Method for improving transcription efficiency of sigma HrdB promoter of streptomyces coelicolor

Abstract

The invention discloses a method for improving transcription efficiency of a sigmaHrdB promoter of streptomyces coelicolor, and relates to the technical field of biology, RNAP core enzyme coding genes rpoA, rpoBC, rpoZ and shbA of streptomyces coelicolor M145 are cloned respectively and transformed into escherichia coli, RNAP-sigmaShbA whole enzyme assembly is performed after expression and purification, the sigmaHrdB promoter of the cloned streptomyces coelicolor M145 and a mutant of the sigmaHrdB promoter are transcribed, and the sigmaHrdB promoter of the cloned streptomyces coelicolor M145 is obtained. The invention provides a method for remarkably improving the transcription efficiency of the sigma HrdB promoter, and the method has a great industrial application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for improving the σ HrdB Promoter transcription efficiency method. Background Art

[0002] Streptomyces coelicolor is a typical representative of the genus Streptomyces. It can produce a variety of antibiotics and other secondary metabolites. It is also a model strain for Streptomyces research. Transcription is the first step of gene expression. Transcriptional regulation ensures the accuracy and timeliness of gene expression by controlling the binding of RNAP to the DNA template and regulating the rates of transcription initiation, elongation and termination. In bacteria, the transcription yield of genes is regulated by promoters. The activity state of the promoter directly maps the degree of gene expression and becomes a key target in the optimization of microbial metabolic engineering. The three known factors that affect promoter activity are the -10 region, the -35 region and the additional -10 region (extend-10 element). Most studies on transcriptional regulatory mechanisms are conducted in Escherichia coli, while the situation of Streptomyces coelicolor is little known.

[0003] σ HrdB It is a key σ factor in Streptomyces coelicolor, which plays an irreplaceable role in regulating key physiological processes such as antibiotic synthesis, morphological differentiation and environmental stress response. HrdB The transcription efficiency of promoters is often limited by many factors, such as the variation of promoter sequences, the insufficient affinity of transcription factors for promoter binding, and the fluctuation of environmental conditions inside and outside the cell. HrdB The expression level of regulated genes is unstable, which in turn affects the production of secondary metabolites and the industrial application potential of the strain.

[0004] Therefore, it is necessary to develop a method that can effectively increase the σ HrdB The method of promoter transcription efficiency is of great significance for optimizing the biosynthetic pathway of secondary metabolites, improving the production performance of strains, and promoting the development of related industrial biotechnology. Summary of the invention

[0005] In view of the above-mentioned defects of the prior art, the technical problem to be solved by the present invention is to provide a method for realizing σ HrdB A method for significantly improving promoter transcription efficiency.

[0006] To achieve the above object, the present invention provides a method for improving the σ HrdB The method for increasing the transcription efficiency of a promoter is characterized in that the method comprises the following steps:

[0007] Step 1, PCR clone RNAP core enzyme encoding genes rpoA, rpoBC, rpoZ of Streptomyces coelicolor M145, the gene sequences are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, respectively, and the corresponding amino acid sequences are shown in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, respectively, and the core enzyme encoding genes are used to construct RNAP core enzyme expression vector pET28a-core, and transformed into Escherichia coli competent E.coli BL21;

[0008] Step 2: PCR clone the shbA gene of Streptomyces coelicolor M145, the gene sequence is shown in SEQ ID NO:7, the corresponding amino acid sequence is shown in SEQ ID NO:8, construct the ShbA expression vector pET28a-ShbA, and transform it into Escherichia coli BL21;

[0009] Step 3: Express and purify the RNAP core enzyme and σ of Streptomyces coelicolor M145 from the Escherichia coli obtained in steps 1 and 2. ShbA , and RNAP-σ ShbA Holoenzyme assembly;

[0010] Step 4: Use the RNAP-σ obtained in step 3 ShbA The whole enzyme, cloned from Streptomyces coelicolor M145 HrdB Promoter and its mutants for transcription.

[0011] In a preferred embodiment of the present invention, the primers used in step 1 are as follows:

[0012] SEQ ID NO:9, rpoA XbaI F:

[0013] ATGCTCTAGAGTTTAAACTTTAAGAAGGAGATATACTCATGCTGATCGCTCAG;

[0014] SEQ ID NO:10, rpoA NdeI R:

[0015] ATGCCATATGTCAGTACTGCTCGGTCTCCACG;

[0016] SEQ ID NO:11, rpoZ NdeI F:

[0017] ATGCCATATGAATATAAGAGGAGGTCCCAGTCATGTCCTCTTCCATCTCCGCGCCCGAG;

[0018] SEQ ID NO:12, rpoZ BamHI R:

[0019] ATGCGGATCCCTACTGCGCCGGGCCCTCGATGGC;

[0020] SEQ ID NO:13, rpoB BamHI F:

[0021] ATGCGGATCCTTTAAGAAGGAGATATATCTATGGCCGCCTCGCGCAATGCC;

[0022] SEQ ID NO:14, rpoB EcoRI R:

[0023] ATGCGAATTCGACCTCTTCGACGCTGCTCGG;

[0024] SEQ ID NO:15, rpoC EcoRI F:

[0025] ATGCGAATTCCGCCACGGTGGCTCGGGTGCAGTGCTCGACGTCAACTTCTTCGAC;

[0026] SEQ ID NO:16, rpoC HindIII R:

[0027] ATGCAAGCTTCTAGTGATGGTGATGGTGATGGTGATGCTGGTTGTACGGACCGTAGTCG.

[0028] In another preferred embodiment of the present invention, the primers used in step 2 are as follows:

[0029] SEQ ID NO:17, shbA F:

[0030] CCTGGTGCCGCGCGGCAGCCATATGCGTGACGACGATGCG

[0031] SEQ ID NO:18, shbA R:

[0032] GCTCGAGTGCGGCCGCAAGCTTCTACTGCTCCGCCAGCGCCCG.

[0033] In another preferred embodiment of the present invention, the step 1 specifically comprises:

[0034] The PCR products ropA, rpoB, rpoC, rpoZ and the vector pET28a were digested with the corresponding restriction endonucleases at 37 degrees for 3 hours, and then connected overnight at room temperature using T4 DNA ligase at a ratio of 3:1 between the DNA fragment and the vector. The ligation products were transformed into competent E. coli BL21.

[0035] In another preferred embodiment of the present invention, the step 2 specifically comprises:

[0036] The PCR product fragment of the shbA gene and the linearized pET28a vector were connected at a ratio of 4:1 using homologous recombinase at 50°C for 15 minutes, and the connection product was transformed into Escherichia coli BL21.

[0037] In another preferred embodiment of the present invention, in step 3, the RNAP core enzyme is purified using a nickel column and a heparin column, and the σ is purified using a nickel column and a molecular sieve. ShbA , RNAP-σ ShbA The specific steps of the whole enzyme assembly are as follows: the purified RNAP core enzyme is separately combined with σ ShbA Mix them together in a molar ratio of 1:2, leave them at room temperature for 30 minutes, and then place them on ice for later use.

[0038] In another preferred embodiment of the present invention, the step 4 specifically comprises:

[0039] Step 4.1. PCR cloning HrdB The promoter and MangoIII sequence, the sequence of which is shown in SEQ ID NO: 19, were used to construct the σ HrdB The promoter was cloned into the vector pUC19-hrdBp and transformed into competent E. coli DH10B;

[0040] Step 4.2: Prepare σ by PCR using the E. coli obtained in step 4.1 HrdB promoter and its mutant transcription templates;

[0041] Step 4.3: Using RNAP-σ in the presence of NTPs ShbA The holoenzyme reacts with the σ in step 4.2 HrdB The promoter and its mutant transcription templates were used for in vitro transcription.

[0042] In another preferred embodiment of the present invention, the primers used in step 4.1 are as follows:

[0043] SEQ ID NO:20, hrdBp F:

[0044] TTGTAAAACGACGGCCAGTGAATTCGCTTACGGGGGTGTGACTCGG;

[0045] SEQ ID NO:21, hrdBp R:

[0046] CCTTCGTACGTGCCGGATCCATTCCCTCCGCGGCTGT.

[0047] In another preferred embodiment of the present invention, the step 4.1 specifically includes:

[0048] The PCR product fragment of the promoter and the pUC19 linearized vector were connected at a ratio of 4:1 using homologous recombinase at 50°C for 15 minutes, and the connection product was transformed into E. coli DH10B.

[0049] In another preferred embodiment of the present invention, σ in step 4.2 HrdB The primers for the transcription template of the promoter and its mutants are as follows:

[0050] SEQ ID NO:22, wild type F:

[0051] TGGGCGTAACGCTCTTGGGAACAACACGATGACCTA;

[0052] SEQ ID NO:23'-14G-F:

[0053] TGGGCGTAACGCTCTTGGGAACAAGACGATGACCTA;

[0054] SEQ ID NO:24,-14T-F:

[0055] TGGGCGTAACGCTCTTGGGAACAATACGATGACCTA;

[0056] SEQ ID NO:25,-14A-F:

[0057] TGGGCGTAACGCTCTTGGGAACAAAACGATGACCTA;

[0058] SEQ ID NO:26,-13G-F:

[0059] TGGGCGTAACGCTCTTGGGAACAACGCGATGACCTA;

[0060] SEQ ID NO:27,-13C-F:

[0061] TGGGCGTAACGCTCTTGGGAACAACCCGATGACCTA;

[0062] SEQ ID NO:28,-13T-F:

[0063] TGGGCGTAACGCTCTTGGGAACAACTCGATGACCTA

[0064] SEQ ID NO:29, R:

[0065] GGCACGTACGAATATACCACATACCAATCCTTCTT

[0066] Technical Effects

[0067] 1. Improve σ by screening promoters with appropriate strength HrdB The transcription intensity of the promoter is precisely regulated to precisely regulate the expression level of the housekeeping σ factor HrdB, ensuring that the generation and consumption of intermediates in the metabolic network are maintained in an ideal dynamic equilibrium state, reducing the influence of environmental factors on gene expression levels, thereby promoting the improvement of the synthesis efficiency of target metabolites. Compared with traditional methods, the present invention can make σ HrdB The transcription efficiency of the promoter was increased by at least 2.2 times, which was beneficial to significantly increase the yield of the target metabolite.

[0068] 2. The present invention has found a method to improve σ HrdB A beneficial mutation in the transcriptional effect of the promoter is expected to increase σ HrdB The expression in vivo enhances a series of HrdB The expression of the identified genes has good application prospects.

[0069] 3. Using Extracellular Functional Sigma Factor ShbA In vitro transcription makes the transcription process more targeted and accurate. Streptomyces coelicolor contains a large number of σ factors, which play an important role in its biological functions. ShbAIt belongs to the ECF family σ factor, which can identify and regulate the housekeeping σ factor HrdB under normal growth conditions. This is the first application of ECFσ factor in this function. The new mechanism of ECFσ factor in regulating housekeeping σ factor was verified in vitro, which opened up a new way for the study of transcriptional regulation of Streptomyces. This method not only improves the targeting and accuracy of transcription, but also provides a powerful tool for in-depth study of the complex regulatory network of Streptomyces. The optimized promoter shows stronger industrial adaptability in antibiotic production, morphological differentiation regulation and environmental stress response, and has broad prospects for commercial application.

[0070] 4. The present invention optimizes the in vitro transcription reaction conditions, and uses Streptomyces coelicolor RNA polymerase to quickly and conveniently detect the abundance of in vitro transcripts, so that the transcription activity of Streptomyces coelicolor RNA polymerase can be fully demonstrated, and the abundance of transcripts can be detected quickly and conveniently, which greatly shortens the research cycle and reduces the R&D cost.

[0071] 5. Production implementation

[0072] Bacterial strain transformation: The optimized σ HrdB The promoter sequence was introduced into Streptomyces coelicolor and a high-yield strain was constructed by genetic engineering technology.

[0073] Large-scale production: After the success of the small-scale laboratory test, it is gradually expanded to the pilot and industrial production stages to achieve stable and efficient large-scale production. The successful application of the present invention will greatly promote the industrialization process of Streptomyces coelicolor and related Streptomyces in the fields of biopharmaceuticals, agricultural biological control, environmental remediation, etc. By increasing the yield and stability of secondary metabolites, reducing production costs, and enhancing market competitiveness, it will bring significant economic and social benefits to related companies. At the same time, the technological innovation of the present invention also provides new ideas and new methods for in-depth research on the transcriptional regulation mechanism of Streptomyces, which has important scientific research value. In summary, the present invention has extremely high transformation potential and broad prospects for industrial application.

[0074] The concept, specific structure and technical effects of the present invention will be further described below in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1 It is an SDS-PAGE diagram of the expression of the RNAP core enzyme protein of Streptomyces coelicolor in a preferred embodiment of the present invention;

[0076] Figure 2 A preferred embodiment of the present invention is σ ShbA SDS-PAGE images of protein expression;

[0077] Figure 3RNAP-σ is a preferred embodiment of the present invention shbA Schematic diagram of the transcriptional activity of the holoenzyme on the wild-type hrdBp promoter in vitro;

[0078] Figure 4 RNAP-σ is a preferred embodiment of the present invention ShbA For σ HrdB Transcription fold analysis of the promoter and its mutants. DETAILED DESCRIPTION

[0079] The following describes several preferred embodiments of the present invention with reference to the drawings in the specification, so that the technical content is clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the protection scope of the present invention is not limited to the embodiments mentioned in the text.

[0080] The RNAP core enzyme of Streptomyces coelicolor is heterologous in Escherichia coli, and the RNAP core enzyme vector used to prepare the RNAP core enzyme required for transcription is a tandem expression vector containing core enzyme subunits rpoA, rpoB, rpoC and rpoZ, wherein rpoB and rpoC are fused and expressed through a connecting amino acid chain (EFRHGGSGA), and the 3' end contains a tag formed by 8 histidines.

[0081] Used to prepare the σ required for transcription ShbA The recombinant E. coli is an E. coli into which the shbA gene is introduced. HrdB The recombinant E. coli is an E. coli into which the hrdB gene is introduced. HrdB The promoter transcription template of recombinant Escherichia coli is introduced into the σ HrdB Recombinant Escherichia coli with promoter sequence and MangoⅢ sequence.

[0082] The above RNAP core enzyme genes rpoA, rpoBC and rpoZ contain 1023bp, 7434bp and 273bp bases respectively, and their gene sequences are shown in SEQ ID NO: 1-SEQ ID NO: 3. The RNAP core enzyme α subunit, β subunit and ω subunit encoded by these three genes contain 340, 2477 and 90 amino acids respectively, and their amino acid sequences are shown in SEQ ID NO: 4-SEQID NO: 6.

[0083] The shbA gene contains 588 bp of bases, and its gene sequence is shown in SEQ ID NO: 7. ShbA It comprises 195 amino acids, and its amino acid sequence is shown in SEQ ID NO:8.

[0084] The above σ HrdBThe promoter sequence and MangoⅢ sequence contain 143 bp of bases, and its sequence is shown in SEQ ID NO:19.

[0085] The present invention cloned the RNAP core enzyme rpoA, rpoBC, rpoZ gene and shbA gene from the genome of Streptomyces coelicolor M145, constructed them into the expression vector pET28a and expressed them in the Escherichia coli expression strain E.coli BL21 (DE3). The Mango transcription experiment using RNA aptamer MangoIII was performed to detect the transcription activity of MangoIII in vitro by fluorescence detection. HrdB The promoter sequence was constructed into the cloning vector pUC19 and cloned in the E. coli cloning strain. The E. coli used for expression was E. coli BL21 (DE3) preserved in our laboratory, and the E. coli used for cloning was E. coli DH10B preserved in our laboratory (purchased from Qingke Biotechnology).

[0086] The method for constructing the above-mentioned recombinant E. coli expression strain is as follows: PCR clone rpoA, rpoBC, rpoZ genes, construct them into pET28a and co-express them in E. coli to obtain a recombinant E. coli expression strain for preparing RNAP core enzyme.

[0087] The method for constructing the above-mentioned recombinant E. coli clone strain is as follows: PCR cloning σ HrdB The promoter sequence was constructed into pUC19 and then cloned in E. coli DH10B. HrdB Promoter sequence mutants were generated by σ HrdB The wild-type promoter sequence was obtained by PCR and cloned in E. coli DH10B.

[0088] σ HrdB The transcription template was obtained by PCR, and the PCR template was the recombinant pUC19 plasmid.

[0089] Construct expression of RNAP core enzyme and σ ShbA Can assemble into RNAP-σ ShbA The whole enzyme recognizes the above transcription template and transcribes in the presence of NTPs. The transcribed MangoⅢ sequence will form a specific secondary structure and emit fluorescence after binding to TO1-3PEG-biotin.

[0090] RNAP core enzyme and σ ShbA The protein induction expression conditions are as follows: expression temperature 16°C, shaker speed 220rpm, IPTG concentration 0.3mM, and expression time 12-16 hours.

[0091] RNAP core enzyme and σ ShbA The protein induction expression conditions are as follows: collect the cells by low-temperature centrifuge at 5000rpm for 7min, resuspend the cells in lysis buffer (50mM Tris-HCl 8.0, 500mM NaCl, 5mM MgCl2, 2mMβ-ME, 10% glycerol) and ultrasonically disrupt them, and collect the supernatant by low-temperature centrifugation at 10500rpm for 30min. Collect the protein after the supernatant passes through a nickel column. The RNAP core enzyme passes through a Heparin column to remove non-specifically bound nucleic acids, and σ ShbA The protein was further purified by passing through molecular sieves (FPLC buffer: 20 mM Tris-HCl pH=8.0, 150 mM NaCl, 5 mM MgCl2, 5% glycerol).

[0092] Using recombinant Escherichia coli expressed RNAP core enzyme and σ ShbA For σ HrdB The in vitro transcription method of the promoter and its mutants is as follows:

[0093] In vitro transcription, RNAP-σ ShbA The holoenzyme can recognize σ HrdB Promoter, transcription in the presence of NTPs. The reaction system is 100nM RNAP-σ ShbA , 10 nM transcription template, 1 μM NTPs, 20 mM Tris-HCl pH 8.0, 100 mM KCl, 5 mM MgCl 2 , 2 mM DTT, 1 μM TO1-3PEG-biotin, and 5% glycerol.

[0094] The reaction temperature was 30°C, the reaction time was 10 min, and the reaction was allowed to stand.

[0095] The method for terminating the reaction is to add 50 ng of Heparin Na salt.

[0096] The method for determining the transcription of the reaction product is as follows:

[0097] Add the reaction product to the ELISA plate, measure the fluorescence value with a multifunctional ELISA reader and calculate the transcription fold.

[0098] The volume of the reaction product is 100 μl, and the ELISA plate is a 96-well black ELISA plate.

[0099] Among them, the excitation wavelength measured by the multifunctional microplate reader is 510nm, and the emission wavelength is 535nm.

[0100] The variables of the experimental group and the control group were the addition or absence of RNAP holoenzyme. ShbAThe transcription reaction of the whole enzyme was used as the experimental group. ShbA The transcription reaction of the holoenzyme to wild-type hrdBp was used as the control group, and the increase in its fluorescence was defined as 1. The transcription fold was the ratio of the increase in fluorescence of the experimental group to the increase in fluorescence of the control group.

[0101] The specific implementation manner is described as follows, but the protection scope of the present invention is not limited thereto:

[0102] Example 1: Cloning of RNAP core enzyme encoding genes rpoA, rpoBC, rpoZ of Streptomyces coelicolor M145.

[0103] The genome of Streptomyces coelicolor M145 was extracted using a genome extraction kit (Sangon Biotechnology).

[0104] The primers for constructing the expression vector were synthesized by Qingke Biotechnology, and the specific sequences are as follows:

[0105] SEQ ID NO:9, RpoA XbaI F:

[0106] ATGCTCTAGAGTTTAAACTTTAAGAAGGAGATATACTCATGCTGATCGCTCAG

[0107] SEQ ID NO: 10, RpoA NdeI R:

[0108] ATGCCATATGTCAGTACTGCTCGGTCTCCACG

[0109] SEQ ID NO:11, RpoZ NdeI F:

[0110] ATGCCATATGAATATAAGAGGAGGTCCCCAGTCATGTCCTCTTCCATCTCCGCGCCCGAG

[0111] SEQ ID NO:12, RpoZ BamHI R:

[0112] ATGCGGATCCCTACTGCGCCGGGCCCTCGATGGC

[0113] SEQ ID NO:13, RpoB BamHI F:

[0114] ATGCGGATCCTTTAAGAAGGAGATATATCTATGGCCGCCTCGCGCAATGCC

[0115] SEQ ID NO:14, RpoB EcoRI R:

[0116] ATGCGAATTCGACCTCTTCGACGCTGCTCGG

[0117] SEQ ID NO:15, RpoC EcoRI F:

[0118] ATGCGAATTCCGCCACGGTGGCTCGGGTGCAGTGCTCGACGTCAACTTCTTCGAC

[0119] SEQ ID NO:16, RpoC HindIII R:

[0120] ATGCAAGCTTCTAGTGATGGTGATGGTGATGGTGATGCTGGTTGTACGGACCGTAGTCG

[0121] The PCR enzyme used was ApexHF HSDNA polymerase premix from Acori Biotech. The PCR system consisted of 50 μl system, 25 μl ApexHF HSDNA polymerase premix, 2 μl primer F, 2 μl primer R, 100 ng genome of Streptomyces coelicolor M145, and 100 ng H 2 O 20 μl.

[0122] PCR conditions are as follows: 94℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 68-58℃ annealing for 5 seconds, 72℃ extension for 1 minute, 5 cycles, and the annealing temperature is gradually reduced by two degrees in each cycle. PCR; 94℃ denaturation for 10 seconds, 64℃ annealing for 5 seconds, 68℃ extension for 1 minute, 30 cycles; 72℃ extension for 5 minutes and then keep at 4℃. Protein

[0123] Example 2: Streptomyces coelicolor M145 ShbA Protein and σ HrdB Cloning of promoters.

[0124] The primers for constructing the expression vector were synthesized by Qingke Biotechnology, and the specific sequences are as follows:

[0125] SEQ ID NO:17, shbA F:

[0126] CCTGGTGCCGCGCGGCAGCCATATGCGTGACGACGATGCG

[0127] SEQ ID NO:18, shbA R:

[0128] GCTCGAGTGCGGCCGCAAGCTTCTACTGCTCCGCCAGCGCCCG

[0129] SEQ ID NO:20, hrdBp F:

[0130] TTGTAAAACGACGGCCAGTGAATTCGCTTACGGGGGTGTGACTCGG

[0131] SEQ ID NO:21, hrdBp R:

[0132] CCTTCGTACGTGCCGGATCCATTCCCTCCGCGGCTGT

[0133] The PCR enzyme used was ApexHF HSDNA polymerase premix from Acori Biotech. PCR system

[0134] A total of 50 μl system, ApexHF HSDNA polymerase premix 25 μl, primer F 2 μl, primer R 2 μl, Streptomyces coelicolor M145 genome 1 μl, H 2 O 20 μl.

[0135] The PCR conditions were as follows: pre-denaturation at 94°C for 3 min; denaturation at 98°C for 10 s, annealing at 60-50°C for 15 s, extension at 72°C for 1 min, 5 cycles, with the annealing temperature at each cycle being changed twice for touch-down PCR; denaturation at 94°C for 10 s, annealing at 55°C for 15 s, extension at 68°C for 1 min, 30 cycles; extension at 72°C for 5 min and then hold at 4°C.

[0136] Example 3: Construction of Streptomyces coelicolor M145 RNAP core enzyme expression vector pET28a-core.

[0137] Restriction digestion and ligation: PCR products ropA (XbaⅠ / NdeI), rpoB (BamHI / EcoRI), rpoC (EcoRI / HindⅢ), rpoZ (NdeI / BamHI) and vector pET28a (XbaⅠ / HindⅢ) were digested with corresponding restriction endonucleases at 37 degrees for 3 hours, and then ligated with T4 DNA ligase at room temperature overnight at a ratio of 3:1 between DNA fragment and vector.

[0138] Transformation: The ligation product was transformed into competent E. coli BL21 (DE3), plated onto LB+Kana (kanamycin) solid medium, and cultured in a 37°C incubator overnight.

[0139] Restriction verification: Pick a single clone and culture it in LB+Kana to collect the bacteria and extract the plasmid. Use XbaⅠ and HindⅢ to cut the plasmid to verify whether the rpoA, rpoBC, and rpoZ gene fragments are connected to pET28a.

[0140] Sequencing verification: The plasmids verified by enzyme digestion were sent to Qingke Biotechnology Co., Ltd. for sequencing verification.

[0141] Example 4: Streptomyces coelicolor M145 ShbA Construction of expression vector pET28a-shbA.

[0142] Homologous recombination: The PCR product fragment and the linearized vector were connected at a ratio of 4:1 using homologous recombination enzyme (Novozyme) at 50°C for 15 minutes.

[0143] Transformation: The ligation product was transformed into competent E. coli BL21 (DE3), plated onto LB+Kana solid medium, and cultured in a 37°C incubator overnight.

[0144] Restriction verification: Pick a single clone and culture it in LB+Kana to collect the bacteria and extract the plasmid. Use NdeⅠ and HindⅢ to cut the plasmid to verify whether the shbA gene fragment is connected to pET28a.

[0145] Sequencing verification: The plasmids verified by enzyme digestion were sent to Qingke Biotechnology Co., Ltd. for sequencing verification.

[0146] Example 5: Streptomyces coelicolor M145 HrdB Construction of promoter cloning vector pUC19-hrdBp(-69+22).

[0147] Homologous recombination: The PCR product fragment and the linearized vector were connected at a ratio of 4:1 using homologous recombination enzyme (Novozyme) at 50°C for 15 minutes.

[0148] Transformation: The ligation product was transformed into competent E. coli DH10B, plated onto LB+Amp (ampicillin) solid medium, and cultured in a 37°C incubator overnight.

[0149] Enzyme digestion verification: Pick a single clone and culture it in LB+Amp to collect the bacteria and extract the plasmid. Use EcoRⅠ and BamHⅠ to digest the plasmid and verify the σ HrdB Whether the promoter fragment is connected to pUC19.

[0150] Sequencing verification: The plasmids verified by enzyme digestion were sent to Qingke Biotechnology Co., Ltd. for sequencing verification.

[0151] Example 6: Expression and purification of Streptomyces coelicolor M145 RNAP core enzyme.

[0152] Induced expression: BL21 (DE3) monoclones containing the expression vector pET28a-core were respectively transferred to 50 ml LB + Kana (kanamycin) medium and cultured at 37°C and 220 rpm with shaking. When the OD reached about 0.6, they were transferred to 1 L LB + Kana medium and cultured at 37°C and 220 rpm with shaking. When the OD reached about 0.4, IPTG was added at a final concentration of 0.3 mM. The temperature was lowered to 16°C and cultured at 220 rpm with shaking overnight.

[0153] Nickel column purification: The cells were collected by low-temperature centrifugation at 5000rpm for 7min, and the cells were resuspended in lysis buffer (50mM Tris-HCl PH8.0, 500mM NaCl, 10mM MgCl2, 2mMβ-ME, 10% glycerol) and ultrasonically disrupted, and the supernatant was collected by low-temperature centrifugation at 10500rpm for 30min. The supernatant was passed through the nickel column and eluted with a buffer containing imidazole to collect the protein.

[0154] Heparin column purification: The protein collected from the nickel column is passed through the Heparin column to remove non-specifically bound nucleic acids. Heparin A: 50mM Tris-HCl PH 8.0, 5mM MgCl2, 10% glycerol; Heparin B: 50mM Tris-HCl PH8.0, 1M NaCl, 5mM MgCl2, 10% glycerol. The percentage of Heparin B is slowly increased from 0% to 100%, and the protein at the peak position is collected. The protein SDS-PAGE is shown in the figure below. Figure 1 shown.

[0155] Example 7: Streptomyces coelicolor M145 ShbA Expression purification.

[0156] Induced expression: The BL21 (DE3) monoclone containing the expression vector pET28a-shbA was transferred to 50 ml LB + Kana (kanamycin) medium and cultured with shaking at 220 rpm at 37°C. When the OD = 0.6, it was transferred to 1 L LB + Kana and cultured with shaking at 220 rpm at 37°C. When the OD = 0.4, IPTG was added at a final concentration of 0.3 mM. The temperature was cooled to 16°C and cultured with shaking at 220 rpm overnight.

[0157] Nickel column purification: Collect the cells by low-temperature centrifugation at 5000rpm for 7min, resuspend the cells in lysis buffer (50mM Tris-HCl PH8.0, 500mM NaCl, 5mM MgCl2, 2mMβ-ME, 10% glycerol) and ultrasonically disrupt them, collect the supernatant by low-temperature centrifugation at 10500rpm for 30min. After the protein supernatant passes through the nickel column, it is eluted with a buffer containing imidazole and the protein is collected.

[0158] Molecular sieve purification: The protein collected by elution from the nickel column is passed through molecular sieve to remove high polymers. Molecular sieve buffer: 20mMTris-HCl pH 8.0, 150mM Nacl, 5mM MgCl2, 5% glycerol, collect the protein with the correct peak position, the protein SDS-PAGE picture is as follows Figure 2 shown.

[0159] Example 8: HrdB Preparation of promoter and mutant transcription templates.

[0160] The primers for preparing transcription template are as follows:

[0161] SEQ ID NO:22, wild type F:

[0162] TGGGCGTAACGCTCTTGGGAACAACACGATGACCTA;

[0163] SEQ ID NO:23'-14G-F:

[0164] TGGGCGTAACGCTCTTGGGAACAAGACGATGACCTA;

[0165] SEQ ID NO:24,-14T-F:

[0166] TGGGCGTAACGCTCTTGGGAACAATACGATGACCTA;

[0167] SEQ ID NO:25,-14A-F:

[0168] TGGGCGTAACGCTCTTGGGAACAAAACGATGACCTA;

[0169] SEQ ID NO:26,-13G-F:

[0170] TGGGCGTAACGCTCTTGGGAACAACGCGATGACCTA;

[0171] SEQ ID NO:27,-13C-F:

[0172] TGGGCGTAACGCTCTTGGGAACAACCCGATGACCTA;

[0173] SEQ ID NO:28,-13T-F:

[0174] TGGGCGTAACGCTCTTGGGAACAACTCGATGACCTA

[0175] SEQ ID NO:29, R:

[0176] GGCACGTACGAATATACCACATACCAATCCTTCTT

[0177] The PCR enzyme used was ApexHF HSDNA polymerase premix from Acori Biotech. The PCR system consisted of 50 μl system, 25 μl ApexHF HSDNA polymerase premix, 2 μl primer F, 2 μl primer R, 1 μl pUC19-hrdBp, and 20 μl H2O.

[0178] PCR conditions were as follows: 94°C pre-denaturation for 1 minute; 98°C denaturation for 10 seconds, 70-60°C annealing for 15 seconds, 72°C extension for 5 seconds, 5 cycles, with the annealing temperature being gradually reduced by two degrees in each cycle. PCR; 98°C denaturation for 10 seconds, 65°C annealing for 15 seconds, 72°C extension for 5 seconds, 30 cycles; 72°C extension for 5 minutes and then hold at 4°C.

[0179] Example 9: σ HrdB Promoter transcription response.

[0180] RNAP-σ ShbA Assembly of the whole enzyme: The purified RNAP core enzyme was separately combined with σ ShbA Mix them together in a molar ratio of 1:2, leave them at room temperature for 30 minutes, and then place them on ice for later use.

[0181] Transcription assay system (100 μl): 100 nM RNAP-σ ShbA , 10nMσ HrdBPromoter transcription template, 1μM NTPs, 20mM Tris-HCl PH 8.0, 100mM KCl, 5mM MgCl2, 2mM DTT, 1μM TO1-3PEG-biotin and 5% glycerol. After standing at 30℃ for 10min, 50ng Heparin Na salt was added to each reaction to terminate the reaction.

[0182] Example 10: σ HrdB Determination of promoter and mutant transcription products.

[0183] The transcription reaction product was added to a 96-well black ELISA plate. The fluorescence value was measured with a multifunctional ELISA reader at an excitation wavelength of 510 nm and an emission wavelength of 535 nm. Figure 3 As shown, RNAP-σ ShbA The whole enzyme has a very high transcription efficiency for wild-type hrdBp, with a fluorescence value of up to 40,000. The variables of the experimental and control groups were the addition or absence of NTPs. ShbA The transcription reaction of the whole enzyme was used as the experimental group. ShbA The transcription reaction of the whole enzyme to the wild-type hrdBp was used as the control group, and the increase in its fluorescence was defined as 1. The transcription factor was the ratio of the increase in fluorescence of the experimental group to the increase in fluorescence of the control group. The determination of mutant transcription was consistent with the above, and finally all ratios were compared with the transcription of the wild-type. Figure 4 As shown, mutations at position -14 to A and -13 to G can both make σ HrdB The transcription of the promoter was significantly increased.

[0184] The preferred specific embodiments of the present invention are described in detail above. It should be understood that ordinary technicians in the field can make many modifications and changes based on the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by technicians in the technical field based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. A method for improving the σ HrdB A method for increasing the transcription efficiency of a promoter, characterized in that The method comprises the following steps: Step 1, PCR clone RNAP core enzyme encoding genes rpoA, rpoBC, rpoZ of Streptomyces coelicolor M145, the gene sequences are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, respectively, and the corresponding amino acid sequences are shown in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, respectively, and the core enzyme encoding genes are used to construct RNAP core enzyme expression vector pET28a-core, and transformed into Escherichia coli competent E.coliBL21; Step 2: PCR clone the shbA gene of Streptomyces coelicolor M145. The gene sequence is shown in SEQ ID NO:7, and the corresponding amino acid sequence is shown in SEQ ID NO:

8. ShbA The expression vector pET28a-shbA was transformed into competent E. coli BL21; Step 3: Express and purify the RNAP core enzyme and σ of Streptomyces coelicolor M145 from the Escherichia coli obtained in steps 1 and 2. ShbA , and RNAP-σ ShbA Holoenzyme assembly; Step 4: Use the RNAP-σ obtained in step 3 ShbA The whole enzyme, cloned from Streptomyces coelicolor M145 HrdB Promoter and its mutants for transcription.

2. The method according to claim 1, characterized in that The primers used in step 1 are as follows: SEQ ID NO:9, rpoA XbaI F: ATGCTCTAGAGTTTAAACTTTAAGAAGGAGATATACTCATGCTGATCGCTCAG; SEQ ID NO:10, rpoA NdeI R: ATGCCATATGTCAGTACTGCTCGGTCTCCACG; SEQ ID NO:11, rpoZ NdeI F: ATGCCATATGAATATAAGAGGAGGTCCCAGTCATGTCCTCTTCCATCTCC GCGCCCGAG; SEQ ID NO: 12, rpoZ BamHI R: ATGCGGATCCCTACTGCGCCGGGCCCTCGATGGC; SEQ ID NO:13, rpoB BamHI F: ATGCGGATCCTTTAAGAAGGAGATATATCTATGGCCGCCTCGCGCAATG CC; SEQ ID NO:14, rpoB EcoRI R: ATGCGAATTCGACCTCTTCGACGCTGCTCGG; SEQ ID NO:15, rpoC EcoRI F: ATGCGAATTCCGCCACGGTGGCTCGGGTGCAGTGCTCGACGTCAACTTC TTCGAC; SEQ ID NO:16, rpoC HindIII R: ATGCAAGCTTCTAGTGATGGTGATGGTGATGGTGATGCTGGTTGTACGG ACCGTAGTCG.

3. The method according to claim 1, characterized in that The primers used in step 2 are as follows: SEQ ID NO:17, shbA F: CCTGGTGCCGCGCGGCAGCCATATGCGTGACGACGATGCG; SEQ ID NO:18, shbA R: GCTCGAGTGCGGCCGCAAGCTTCTACTGCTCCGCCAGCGCCCG.

4. The method according to claim 1, characterized in that The step 1 specifically includes: The PCR products rpoA, rpoB, rpoC, rpoZ and the vector pET28a were digested with the corresponding restriction endonucleases at 37 degrees for 3 hours, and then connected overnight at room temperature using T4 DNA ligase at a ratio of 3:1 between the DNA fragment and the vector. The ligated products were transformed into competent E. coli BL21.

5. The method according to claim 1, characterized in that The step 2 specifically includes: The PCR product fragment of the shbA gene and the linearized pET28a vector were connected at a ratio of 4:1 using homologous recombinase at 50°C for 15 minutes, and the connection product was transformed into Escherichia coli BL21.

6. The method according to claim 1, characterized in that In step 3, the RNAP core enzyme is purified using a nickel column and a heparin column, and the σ is purified using a nickel column and a molecular sieve. ShbA , RNAP-σ ShbA The specific steps of the whole enzyme assembly are as follows: the purified RNAP core enzyme is separately combined with σ ShbA Mix them together in a molar ratio of 1:2, leave them at room temperature for 30 minutes, and then place them on ice for later use.

7. The method according to claim 1, characterized in that The step 4 specifically includes: Step 4.

1. PCR cloning HrdB The promoter and MangoIII sequence, the sequence of which is shown in SEQ ID NO: 19, were used to construct the σ HrdB The promoter was cloned into the vector pUC19-hrdBp and transformed into competent E. coli DH10B; Step 4.2: Prepare σ by PCR using the E. coli obtained in step 4.1 HrdB promoter and its mutant transcription templates; Step 4.3: Using RNAP-σ in the presence of NTPs ShbA The holoenzyme reacts with the σ in step 4.2 HrdB The promoter and its mutant transcription templates were used for in vitro transcription.

8. The method according to claim 7, characterized in that The primers used in step 4.1 are as follows: SEQ ID NO:20, hrdBp F: TTGTAAAACGACGGCCAGTGAATTCGCTTACGGGGGTGTGACTCGG; SEQ ID NO:21, hrdBp R: CCTTCGTACGTGCCGGATCCATTCCCTCCGCGGCTGT.

9. The method according to claim 7, characterized in that The step 4.1 specifically includes: The PCR product fragment of the promoter and the pUC19 linearized vector were connected at a ratio of 4:1 using homologous recombinase at 50°C for 15 minutes, and the connection product was transformed into E. coli DH10B.

10. The method according to claim 7, characterized in that The σ in step 4.2 HrdB The primers for the transcription template of the promoter and its mutants are as follows: SEQ ID NO:22, wild type F: TGGGCGTAACGCTCTTGGGAACAACACGATGACCTA; SEQ ID NO:23'-14G-F: TGGGCGTAACGCTCTTGGGAACAAGACGATGACCTA; SEQ ID NO:24,-14T-F: TGGGCGTAACGCTCTTGGGAACAATACGATGACCTA; SEQ ID NO:25,-14A-F: TGGGCGTAACGCTCTTGGGAACAAAACGATGACCTA; SEQ ID NO:26,-13G-F: TGGGCGTAACGCTCTTGGGAACAACGCGATGACCTA; SEQ ID NO:27,-13C-F: TGGGCGTAACGCTCTTGGGAACAACCCGATGACCTA; SEQ ID NO:28,-13T-F: TGGGCGTAACGCTCTTGGGAACAACTCGATGACCTA SEQ ID NO:29, R: GGCACGTACGAATATACCACATACCAATCCTTCCTT.

Images