Application of BnaVTC2 gene in controlling vitamin C content and stress resistance of brassica napus

Abstract

The invention belongs to the field of gene engineering, and discloses application of a BnaVTC2 gene in controlling the vitamin C content and stress resistance of brassica napus. The applicant respectively designs two targets of sgRNA1 and sgRNA2 aiming at the uORF sequence of the brassica napus BnaVTC2 gene, and constructs an editing vector for knocking out the uORF of the BnaVTC2 gene by utilizing the targets; the editing vector is introduced into a hypocotyl of brassica napus through an agrobacterium-mediated transformation method, callus is induced, and seedlings are regenerated. The uORF of the rape BnaVTC2 gene is subjected to fixed-point editing through a CRISPR / Cas9 gene editing technology, and the phenotype identification of the edited plant finds that the vitamin C content of the rape plant and the resistance of the rape to low temperature and salt stress can be improved, so that a gene resource and a technical thought are provided for improving the quality and stress resistance of the rape.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to the application of the BnaVTC2 gene in controlling the vitamin C content and stress resistance of Brassica napus. Background Art

[0002] The development of Brassica napus as a vegetable has a good scientific basis and great potential. In recent years, in the main rapeseed producing areas in the Yangtze River Basin, rapeseed multifunctional development models such as "vegetable + oil", "vegetable + flower + oil" have been developed, which can effectively increase the economic added value of rapeseed. The use of oil and vegetable dual-use technology (i.e. cutting the rapeseed stalks first and then harvesting the rapeseed) is of great significance to improving the overall benefits of rapeseed cultivation, increasing farmers' income, and promoting the development of my country's rapeseed industry. Rapeseed seedlings (5-leaf stage) and rapeseed stalks are rich in vitamin C and other nutrients and have high edible value. Cultivating high-vitamin C rapeseed stalk varieties can not only improve the vegetable value of rapeseed stalks, but also provide consumers with healthy and nutritious functional vegetables.

[0003] Vitamin C, also known as ascorbic acid, is one of the main vitamins required by the human body. For an average adult, the dietary recommended supply of most other vitamins required by the human body is below 20 mg / d, while the dietary recommended supply of vitamin C is 100 mg / d. It is the most demanded vitamin in the human body. A lack of vitamin C in the human body will cause a decrease in the body's immunity, and in severe cases, it will cause scurvy. Vitamin C is the most common antioxidant in vegetables and fruits, and participates in a variety of redox reactions in the human body. Studies have shown that vitamin C can not only prevent cancer and reduce the incidence of cancer, but also improve and enhance the body's immune function, and it also has the important function of preventing cardiovascular disease. The human body cannot synthesize vitamin C on its own and must obtain it from fresh vegetables, fruits and other foods. Increasing the content of vitamin C in rapeseed is of great significance to ensuring residents' vitamin C intake.

[0004] Increasing the vitamin C content of crops through traditional breeding methods is inefficient and difficult to achieve precise regulation. Gene editing technology, especially the CRISPR / Cas9 system, provides a new approach for crop genetic improvement. The upstream open reading frame (uORF) is a cis-element commonly found in eukaryotic genes, which usually inhibits the translation of the downstream main open reading frame (pORF). By editing the uORF, the expression level of the gene can be finely regulated, thereby increasing the vitamin C content of crops. Summary of the invention

[0005] The object of the present invention is to provide an application of the BnaVTC2 gene in controlling the vitamin C content and stress resistance of Brassica napus. The protein encoded by the BnaVTC2 gene is shown in SEQ ID NO.3.

[0006] Another object of the present invention is to provide a method for increasing the vitamin C content and stress resistance of Brassica napus, which uses CRISPR / Cas9 technology to accurately edit the uORF region of the gene BnaVTC2 related to vitamin C synthesis in rapeseed to improve the translation efficiency of the target gene, thereby increasing the accumulation of vitamin C, and at the same time improving the resistance of rapeseed to abiotic stresses such as low temperature and salt stress.

[0007] In order to achieve the above object, the present invention adopts the following technical measures:

[0008] The applicant discovered for the first time that the rapeseed BnaVTC2 gene is related to the vitamin C content and stress resistance of Brassica napus. Experiments further confirmed that by editing the upstream open reading frame (uORF) of the BnaVTC2 gene, the translation level of the BnaVTC2 gene was improved (i.e., the expression level of the BnaVTC2 protein was increased), thereby increasing the vitamin C content and stress resistance of Brassica napus.

[0009] The protection scope of the present invention includes:

[0010] The application of increasing the expression level of BnaVTC2 protein in Brassica napus to improving the vitamin C content and stress resistance of Brassica napus. The Brassica napus BnaVTC2 protein is shown in SEQ ID NO.3. During the above application, as long as the expression level of BnaVTC2 protein is increased, the purpose of simultaneously improving the vitamin C content and stress resistance of Brassica napus can be achieved.

[0011] The application process of the above-mentioned application includes:

[0012] A substance that increases the expression of the BnaVTC2 protein in Brassica napus is introduced into Brassica napus. Preferably, the substance is a nucleic acid molecule containing the BnaV TC2 gene, or an expression frame, a recombinant vector, or a recombinant microorganism thereof.

[0013] Knock out or inhibit the upstream open reading frame of the BnaVTC2 gene in Brassica napus to improve the vitamin C content and stress resistance of Brassica napus;

[0014] The knockout method includes: homologous recombination or CRISPR-Cas9 method, and the upstream open reading frame (uORF) after knockout has no original function or cannot be translated into protein.

[0015] The inhibition methods include: antisense RNA technology or interfering RNA technology.

[0016] In the above application, preferably, the knockout is performed using a CRISPR-Cas9 method, and the sgRNA in the method with Zhongshuang No. 11 as the background is: GGAGCTCTGCCGTCTGAAGG and CGGCAATCACGGCTATACAC.

[0017] In the above application, preferably, the BnaVTC2 gene is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0018] A method for improving the vitamin C content and stress resistance of Brassica napus using the CRISPR / Cas9 system, comprising the following steps:

[0019] (1) According to the location of the BnaVTC2 gene, the uORF was designed to design the sequences of two sgRNAs, whose sequences are shown as GGAGCTCTGCCGTCTGA AGG and CGGCAATCACGGCTATACAC;

[0020] (2) According to the sgRNA sequence and CRISPR / Cas9 vector requirements, two pairs of single-stranded oligo sequences were designed and synthesized, whose sequences were shown as ATATAT GGTCTCGATTGGGAGCTCTGCCGTCTGAAGGGTT, TGGGAGCTCTGCCGTCTGAAGGGTTTTAGAGCTAGAAATAGC and AACGTGTATAGCCGTGATTGCCGCAATCTCTTAGTCGAC TCTAC, ATTATTGGTCTCGAAACGTGTATAGCCGTGATTGCCGCAA, respectively;

[0021] (3) Amplify two pairs of single-stranded oligo DNA using the intermediate vector PCBC-DT1T2 as a template to obtain the gRNA expression cassette;

[0022] (4) Connect the purified gRNA expression cassette to the CRISPR-Cas9 vector pKSE401, and then transform Escherichia coli DH5α to obtain a plant genome editing vector;

[0023] (5) The plant genome editing vector was transformed into the Brassica napus variety Zhongshuang 11 (derived from the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences, and the present invention is not implemented in this designated variety, the same below) by using the Agrobacterium-mediated genetic transformation method, and plants with a deletion mutation of the uORF of the Bna VTC2 gene were screened in the gene-edited offspring to obtain Brassica napus plants with improved vitamin C content and stress resistance;

[0024] In the above method, when screening plants with uORF deletion mutation of BnaVTC2 gene, the nucleotide sequences of the primers for identifying the A01 chromosome copy are shown as TCAATCTCCCCGAATCATAC and GATTTTCAACATTCTCAGAC; the nucleotide sequences of the primers for identifying the C01 chromosome copy are shown as GCCATTCAATCTCCCCGAAA and GTCGGAACCCTCTTGATCT. Compared with the prior art, the present invention has the following advantages:

[0025] The above method was used to specifically knock out the uORF of the BnaVTC2 gene promoter in Brassica napus, and plants with a deletion mutation of the BnaVTC2 promoter uORF were obtained. On this basis, individual plants without exogenous transgenic markers were further screened, and phenotypic identification and trait investigation showed that the vitamin C content in leaves, buds and stems of the homozygous uORF knockout strains of the BnaVTC2 gene promoter without transgenic components was significantly increased compared with the wild-type (non-transgenic) control.

[0026] Under low temperature (8°C) stress, the germination speed of Brassica napus with uORF knockout of the BnaVTC2 gene promoter is significantly faster than that of the wild type. Under 125mM salt concentration, the fresh weight and dry weight of the homozygous strains of the BnaVTC2 gene promoter uORF knockout are significantly increased. Therefore, the present invention can be used to improve the nutritional quality and stress resistance (salt and low temperature stress) of rapeseed. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 : Schematic diagram of the uORF editing target site in the BnaVTC2 gene promoter.

[0028] Figure 2 : Schematic diagram of the CRISPR / Cas9 vector pKSE401.

[0029] Figure 3 :CRISPR-Cas9 edits the target site region sequence of the homozygous mutant of BnaVTC2-uORF copy;

[0030] Among them, A: L1 editing type of T0 generation single strain of BnaVTC2-uORF mutant; B: L2 editing type of T0 generation single strain of BnaVTC2-uORF mutant; C: L5 editing type of T0 generation single strain of BnaVTC2-uORF mutant; D: L11 editing type of T0 generation single strain of BnaVTC2-uORF mutant; E: L14 editing type of T0 generation single strain of BnaVTC2-uORF mutant; F: L15 editing type of T0 generation single strain of BnaVTC2-uORF mutant.

[0031] Figure 4 :Detection of VC content in T0 generation of BnaVTC2-uORF mutant plants.

[0032] Figure 5 : Detection of VC content in various tissues of T1 generation BnaVTC2-uORF mutant plants.

[0033] Among them, A: schematic diagram of sampling and testing, including the upper part in the seedling stage, and the buds and stems in the flowering period; B: VC content detection in leaves; C: VC content detection in flower buds; D: VC content detection in stems.

[0034] Figure 6 : Low temperature germination test of seeds collected from T1 generation self-pollination of BnaVTC2-uORF mutant plants;

[0035] Among them, A: low-temperature germination pictures of BnaVTC2-uORFT2 mutants and controls; B: low-temperature germination statistics of BnaVTC2-uORFT2 mutants and controls.

[0036] Figure 7 : Phenotypes of T2 plants of BnaVTC2-uORF mutant and control treated with salt;

[0037] Among them, A: Growth conditions of BnaVTC2-uORF mutant T2 generation plants and controls under normal conditions and 125mM salt concentration treatment; B: Fresh weight statistics of BnaVTC2-uORF mutant T2 generation plants and controls under normal and 125mM salt concentration treatment; C: Dry weight statistics of BnaVTC2-uORF mutant T2 generation plants and controls under normal and 125mM salt concentration treatment. DETAILED DESCRIPTION

[0038] The present invention is described in detail below with reference to examples, but is not intended to limit the scope of the present invention. Without departing from the concept of the present invention, any modification or replacement of the method, steps or conditions of the present invention shall fall within the protection scope of the present invention.

[0039] The instruments, reagents, materials, etc. involved in the following examples are conventional instruments, reagents, materials, etc. in the prior art unless otherwise specified and can be obtained through regular commercial channels. The test methods, detection methods, etc. involved in the following experimental examples are conventional test methods, detection methods, etc. in the prior art unless otherwise specified.

[0040] In the present invention, the reference version of the Brassica napus genome is the Zhongshuang 11 V0 version, https: / / yanglab.hzau.edu.cn / BnIR / germpl asm_info?id=ZS11.v0.

[0041] Embodiment 1:

[0042] Design of knockout sgRNA for CRISPR / Cas9 of uORF sequence of BnaVTC2 gene in Brassica napus and construction of genome editing vector 1. Design of sgRNA sequence

[0043] The uORF sequences of the BnaVTC2 gene of Brassica napus (the BnaVTC2 gene is shown as SEQ ID NO.1 in the A01 chromosome of Brassica napus and as SEQ ID NO.2 in the C01 chromosome) were aligned, and the PAM motif (NGG) was found in the conserved region. The sequence 20 bp upstream of the 5' end of the PAM position was the sgRNA sequence. Both sgRNAs (sgRNA1 and sgRNA2) are located in the uORF of the promoter of the BnaVTC2 gene, and their sequences are shown as GGAGCTCTGCCGTCTGAAGG and CGGCAATCACGGCTATACAC, and the target site is shown as Figure 1 The polynucleotide sequences of BnaVTC2-uORF involved in the present invention in chromosomes A01 and C01 are shown in SEQ ID NO.4 and SEQ ID NO.5 respectively.

[0044] 2.Synthesis of Oligo DNA Single Strand

[0045] The two pairs of oligo DNA single-stranded sequences of the present invention are shown as ATATATGGTCTCGATTG GGAGCTCTGCCGTCTGAAGG GTT, TGGGAGCTCTGCCGTCTGAAGGGTTTTAGAGCTAGAAATAGC and AACGTGTAT AGCCGTGATTGCCGCAATCTCTTAGTCGACTCTAC, ATTATTGGTCTCGAAACGTGTAT AGCCGTGATTGCCGCAA, and the sequences are synthesized by Shanghai Shenggong Biotechnology Technology Service Co., Ltd.

[0046] 3. Preparation of gRNA Expression Cassette

[0047] Using the intermediate vector PCBC-DT1T2 as a template (A CRISPR / Cas9 toolkit for multiplex genome editing in plants. Xin g HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. BMC Plant Biol. 2014 Nov 29; 14: 327.), the two pairs of synthesized oligo DNA were dissolved in ddH2O to a concentration of 10 μM, and the PCR reaction system was added at the same time (the PCR reaction system was 1 μl of template, 2 μl of primers ATATATGGTCTCGATTGGGAGCTCTGCCGTCTGAAGGGTT and ATTATTGGTCTCG AAACGTGTATAGCCGTGATTGCCGCAA, and 2 μl of primers TGGGAGCTCTGCCGTCTGAAGGGTTTTAGAG CTAGAAATAGC and primer AACGTGTATAGCCGTGATTGCCGCAATCTCTTAGTCGACTCTAC were diluted 10 times and then 2 μl was added each, 25 μl was added to the high-fidelity mix, and finally water was added to 50 μl. The PCR reaction program was: 95°C for 30 s, 58°C for 30 s, 72°C for 1 min, and 32 cycles. The PCR product was purified using the DNA purification and recovery kit produced by Beijing Tiangen Biochemical Technology Co., Ltd.

[0048] 4. Construction of the genome editing vector pKSE401-VTC2-uORF

[0049] Ligate the purified gRNA expression cassette to the CRISPR / Cas9 vector pKSE401 (see Figure 2 ), mix the components on ice according to the following reaction system, react at 37°C for 5 hours, then terminate the reaction at 50°C for 5 minutes and 80°C for 10 minutes;

[0050] Reaction system: 2 μl of purified gRNA expression cassette + 2 μl of pKSE401 + 1.5 μl of 10×T4 DNA Ligase Buffer (NEB) + 1.5 μl of 10×BSA + 1 μl of BsaI (NEB) + 1 μl of T4 DNA Ligase (NEB) + 6 μl of ddH2O;

[0051] 5. E. coli Transformation

[0052] Take 5 μl of the ligation product and add it to 50 μl of DH5α E. coli competent cells, mix well; place on ice for 30 minutes, avoid shaking during the period; heat shock at 42°C for 45 seconds, and immediately place on ice for 2 minutes; add 400 μl LB liquid culture medium, and resuscitate and culture at 37°C, 200 rpm for more than 30 minutes; take 100 μl of the bacterial solution and spread it on an LB plate containing 50 mg / L kanamycin, and culture it at 37°C overnight.

[0053] 6. Positive clone identification and plasmid extraction

[0054] Pick a single clone and inoculate it into a culture medium containing LB liquid containing 50 mg / L kanamycin; culture it at 37°C, 200 rpm for 5 hours, take 1 μl of the bacterial solution and use primers U6-26PF: 5'-TGTCCCAGGATTAGAATGATTAGGC-3', U6-29PR: 5'-AGCCCTCTTCTTTCGATCC ATCAAC-3' to perform bacterial solution PCR identification. After the positive clone is correctly sequenced by Sanger, the plasmid is extracted by alkaline lysis method.

[0055] Embodiment 2:

[0056] Construction of target vector for transformation of Agrobacterium tumefaciens GV3101

[0057] 1 μl of target vector plasmid was added to 100 μl of GV3101 Agrobacterium (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) competent cells; after mixing, ice bath for 5 minutes, liquid nitrogen freezing for 5 minutes, and 37°C water bath for 5 minutes; 700 μl of liquid LB medium was added and resuscitated and cultured at 28°C, 200rpm shaking for 3 hours; an appropriate amount of bacterial liquid was spread on LB solid medium containing 50 mg / L kanamycin, 50 mg / L gentamicin and 50 mg / L rifampicin; cultured in the dark at 28°C for 48 hours, a single clone was picked and inoculated into LB liquid medium containing 50 mg / L kanamycin, 50 mg / L gentamicin and 50 mg / L rifampicin, cultured overnight at 28°C, 200rpm, and then primer U6-26PF: 5'-TGTCCCAGGATTAGAATGATTAGG C-3', U6-29PR: 5'-AGCCCTCTTCTTTCGATCCATCAAC-3', positive identification. The correct Agrobacterium single clone will be used for genetic transformation of Brassica napus.

[0058] Example 3: Agrobacterium-mediated genetic transformation of Brassica napus

[0059] 1. Explant Preparation

[0060] The surface of the seeds of the Brassica napus variety Zhongshuang No. 11 (the material comes from the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences, which is a scientific research exchange material. The material is not a special material for the implementation of the present invention) collected in the laboratory of the applicant is disinfected: the seeds are added to a clean 50ml centrifuge tube and treated with a 75% alcohol solution for 1 minute; the alcohol is discarded, 10ml of 0.15% mercuric chloride solution is added, and the seeds are soaked for 15 minutes, during which the seeds are shaken every few minutes to allow the liquid to fully contact the seeds; the mercuric chloride solution is poured out, and the seeds are washed 4 times with sterilized single distilled water; then the seeds are transferred to a culture medium numbered M0, with 20 Brassica napus seeds placed in each bottle, and about 120 seeds are required for each transformation; and the seeds are cultured in the dark at 24°C for 5-6 days.

[0061] 2. Agrobacterium infection and co-cultivation

[0062] Take 10 μl of the Agrobacterium bacterial solution stored at -80°C, add it to 1 ml of LB liquid medium containing 50 mg / L kanamycin, 50 mg / L gentamicin and 50 mg / L rifampicin, and culture it overnight for activation. Draw a line on the LB solid medium containing 50 mg / L kanamycin, 50 mg / L gentamicin and 50 mg / L rifampicin after activation, and culture it at 28°C for 24-48 hours; take out the seedlings cultured in the dark for 6 days, cut the hypocotyls in a sterilized large dish with a scalpel sterilized by burning, and each section is about 0.8 cm long. When cutting, pour a small amount of DM (see "Specific Implementation Method") medium into the large dish to keep it moist; scrape the Agrobacterium cells with an inoculation loop to a final concentration of 100 μM Activate Agrobacterium in DM medium of AS at 28°C and 200rpm for 30 minutes; transfer the cut hypocotyls to the activated Agrobacterium bacterial solution and infect for 30 minutes, shaking every 5 minutes or so; transfer the explants to an empty culture dish with sterilized filter paper, spread them out, and absorb the bacterial solution with a small filter paper; transfer the explants to the culture medium numbered M1 and culture them in the dark at 24°C for 48 hours.

[0063] 3. Screening and Differentiation

[0064] The explants co-cultured for 48 hours were transferred to M2 medium containing 25 mg / L kanamycin and cultured at 24°C under light (light intensity of about 1000 Lux) for about 3 weeks (lighting time of 16 hours / day). At this time, the explants can be seen to be stained darker and begin to swell into callus tissue; thereafter, the explants were transferred to M3 medium containing 25 mg / L kanamycin and cultured at 24°C under light (light intensity of about 1000 Lux) (lighting time of 16 hours / day), and subcultured every two weeks to ensure adequate nutrition until differentiation of regenerated seedlings can be seen.

[0065] 4. Rooting of regenerated seedlings

[0066] The regenerated seedlings were cut from the callus with forceps and a scalpel, transferred to M4 medium for conventional plant tissue culture, and cultured at 24°C with light intensity (about 1000 Lux) until the regenerated seedlings took root (lighting time 16 hours / day).

[0067] 5. Transplanting

[0068] Transplant the well-rooted regenerated seedlings into nutrient soil and cover them with a lid to maintain humidity. Open the lid after 2 days to allow them to grow normally.

[0069] Further explanation: The culture medium numbers and formulas used in this example are as follows:

[0070] Culture medium (number) M0: MS basic medium 2.2g / L + agar powder 7.5g / L, pH 6.0

[0071] Culture medium (number) DM: MS basic medium 4.4g / L + sucrose 30g / L, add 100μM AS (acetosyringone) before use, pH 6.0 Culture medium (number) M1: MS basic medium 4.4g / L + sucrose 30g / L + mannitol 18g / L + 2,4-D1mg / L + KT0.3mg / L + agar powder 7g / L Add 1ml 100mM AS before use, pH 6.0

[0072] Culture medium (number) M2: MS basic medium 4.4g / L + sucrose 30g / L + mannitol 18g / L + 2,4-D1mg / L + KT0.3mg / L + agar powder 7g / L, add kanamycin to 25mg / L, TMT to 300mg / L, 1.5 / 1000 volume of STS, pH 6.0

[0073] Culture medium (number) M3: MS basic medium 4.4g / L + glucose 10g / L + xylose 0.25g / L + MES 0.6g / L + agar powder 7g / L, add kanamycin to 25mg / L, TMT to 300mg / L, Zeatin to 2mg / L, pH 6.0

[0074] Culture medium (number) M4: B5 medium 3.21 g / L + sucrose 30 g / L + agar powder 7.5 g / L, pH 6.0.

[0075] Note: MS basic medium is a commonly used medium for plant tissue culture. It only contains inorganic salt components and additional components of MS, and does not contain plant hormone components.

[0076] Example 4: Mutation detection in transgenic plants

[0077] 1. Screening and detection of transformed plants

[0078] The genomic DNA of the transgenic T0 generation plants with kanamycin resistance was extracted by the CTAB method, and PCR amplification was performed (the conditions for PCR amplification were denaturation at 95°C for 4 min, 95°C for 30 s, 58°C for 50 s, 72°C for 1 min, 30 cycles, 72°C for 5 min, and 25°C for 1 min) to detect the transformed plants. The primers used were: NPTII-F: 5'-GATGGATTGCACGCAGGT-3', NPTII-R: 5'-TCGTCAAGAA GGCGATAGA-3', to detect whether the T0 generation transformed plants contained exogenous selection markers.

[0079] 2. Mutation detection of BnaVTC2-uORF edited transformed strains

[0080] Since the two copies of the uORF of the BnaVTC2 gene are on chromosomes A01 and C01, respectively, two pairs of primers were designed (when screening plants with deletion mutations of the uORF of the BnaVTC2 gene, the nucleotide sequences of the primers for identifying the A01 chromosome copy are shown as TCAATCTCCCCGAATCAT AC and GATTTTCAACATTCTCAGAC; the nucleotide sequences of the primers for identifying the C01 chromosome copy are shown as GCCATTCA ATCTCCCCGAAA and GTCGGAACCCTCTTGATCT.), and the gene fragments near the target site were amplified from the genomic DNA of the identified positive BnaVTC2-sgRNA transformed plants. The PCR products were subjected to Sanger sequencing (sent to Aoke Wuhan Biotechnology Co., Ltd.) to identify whether the target sequences of the two copies of the target sites A01 and C01 of the transformed plants were edited. The sequencing results showed that in the transformed plants numbered L1, L2, L5, L11, L14, and L15, the target sequences produced heterozygous mutations at the target sites of the two homologous copies of chromosomes A01 and C01 ( Figure 3 ).

[0081] Example 5: Screening of T2-generation transgenic-free strains and observation of plant phenotypes and trait statistics

[0082] After the T1 generation homozygous mutant lines with target site editing were self-crossed and harvested, the T2 generation was sown and planted. The kanamycin screening marker identification primers NPTII-F: 5'-GATGGATTGCACGCAGGT-3', NPTII-R: 5'-TCGTCAAGAAGGCGATAGA-3', and the Cas9 gene identification primers Cas9-F: 5'-ACGAGCGCCATCCGATC-3', Cas9-R: 5'-GTTCACCCTGAGGATGTCGCT-3' were used to identify the kanamycin screening marker and Cas9 gene of the T2 generation homozygous mutant lines, and were used to screen homozygous mutant lines without transgenic components.

[0083] The leaves of the T0 generation plants with uORF editing of the BnaVTC2 gene were sampled, ground evenly under liquid nitrogen, and vitamin C was extracted according to the operating instructions of the "Ascorbic Acid (AsA) Content Detection Kit" (Cat. No. BC1235) of Solebao Company, and the absorbance value was measured using an enzyme marker. Finally, the vitamin C content was calculated according to the formula AsA content (nmol / g mass) = (C standard solution × ΔA assay tube ÷ ΔA standard tube × V sample) ÷ (W × V sample ÷ V sample total) = 400 × ΔA assay tube ÷ ΔA standard tube ÷ W.

[0084] The results showed that the VC content of the T0 generation of the BnaVTC2-uORF mutant plants was significantly higher than that of the wild-type control ( Figure 4 The leaves, buds and stems of the T1 seedlings of the Bn aVTC2-uORF mutant plants were sampled using the above method ( Figure 5 The results showed that the vitamin C content in the leaves, buds and stems of Bn aVTC2-uORF A01 copy single mutation, C01 copy single mutation and A01 and C01 copy double mutation materials increased to varying degrees, among which the vitamin C content in the A01 and C01 copy double mutation material was the highest and significantly higher than that in the wild-type control ( Figure 5 (middle B).

[0085] By comparing the responses of BnaVTC2 gene uORF knockout mutants to adverse stress:

[0086] The plant growth chamber was set to 0 light intensity and 8°C temperature. Fresh and plump seeds collected from self-pollination of T1 generation homozygous mutant strains were selected as test seeds (i.e., VC5-13 and VC11-15). They were placed in culture dishes containing 7.5 g / L agar powder, and the germination was investigated on days 4, 5, and 6. The hypocotyl length was considered to be 2 mm or greater. Under low temperature treatment conditions (8°C), the germination rate of the BnaVTC2 gene uORF knockout mutant was about 40% faster than that of the control (Zhongshuang No. 11) on day 4 of treatment; on day 5 of treatment, the germination rate of the BnaVTC2 gene uORF knockout mutant was about 56% faster than that of the control ( Figure 6 ), indicating that the functional deletion editing of the uORF of the BnaVTC2 gene increased the low-temperature germination rate of Brassica napus.

[0087] During salt treatment, the ratio of nutrient soil and vermiculite was 1:1, and the soil was mixed with 125mM NaCl solution to make the soil moist and potted. Six seeds of the experimental group (i.e., VC5-13 and VC11-15) and the control seed (Zhongshuang No. 11) that swelled and absorbed water for 24 hours were sown in large green pots, respectively. The phenotypes were investigated after three weeks of light culture at 25℃ (16h light / 8h dark). Among them, the fresh weight was weighed directly with a 1 / 10,000 balance after washing the soil-cultured seedlings and drying the roots, and the dry weight was weighed with a 1 / 10,000 balance after being fixed at 105℃ for half an hour and then continued to dry at 80℃ to constant weight. Under normal growth conditions, there was no significant difference between the BnaVTC2 gene uORF knockout mutant and the control; under 125mM salt stress conditions, the fresh weight of the BnaVTC2 gene uORF knockout mutant was about 2.5 times that of the control, and the dry weight of the BnaVTC2 gene uORF knockout mutant was about 2.2 times that of the control ( Figure 7 The above results show that the present invention can knock out the uORF function-deficient mutant of the BnaVTC2 gene of Brassica napus by using the CRISPR / Cas9 system, so that the Brassica napus can obtain stronger stress resistance and higher vitamin C content. Therefore, the present invention can be used to improve the stress resistance and nutritional traits of rapeseed.

Claims

1. Application of increasing the expression level of Brassica napus BnaVTC2 protein in improving the vitamin C content and stress resistance of Brassica napus, wherein the Brassica napus BnaVTC2 protein is shown in SEQ ID NO.

3.

2. The use according to claim 1, characterized in that: A substance that increases the expression of BnaVTC2 protein in Brassica napus is introduced into Brassica napus. The substance contains BnaVTC2 The nucleic acid molecule of the gene, or its expression frame, recombinant vector, recombinant microorganism, the Brassica napus BnaVTC2 The protein encoded by the gene is shown in SEQ ID NO.

3.

3. The use according to claim 1, characterized in that: The application process is to knock out or inhibit Brassica napus BnaVTC2 The upstream open reading frame of the gene is used to improve the vitamin C content and stress resistance of Brassica napus.

4. The use according to claim 3, wherein the knockout is performed by homologous recombination or CRISPR-Cas9 method, and the upstream open reading frame after the knockout has no original function or cannot be translated into protein.

5. The use according to claim 3, wherein the inhibition is by antisense RNA technology or interfering RNA technology.

6. The use according to claim 3, characterized in that: The knockout was performed using the CRISPR-Cas9 method, in which the sgRNAs with Zhongshuang No. 11 as the background were: GGAGCTCTGCCGTCTGAAGG and CGGCAATCACGGCTATACAC.

7. The use according to claim 2 or claim 3, wherein BnaVTC2 The gene is shown as SEQ ID NO.1 or SEQ ID NO.

2.

8. A method for improving the vitamin C content and stress resistance of Brassica napus using the CRISPR / Cas9 system, comprising the following steps: (1) Based on Brassica napus BnaVTC2 The location of the gene is set as uORF and the sequences of two sgRNAs are calculated, and their sequences are shown as GGAGCTCTGCCGTCTGAAGG and CGGCAATCACGGCTATACAC; (2) According to the sgRNA sequence and CRISPR / Cas9 vector requirements, two pairs of single-stranded oligo sequences were designed and synthesized, whose sequences were shown as ATATATGGTCTCGATTGGGAGCTCTGCCGTCTGAAGGGTT, TGGGAGCTCTGCCGTCTGAAGGGTTTTAGAGCTAGAAATAGC and AACGTGTATAGCCGTGATTGCCGCAATCTCTTAGTCGACTCTAC, ATTATTGGTCTCGAAACGTGTATAGCCGTGATTGCCGCAA, respectively; (3) Amplify two pairs of single-stranded oligo DNA using the intermediate vector PCBC-DT1T2 as a template to obtain the gRNA expression cassette; (4) Connect the purified gRNA expression cassette to the CRISPR-Cas9 vector pKSE401, and then transform Escherichia coli DH5α to obtain a plant genome editing vector; (5) The above-mentioned plant genome editing vector was transformed into the Brassica napus variety Zhongshuang 11 using Agrobacterium-mediated genetic transformation, and the gene-edited offspring were screened. BnaVTC2 Plants with gene uORF deletion mutation can be used to obtain Brassica napus plants with improved vitamin C content and stress resistance.

Images