SNP locus on chromosome 4 that significantly affects waist circumference, with the strongest association being g.22721111C>T (P = 9.96 × 10⁻⁶). -7 ), that is, the 134th nucleotide from the 5' end in SEQ NO.1, corresponds to the C>T mutation at position 22721111bp on chromosome 4 in International Pig Reference Genome Version 11.1.

[0051] (5) Analyze the association between different genotypes and the waist circumference phenotype of breeding pigs to verify the influence of SNP loci on the waist circumference trait in pigs.

[0052] The results are shown in Table 1. Figure 2 As shown in Table 1. Figure 2The SNP locus g.22721111C>T was found to be highly significantly correlated with waist circumference (P<0.001), indicating that this molecular marker significantly affects waist circumference in pigs. Specifically, pigs with the CC genotype had significantly larger waist circumferences than those with the CT and TT genotypes, suggesting that homozygous CC is advantageous for waist circumference in breeding pigs. Waist circumference is a crucial indicator for selecting and retaining lean-type pigs. In actual production, pigs with larger waist circumferences have larger market weights and better economic benefits. Therefore, CT and TT genotypes are not conducive to breeding pigs aiming for large market weights. During breeding, it is necessary to gradually eliminate CT and TT genotype pigs and retain CC genotype pigs to increase the frequency of the C allele at this locus through successive generations.

[0053] Table 1. Correlation analysis of SNP locus g.22721111C>T with waist circumference.

[0054]

[0055] Note: Different lowercase letters in the superscript of data in the same column indicate significant differences (P<0.05), while the same letter indicates no significant differences (P>0.05).

[0056] (6) Effect analysis

[0057] This invention provides a SNP molecular marker that is significantly associated with the waist circumference trait in Duroc breeding pigs. Using this SNP molecular marker for marker-assisted selection can accelerate the waist circumference breeding process in Duroc pigs. As shown in Table 1, the frequency of the dominant allele C at the SNP locus g.22721111C>T is 0.666 in the population. Therefore, by using molecular marker-assisted selection to gradually cull pigs with genotypes CT and TT within the population, the allele frequency of allele C can be significantly increased, thereby increasing the waist circumference of breeding pigs, indirectly increasing the weight of breeding pigs, accelerating the improvement of lean-type pigs, and thus effectively improving the economic benefits of pig breeding.

[0058] Example 2: Methods for genetic improvement of pigs

[0059] The target fragment containing SNP sites significantly associated with the waist circumference trait of the Duroc line is a 239 bp nucleotide sequence from chromosome 4, the specific sequence of which is shown in SEQ ID NO:1, and the primer pairs for its PCR amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0060] SEQ ID NO:1

[0061] ACGTATGTGTTACAGAGCAGTATAACAAGATTCATAACAATAAGAAGAAAACAAAATAGTTCGGGTTTAATGAAAGTGGCCCTCTTTGTCTATCTAGCATATTTGATAACAATTTAAGATCTGCATTTGAAGG Y GGTGAAACGGCAGAAAATAACATTCCCTTGGTTATTATTACAAAGTGGTTAGAAAGATGAAGTAAACACCTACCTCCGATTTATTTAGTCAGCATTTTACCTAAAATATTTCCTAAACAGGCAAGTTTAAAAGGGACT

[0062] The Y marked in the sequence is the mutation site, which is C or T, indicating an allele mutation; the bolded beginning and end of the sequence indicate the primer binding position.

[0063] Upstream primer primer-F: 5'-ACGTATGTGTTACAGAGCAGT-3' (SEQ ID NO:2);

[0064] Downstream primer primer-R: 5'-AGTCCCTTTTAAACTTGCCTGT-3' (SEQ ID NO:3).

[0065] The genetic improvement methods for pigs include the following steps:

[0066] S1. Determine the genotype of SNP molecular markers related to waist circumference in pigs.

[0067] (1) Collect ear tissue from pigs or tail tissue from piglets, extract whole genome DNA from pigs using the standard phenol-chloroform method, and then perform quality testing and concentration determination on the extracted DNA.

[0068] (2) PCR amplification

[0069] Prepare a 10 μL mixture, including: 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O. The PCR mix can be commercially available 2×Taq PCR Star Mix (Dye) (manufacturer: GenStar, catalog number: A012-101), which includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0070] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, with a final extension at 72℃ for 5 min.

[0071] (3) DNA sequence sequencing identification

[0072] The PCR amplification products were sequenced, and gene fragments were measured in both forward and reverse reactions. Based on the sequencing results, the genotype of the pig SNP site g.22721111C>T was determined.

[0073] S2. Select pigs with the SNP locus genotype CC as parents for breeding, and increase the frequency of the allele C at this locus generation by generation.

[0074] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. The application of a reagent for detecting SNP molecular markers related to waist circumference located on porcine chromosome 4, characterized in that, The SNP molecular marker is located at position 22721111 bp on chromosome 4 of the International Swine Reference Genome Version 11.

1. The nucleotide type at this site is C or T, and the genotype of the SNP molecular marker is CC, CT, or TT. The single nucleotide polymorphism of the SNP molecular marker site affects the waist circumference trait in pigs. Specifically, pigs with the SNP molecular marker genotype CC have a larger waist circumference than pigs with the genotypes CT and TT. The pigs in question are Canadian Duroc breeds. The applications include: (1) Identify the characteristics of pig waist circumference; (2) Prepare products for identifying the characteristics of pig waist circumference; (3) Pig genetic improvement, based on breeding pigs with the SNP molecular marker genotype CC located on chromosome 4 of pigs that is related to waist circumference, in order to increase the waist circumference of pigs; (4) Prepare a product for assisting in the genetic improvement of pigs, said product being based on identifying pigs with the genotype CC, a molecular marker of waist circumference associated with the SNP located on chromosome 4 of the pig, in order to improve the waist circumference of the pigs.

2. The application according to claim 1, characterized in that, The reagent is a primer pair, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

3. A method for genetic improvement of pigs, characterized in that, Includes the following steps: (1) Determine the genotype of the SNP molecular markers related to waist circumference located on chromosome 4 of pigs; (2) Select individuals with the SNP molecular marker genotype CC and eliminate individuals with the genotypes CT and TT, and increase the frequency of the allele C at this locus generation by generation. The SNP molecular marker associated with waist circumference on pig chromosome 4 is located at position 134 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 22721111 bp on chromosome 4 in International Pig Reference Genome Version 11.

1. The nucleotide type at this site is C or T, and the genotype is CC, CT or TT. The pigs in question are Canadian Duroc breeds.

4. The method for genetic improvement of pigs according to claim 3, characterized in that, In step (1), the method for determining the genotype of the SNP molecular marker related to waist circumference located on chromosome 4 of pigs includes the following steps: Whole-genome DNA was extracted from pigs and amplified by PCR using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3. The amplified products were sequenced, and the genotype of the pig's SNP molecular marker related to waist circumference located on chromosome 4 was determined based on the sequencing results.

Images