Resecting reagent containing glycine-NaOH buffer solution and application of resecting reagent in nucleic acid sequencing

Abstract

The invention provides an excision reagent containing a glycine-NaOH buffer solution and application of the excision reagent in nucleic acid sequencing. The invention also provides a sequencing kit containing the excision reagent, a method for excising a polynucleotide 3 '-end blocking group and a sequencing method. In the polynucleotide sequencing process, the scheme can accelerate the excision efficiency of the 3 '-end blocking group, effectively improve the sequencing Q30, reduce Lag and Runon, and improve the sequencing quality.

Description

Excision reagent containing glycine-NaOH buffer and its application in nucleic acid sequencing Technical Field

[0001] The invention belongs to the field of sequencing, and in particular relates to an excision reagent containing a glycine-NaOH buffer, a kit containing the excision reagent, and application of the reagent in polynucleotide sequencing. Background Art

[0002] First-generation sequencing is a sequencing technology based on the Sanger method. In comparison, second-generation sequencing is based on massively parallel sequencing technology, which can simultaneously complete the synthesis of complementary chains of sequencing templates and the acquisition of sequence data. Third-generation sequencing is based on single-molecule sequencing and massively parallel sequencing (MPS) technology. Second-generation sequencing is currently the mainstream sequencing technology. Generally speaking, second-generation sequencing technology includes three consecutive steps: 1. Adding dNTPs to the sequencing reaction system; 2. Detecting the base type of the dNTP added to the sequencing system; 3. Elution reaction to remove various enzymes, fluorescent markers, or blocking groups at the 3' end of the dNTP in the reaction. This series of consecutive steps realizes "sequencing by synthesis."

[0003] The current mainstream mcMPS (multi-copy base signal acquisition unit MPS) technology is based on the "non-continuous polymerization sequencing method" to realize the reading of nucleotide sequences. In each round of polymerization reaction, the "base extension" of different nucleic acid molecules in the same "base signal acquisition unit" is not completely synchronized. Some individual nucleic acid molecules may not undergo the expected polymerization extension or may undergo unexpected polymerization extension reactions greater than one time. For example, for a specific nucleic acid molecule, after the sequencer completes one polymerization extension and signal acquisition, the block (blocking group) marked on the 3' end of the reversible terminal terminator cannot be removed and reduced to "-OH" normally. This will directly lead to the inability of the nucleic acid molecule to undergo normal polymerization extension in the next sequencing cycle, thereby continuously generating "lag signals" (Phasing or Lag) in subsequent sequencing cycles. Similarly, if the 3' end blocking group of the reversible terminal terminator, which serves as the raw material for the polymerization reaction, is missing or ineffectively blocked, the specific nucleic acid molecule will complete a polymerization extension reaction greater than one base, thereby continuously generating "pre-phasing signals" (Pre-phasing or Runon) in subsequent sequencing cycles, which is the marathon effect. As the sequencing reaction proceeds, the "marathon effect" of different nucleic acid molecules in the same "base signal acquisition unit" will become more and more serious.

[0004] The MGISEQ-2000RS high-throughput rapid sequencing reagent set is fast and efficient, completing sequencing requirements in a short time. It is particularly suitable for samples with low data volumes and urgent needs, especially for tumor detection. The MGISEQ-2000RS high-throughput sequencing kit uses combined probe-anchored polymerization (cPAS) technology to polymerize DNA molecular anchors and fluorescent probes on DNA nanospheres (DNBs). The optical signal is collected using a high-resolution imaging system and digitized to obtain high-quality and highly accurate sample sequence information.

[0005] The MGISEQ-2000RS high-throughput sequencing kit also exhibits run-ons and lags during sequencing. Therefore, rapid and effective removal of the 3'-end blocking group is crucial to sequencing speed and accuracy. Kit components need to be optimized to accelerate and thoroughly remove the blocking group.

[0006] Summary of the Invention

[0007] To address the problem of insufficient speed and efficiency in excision of 3'-end blocking groups during sequencing in the prior art, the present invention provides an excision reagent containing a glycine-NaOH buffer and its use in nucleic acid sequencing. The inventors discovered that for excision of the reversible blocking group at the 3' end of dNTPs, a slightly alkaline buffer solution is more conducive to excision, i.e., accelerating the excision speed and thoroughness, thereby reducing advances and lags, particularly lags, during sequencing. Conventionally, a Tris-HCl buffer system is used as an excision solution, but this fails to meet the strong alkalinity requirement, i.e., a pH greater than 9.0. Analysis has shown that the reaction of azide with THPP and the hydrolysis of the ester to form the 3'-end hydroxyl group both require strong alkaline conditions. The present invention, for the first time, utilizes a glycine-sodium hydroxide buffer system in a sequencing excision reagent to accelerate excision efficiency and improve sequencing quality. Use of this reagent in sequencing kits will improve the sequencing quality of the product, increasing its value and market share.

[0008] To solve the above problems, one of the solutions of the present invention provides a resection reagent comprising a glycine-sodium hydroxide buffer.

[0009] In a specific embodiment, the glycine-sodium hydroxide buffer further comprises a 3'-terminal blocking group excision agent. The 3'-terminal blocking group excision agent is, for example, THPP, TCEP, or DTT. When in use, the excision agent is located in well 9 of the sequencing reagent reservoir.

[0010] In a specific embodiment, the pH range of the glycine-sodium hydroxide buffer is greater than 9, specifically 9-12, more specifically 9.6-10.6, such as 9.6, 10 or 10.6.

[0011] Preferably, the pH of the glycine-sodium hydroxide buffer is 10.6.

[0012] In a specific embodiment, the concentration of the 3'-end blocking group cleavage agent, such as THPP, is 5-30 mM, such as 5 mM, 10 mM, 20 mM or 30 mM.

[0013] Preferably, the concentration of the 3'-end blocking group removal agent is 20 mM.

[0014] To solve the above problems, a second solution of the present invention provides a sequencing kit, which includes the excision reagent as described in one of the solutions of the present invention.

[0015] In a specific embodiment, the sequencing kit further comprises one or more of DNA nanoballs, sequencing slides, MDA polymerase, dNTPs, and scanning reagents.

[0016] To solve the above problems, the third solution of the present invention provides a method for removing the 3'-terminal blocking group of a polynucleotide, which uses the removal reagent described in one of the solutions of the present invention to remove the 3'-terminal blocking group to expose the 3'-terminal hydroxyl group.

[0017] In a specific embodiment, the conditions for excision are as follows: a temperature of 30-60°C, and / or a time of 1-5 seconds. Preferably, the temperature is 30-40°C, 40-50°C, or 50-60°C, for example, 30°C, 40°C, 50°C, or 60°C. Preferably, the temperature is 50°C and the time is 2 seconds.

[0018] To solve the above problems, a fourth solution of the present invention provides a sequencing method, which comprises the following steps:

[0019] (1) Loading the nucleic acid to be tested onto the sequencing slide;

[0020] (2) contacting the nucleic acid to be tested with sequencing reagents, such as dNTP molecules and DNA polymerase;

[0021] (3) Recording signals;

[0022] (4) Using the excision reagent described in one embodiment of the present invention or the sequencing kit described in the second embodiment of the present invention, the 3'-terminal blocking group is removed to expose the 3'-terminal hydroxyl group; the above steps are repeated multiple times until sequencing is completed.

[0023] Specifically, the method comprises the following steps:

[0024] (1) Using the sequencing kit described in the second embodiment of the present invention, loading DNA nanospheres;

[0025] (2) Use MDA polymerase to add dNTP molecules to the parent strand of DNA;

[0026] (3) Recording signals;

[0027] (4) Using the excision reagent described in one embodiment of the present invention or the sequencing kit described in the second embodiment of the present invention, the 3'-terminal blocking group is removed to expose the 3'-terminal hydroxyl group; the above steps are repeated multiple times until sequencing is completed.

[0028] Preferably, the cycle is performed 50-400 times, for example 50, 100, 150, 200 or 400 times. During use, the scanning reagent is located in well 10 of the sequencing reagent tank.

[0029] To solve the above problems, the fifth solution of the present invention provides an application of the excision reagent as described in one of the solutions of the present invention or the sequencing kit as described in the second solution of the present invention in polynucleotide sequencing or the preparation of reagents for polynucleotide sequencing.

[0030] On the basis of conforming to the common sense in this field, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0031] The reagents and raw materials used in the present invention are commercially available.

[0032] The positive progress effects of the present invention are:

[0033] This invention is the first to use a glycine-sodium hydroxide buffer system in a sequencing excision reagent to accelerate excision efficiency and improve sequencing quality. Using this reagent in sequencing kits will improve sequencing quality, thereby increasing product value and market share. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] FIG1 shows the effect of the glycine-sodium hydroxide buffer system on Lag (lag) in sequencing.

[0035] FIG2 shows the effect of the glycine-sodium hydroxide buffer system on Runon (advance) in sequencing. DETAILED DESCRIPTION

[0036] Example 1 Preparation of reagents and sequencing

[0037] 1. Experimental equipment: MGISEQ-2000RS sequencer, MGIDL-200H loader, MGISEQ-2000RS sequencing slide, the excitation wavelengths of the instruments are 532nm and 650nm, respectively.

[0038] 2. Reagents and raw materials used in the experiment

[0039] Ammonium bicarbonate (analytical grade), N-ethylmaleimide, ultrapure water, and E. coli single-stranded circular DNA as a template (Standard Library Reagent V3.0) primer sequence: CAACTCCTTGGCTCACAGAACATGGCTACGATCCGACTT (SEQ ID NO: 1). DNA polymerase and DNA nanospheres were from MGI (MGISEQ-2000RS High-Throughput Sequencing Kit PE150). The following experiments all used E. coli single-stranded circular DNA as a template and used the MGISEQ-2000RS High-Throughput Sequencing Kit to prepare DNA nanospheres and load them onto sequencing slides for subsequent sequencing. The fluorescently modified and reversibly blocked nucleotide mixtures mentioned in this example include: dATP-1, which refers to an adenine nucleotide modified with a reversible blocking group and a Cy5 fluorescent modification; dTTP-1, which refers to a thymine nucleotide modified with a reversible blocking group and a ROX fluorescent modification; dGTP-1, which refers to a guanine nucleotide modified with a reversible blocking group and a Cy3 fluorescent modification; and dCTP-1, which refers to a cytosine nucleotide modified with a reversible blocking group and an EF700 fluorescent modification. (Depending on the platform, the fluorescently modified and reversibly blocked nucleotide mixtures can vary; for example, a single reversible blocking group nucleotide or other modification types can be added to the nucleotide mixture.)

[0040] Control 1: SE50 sequencing was performed on the MGISEQ-2000RS sequencing platform using the MGISEQ-2000RS High-Throughput Sequencing Kit according to the experimental protocol. Briefly, a mixture of fluorescently modified and reversibly blocked nucleotides was sequentially polymerized on the MGISEQ-2000RS sequencing platform. Free nucleotides were then eluted using an elution reagent, signals were acquired in a camera solution, protecting groups were removed using an excision reagent, and washing was performed using an elution reagent. Sequencing quality was assessed by calculating the decrease in Lag and Runon values ​​for each cycle and analyzing the sequencing error rate curve for each cycle.

[0041] Experimental Group 1: Use the MGISEQ-2000RS high-throughput sequencing kit, then remove the reagent in well 9 of the kit and replace it with the buffer solution containing the excision reagent of the present invention. The fluorescent-modified and reversibly blocked nucleotide mixture is polymerized in sequence on the MGISEQ-2000RS sequencing platform, and then the free nucleotides are eluted with an elution reagent. This allows polymerization and leveling to be performed while signal acquisition is in progress. At this time, the polymerized nucleotide mixture is a reversibly blocked modified nucleotide. SE50 sequencing is performed on the MGISEQ-2000RS sequencing platform according to the same experimental process as the control group. The decrease in Lag and Runon in each cycle and the sequencing error rate curve of each cycle are then counted to evaluate the sequencing quality.

[0042] 3. Experimental Methods and Procedures

[0043] (a) Configuration of excision reagent:

[0044] Accurately weigh a certain amount of glycine and sodium hydroxide, and prepare glycine-sodium hydroxide buffer solutions of different pH values ​​according to Table 1: X mL 0.2 mol / L glycine + Y mL 0.2 mol / L sodium hydroxide. Dilute to 200 mL with water. Then weigh a certain amount of THPP (tris(3-hydroxypropyl)phosphine) and dissolve it in the above buffer solution to prepare a 20 mM THPP solution for later use.

[0045] Table 1 Glycine-sodium hydroxide buffer configuration

[0046] pH 0.2 mol / L Glycine (X mL) 0.2 mol / L Sodium Hydroxide (Y mL) 8.6504.0

[0047] 8.8506.09.0508.89.25012.09.45016.89.65022.49.85027.210.05032.010.45038.610.65045.5

[0048] (b) DNA sequencing method

[0049] Step 1: Load the DNA nanoballs onto the prepared sequencing slide;

[0050] Step 2: Pump the prepared dNTP molecule mixture into the sequencing slide and use MDA polymerase to add dNTP molecules to the parent strand of DNA;

[0051] Step 3: Determine the type of base by taking a photo with a scanning reagent;

[0052] Step 4: Use excision reagent to expose the 3' terminal hydroxyl group at 50°C and excision time of 2s;

[0053] Repeat the previous four steps for multiple cycles until the sequencing is completed.

[0054] DNA nanoballs, MDA polymerase, dNTPs, and scanning reagents can be sourced from the MGISEQ-2000RS high-throughput sequencing kit or other similar kits. The scanning reagent is located in well 10 of the sequencing reagent reservoir.

[0055] Effects of each buffer system in Example 2

[0056] Table 2 Effect of pH value of different buffer systems on sequencing quality

[0057]

[0058]

[0059] As can be seen from Table 2, compared with the Tris-HCl buffer system, the slightly alkaline solution of glycine-sodium hydroxide is beneficial to improving sequencing Q30 and reducing Lag and Runon.

[0060] As can be seen from Figure 1, compared with Tris-HCl, the glycine-sodium hydroxide buffer system with a pH value of 10 can effectively reduce Lag in sequencing.

[0061] As can be seen from Figure 2, compared with Tris-HCl, the glycine-sodium hydroxide buffer system with a pH value of 10 can effectively reduce the Runon in sequencing.

[0062] In addition to HTPP, the glycine-sodium hydroxide buffer system can also be used in combination with TCEP and DTT excision reagents to achieve good sequencing results.

[0063] DNA sequencing is a complex process, requiring numerous reagents across various steps. The inventors also experimented with a boric acid-sodium borate buffer system, but at the same pH, sequencing quality was inferior to that of a glycine-sodium hydroxide buffer system. This may be due to the boric acid-sodium borate buffer being unsuitable for the overall reagent environment. Possible reasons include: 1. poor biocompatibility, which damages DNA nanospheres; 2. thermal instability of the pH; 3. chemical reactions with other components of the excision reagent; and 4. poor buffering capacity. However, the specific reasons remain unclear.

[0064] The inventors also tried a carbonate-sodium carbonate (pH 10.6) buffer system, but this proved effective only with azide-based 3'-exposed hydroxyl groups and was ineffective with other cleavable blocking groups. Furthermore, carbonate-sodium carbonate buffers exhibit instability and decomposition upon heating, making them unsuitable for long-term commercial storage. This suggests that the selection of a sequencing buffer not only affects buffer efficiency but also multiple factors, including composition and thermal stability.

[0065] Although the above describes specific embodiments of the present invention, it should be understood by those skilled in the art that these are merely illustrative and that various changes or modifications may be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the scope of protection of the present invention is defined by the appended claims.

Claims

1. An excision reagent, characterized in that The excision reagent comprises a glycine-sodium hydroxide buffer.

2. The excision reagent according to claim 1, wherein The cleavage reagent further comprises a 3'-end blocking group cleavage agent, such as THPP, TCEP or DTT.

3. The excision reagent according to claim 1, wherein The pH range of the glycine-sodium hydroxide buffer is greater than 9, preferably 9-12, more preferably 9.6-10.6, such as 9.6, 10 or 10.

6.

4. The excision reagent according to claim 2, wherein The concentration of the 3'-end blocking group cleavage agent is 5-30 mM, for example, 5 mM, 10 mM, 20 mM or 30 mM.

5. A sequencing kit, characterized in that: The sequencing kit comprises the excision reagent according to any one of claims 1 to 4.

6. The sequencing kit according to claim 5, wherein The sequencing kit further comprises one or more of a sequencing slide, a polymerase, dNTPs and a scanning reagent.

7. A method for removing a blocking group at the 3' end of a nucleotide, characterized in that: The method uses the excision reagent according to any one of claims 1 to 4 to excise the 3'-terminal blocking group to expose the 3'-terminal hydroxyl group.

8. The method according to claim 7, wherein The conditions for excision are as follows; temperature is 30-60°C, and / or, time is 1-5s; preferably, the temperature is 30-40°C, 40-50°C or 50-60°C, for example 30°C, 40°C, 50°C or 60°C; preferably, the temperature is 50°C and the time is 2s.

9. A sequencing method, characterized in that The method comprises the following steps: (1) Loading the nucleic acid to be tested onto the sequencing slide; (2) contacting the nucleic acid to be tested with sequencing reagents, such as dNTP molecules and DNA polymerase; (3) Recording signals; (4) using the excision reagent according to any one of claims 1 to 4 or the sequencing kit according to claim 5 or 6 to remove the 3'-terminal blocking group to expose the 3'-terminal hydroxyl group; (5) The above steps are repeated multiple times until the sequencing is completed; Preferably, the cycle is performed 50-400 times, such as 50, 100, 150, 200 or 400 times.

10. Use of the excision reagent according to any one of claims 1 to 4 or the sequencing kit according to claim 5 or 6 in polynucleotide sequencing or in the preparation of reagents for polynucleotide sequencing.

Images