Molecular marker for diagnosis and treatment of severe viral pneumonia

Abstract

The invention relates to the technical field of biomedicine, in particular to a molecular marker for diagnosis and treatment of severe viral pneumonia. The TMEM176B and various interacting genes show good prognosis prediction value, and a reliable molecular marker is provided for early judgment and screening of severe viral pneumonia; the TMEM176B can be used as a severe viral pneumonia intervention target, and has important value for clinical transformation and research and development of future drug targets.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to molecular markers for the diagnosis and treatment of severe viral pneumonia. Background Art

[0002] Respiratory viral infections, represented by influenza virus and novel coronavirus, have posed a serious threat to global public health security. Intermittent outbreaks and large-scale epidemics of influenza virus often cause fatal diseases. Although vaccination and early antiviral treatment have improved the prognosis of patients to a certain extent, these prevention and treatment measures still have limitations. For example, influenza vaccines may fail, and the time window for antiviral treatment is narrow. According to previous studies, immune disorders and tissue damage caused by pathogens are more likely to lead to severe illness. Therefore, finding more effective host markers for population screening and early intervention is of great significance for the treatment of viral infectious diseases in the future. At present, although some host targets such as EN-RAGE, TNFSF14, ANXA1, FPR1, etc. have been reported, these studies are mostly based on bioinformatics analysis of small sample data, and their reliability still needs further verification. Therefore, there is an urgent need to develop new and reliable diagnostic biomarkers to guide clinical practice.

[0003] Cell populations such as the monocyte-macrophage system and dendritic cells not only play an important role in innate immunity, but are also key mediators of adaptive immune responses and play an important role in viral defense. Although multiple studies have focused on the role of the development and differentiation of these cell populations in disease, reliable lineage-specific biomarkers have not yet been found. Summary of the invention

[0004] The present invention aims to find specific lineage markers of myeloid immune cells for screening high-risk populations for severe viral pneumonia. This not only helps with early diagnosis, but also minimizes side effects in clinical intervention, and has important translational value.

[0005] The present invention discovers a monocyte-macrophage-specific biomarker, which is closely related to the diagnosis and treatment of severe viral pneumonia.

[0006] The first object of the present invention is to provide a quantitative detection agent for a molecular marker for use in the preparation of a kit for diagnosis and prognosis evaluation of severe viral pneumonia; the molecular marker includes TMEM176B mRNA and / or protein.

[0007] The second object of the present invention is to provide a molecule that specifically inhibits TMEM176B gene transcription or translation, or can specifically inhibit TMEM176B protein expression or activity, for use in the preparation of a drug for treating severe viral pneumonia.

[0008] TMEM176B and multiple interacting genes showed good prognostic predictive value, providing a reliable molecular marker for early judgment and screening of severe viral pneumonia. In addition, TMEM176B, as an intervention target for severe viral pneumonia, has important clinical translational value and provides strong support for the research and development of future drug targets. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0010] Figure 1 :A. Expression of Tmem176B in different cell subtypes;

[0011] B. The expression changes of Tmem176B in BMDC cells in the unstimulated state and after stimulation with LPS or PolyI:C (n=3; *, p<0.05; **, p<0.01, ***, p<0.001); US, unstimulated group.

[0012] Figure 2 : Detection results of Tmem176B expression in different cells.

[0013] Figure 3 : Expression pattern of Tmem176B.

[0014] A. Clustering and annotation of GSE149689;

[0015] B. Tmem176B is specifically expressed in mononuclear cell clusters;

[0016] C. Clustering and annotation of GSE145926;

[0017] D. Tmem176B is specifically expressed in macrophage clusters.

[0018] Figure 4: After influenza virus infection, Tmem176B was significantly downregulated in BMDM (A, MOI = 5, 24 h.pi), BMDC (B, MOI = 1, 24 h.pi) and RAW264.7 (C, MOI = 0.5); Student-t test. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; data are expressed as mean ± SD.

[0019] Figure 5 :Correlation analysis between TMEM176B and its co-expressed gene modules and inflammasome-pyroptosis genes;

[0020] A. WGCNA analysis of GSE97672;

[0021] B. WGCNA analysis of GSE163959;

[0022] C. hdWGCNA analysis of GSE149689;

[0023] D. The green module where TMEM176B is located in the GSE97672 dataset is related to inflammasome-pyroptosis related genes;

[0024] E. The turquoise module where TMEM176B is located in the GSE163959 dataset is related to inflammasome-pyroptosis related genes;

[0025] F. The turquoise module where TMEM176B is located in the GSE149689 dataset is related to inflammasome-pyroptosis related genes.

[0026] Figure 6 : Immune cell infiltration analysis of samples in GSE163959;

[0027] A. Abundance of infiltrating immune cells in influenza-infected samples;

[0028] B. Correlation analysis between each infiltrating immune cell and different gene modules, especially the gene modules including TMEM176B.

[0029] Figure 7 : Pseudo-time analysis of myeloid cells in GSE149689 (peripheral blood) and GSE202001 (mouse lung tissue);

[0030] A, C, pseudo-time series diagram of cells and temporal expression changes of TMEM176B in GSE149689; B, D, pseudo-time series diagram of cells in GSE202001 and temporal expression changes of TMEM176B; E, G, temporal differential gene analysis between GSE149689 and GSE202001;

[0031] F, H, Branch trajectory prediction analysis in GSE149689 and GSE202001.

[0032] Figure 8 :TMEM176B and its related genes establish a prognostic model;

[0033] A. Cluster analysis of GSE202001;

[0034] B. Gene significance <0.1 was used as the threshold to delete genes with low correlation with NLRP3;

[0035] C. Venn diagram showing 185 intersection genes, which are TMEM176B co-expressed genes related to both NLRP3 and cell differentiation;

[0036] DE.GO and KEGG analyses were performed on 185 genes;

[0037] FH. Used random forest model in the training set of GSE157344 to obtain 27 genes affecting prognosis;

[0038] IK. Different expression patterns of characteristic gene values ​​of the 27 gene modules in patients of different ages (cutoff value 65), genders, and SOFA scores (cutoff value 5) (Wilcoxon test, p < 0.05).

[0039] Fig. 9 :After influenza virus A / PR / 8 / 34 infection, Tmem176b - / - The mice had an improved prognosis compared to wild mice:

[0040] Wild-type and Tmem176b cells from 6 to 8 weeks of age were cultured - / - C57BL / 6 mice were intratracheally infected with 750 PFU influenza A / PR / 8 / 34 and monitored for survival 14 days post-infection. There were 11 males and 17 females of each genotype; Tmem176b - / - The weight loss and mortality of mice were significantly reduced.

[0041] Fig.10 :Tmem176b - / - Reduced lung tissue damage in infected mice;

[0042] Infected with 100 PFU influenza A / PR / 8 / 34 wild-type and Tmem176b - / - Results of lung pathology experiments in C57BL / 6 mice; lung injury scores were assessed by H&E staining on days 3 and 5 after infection;

[0043] Fig.11:Tmem176b - / - Reduced the inflammatory response of myeloid immune cells infected with influenza virus A / PR / 8 / 34 in vitro; ELISA was used to detect wild-type and Tmem176b infected with influenza virus A / PR8 for 24 hours - / - The contents of IL-1β, TNF, and IL-6 in the supernatants of BMDCs and BMDMs. DETAILED DESCRIPTION

[0044] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0045] (Specific embodiments of the present invention will be described in detail below. The one or more examples provided below are for illustration only and should not be considered as limiting the present invention. In fact, those skilled in the art can make various modifications and changes to the present invention without departing from the scope or spirit of the present invention. For example, a feature described in one embodiment can be used in another embodiment to produce a further embodiment.)

[0046] In the present disclosure, unless otherwise indicated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. By further guidance, the following definitions are used to better understand the teachings of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0047] In the present disclosure, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology and laboratory operation procedures used herein are terms and routine procedures widely used in the corresponding fields. At the same time, in order to better understand the present disclosure, the definitions and explanations of the relevant terms are provided below.

[0048] The terms "and / or", "or / and", and "and / or" used herein include any one of two or more related listed items, and also include any and all combinations of related listed items, wherein the any and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in the present invention, the technical solution undoubtedly includes technical solutions connected by "logical and", and undoubtedly includes technical solutions connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0049] As used herein, the terms "comprising", "including" and "comprising" are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements or method steps.

[0050] Numerical ranges expressed as endpoints herein include all numbers and fractions subsumed within the range, as well as the recited endpoints.

[0051] As used herein, reference to "about" a value or parameter includes (and describes) embodiments directed to the value or parameter itself. For example, description referring to "about X" includes description of "X".

[0052] The present invention relates to concentration values, and its meaning includes fluctuations within a certain range. For example, it can fluctuate within the corresponding accuracy range. For example, 2% can allow fluctuations within the range of ±0.1%. For values ​​that are large or do not require too fine control, its meaning is also allowed to include greater fluctuations. For example, 100mM can allow fluctuations within the range of ±1%, ±2%, ±5%, etc. Involving molecular weight, its meaning is allowed to include fluctuations of ±10%.

[0053] As used herein, the singular articles "a," "an," and "the" include plural referents unless otherwise indicated.

[0054] In the present invention, descriptions such as "plurality" and "multiple" refer to quantities greater than or equal to 2 unless otherwise specified.

[0055] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0056] The term "primer" or "primer sequence" used in the present disclosure refers to a linear oligonucleotide that hybridizes to a target DNA template to produce a target DNA: primer hybrid and initiate a DNA synthesis reaction. The upper and lower limits of the primer length are determined empirically. The lower limit of the primer length is the minimum length required to form a stable duplex when hybridizing with the target nucleic acid under nucleic acid amplification reaction conditions. Very short primers (usually less than 3 nucleotides long) do not form thermodynamically stable duplexes with the target nucleic acid under such hybridization conditions. The upper limit is often determined by the possibility of duplex formation in regions other than the predetermined nucleic acid sequence in the target nucleic acid. Typically, suitable primer lengths are in the range of about 3 nucleotides to about 40 nucleotides. The primer may be an RNA oligonucleotide, a DNA oligonucleotide, or a chimeric sequence.

[0057] The term "diagnosis" or its variants as used herein refers to determining the nature or characteristics of a condition or disease or disorder (e.g., severe viral pneumonia), detecting and / or classifying severe viral pneumonia in a subject. Diagnosis may be accompanied by a determination of the severity of severe viral pneumonia.

[0058] The term "treatment" and its variations or "improvement" as used herein refers to therapeutic treatment, wherein the purpose is to reverse, alleviate, improve, inhibit, slow down or stop the progression or severity of severe viral pneumonia, its related conditions and / or symptoms. The term "treatment" includes reducing or alleviating at least one adverse effect or symptom of severe viral pneumonia. If one or more symptoms or clinical markers are reduced, the treatment is usually "effective". As an alternative or supplement, if the progression of the disease is slowed or stopped, the treatment is "effective".

[0059] In the present invention, "preferably", "better", "more preferably", and "suitably" are only used to describe implementation methods or examples with better effects, and it should be understood that they do not constitute a limitation on the scope of protection of the present invention. In the present invention, "optionally", "optional", and "optional" refer to being optional, that is, any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent of each other.

[0060] All documents mentioned in the present invention are cited as references in the present invention, just as each document is cited as a reference separately. Unless they conflict with the invention purpose and / or technical solution of the present invention, the cited documents involved in the present invention are cited with all contents and all purposes. When the present invention involves cited documents, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When the present invention involves cited documents, the examples and preferred embodiments of the cited relevant technical features can also be incorporated into the present invention as references, but are limited to the ability to implement the present invention. It should be understood that when the cited content conflicts with the description in the present invention, the present invention shall prevail or be modified adaptively according to the description of the present invention.

[0061] The present invention relates to the use of a quantitative detection agent for a molecular marker in the preparation of a kit for diagnosing severe viral pneumonia and evaluating prognosis;

[0062] The molecular markers include TMEM176B mRNA and / or protein.

[0063] The term "quantitative detection agent of molecular marker (e.g., TMEM176B) mRNA" in the present invention should not be understood only as a detection agent for molecular marker (e.g., TMEM176B) mRNA, but should include other detection agents known to those skilled in the art that can reflect the expression level of molecular marker (e.g., TMEM176B) mRNA. For example, the expression amount of molecular marker (e.g., TMEM176B) mRNA can be indirectly detected by quantitatively detecting the cDNA obtained by reverse transcription of molecular marker (e.g., TMEM176B) mRNA.

[0064] In the present invention, unless otherwise stated, "molecular marker (such as TMEM176B) mRNA" and "molecular marker (such as TMEM176B) protein" may be replaced by "marker", "biochemical marker", "marker polypeptide", "severe viral pneumonia marker". It specifically refers to a molecule to be used as a target for analyzing a patient's experimental sample.

[0065] The molecular marker mRNA used as a marker in the present invention is expected to include its full-length ribonucleotide sequence, or naturally occurring variants, or fragments of the full-length sequence and variants, especially fragments that can be detected and determined to have a specific sequence, more preferably fragments that can be distinguished from other RNA sequences in the blood. Preferably, it contains at least 7, 8, 9, 10, 11, 12, 15 or 20 consecutive ribonucleotides of the full-length ribonucleotide sequence.

[0066] The molecular marker protein used as a marker in the present invention is expected to include naturally occurring variants of the protein and fragments of the protein or the variant, particularly immunologically detectable fragments. Immunologically detectable fragments preferably include at least 5, 6, 7, 8, 9, 10, 11, 12, 15 or 20 consecutive amino acids of the marker polypeptide. For example, the expression of "TMEM176B protein" includes the complete protein sequence of TMEM176B, and the marker polypeptide defined above.

[0067] Those skilled in the art will recognize that ribonucleotides / proteins / polypeptides released by cells or ribonucleotides present in the extracellular matrix may be damaged (e.g., during inflammation) and may be degraded or cut into such fragments. As will be appreciated by the skilled artisan, mRNA, protein or fragments thereof may also exist as part of a complex. Such a complex may also be used as a marker in the sense of the present invention. In addition, in an alternative, the marker polypeptide or its variant may carry a post-translational modification. Non-limiting examples of post-translational modifications are glycosylation, acylation and / or phosphorylation. "Naturally occurring variants" should be understood as genes of higher animals that are generally accompanied by a high frequency of polymorphisms. There are also many molecules that produce isoforms containing mutually different amino acid sequences during the splicing process.

[0068] In some embodiments, the molecular marker further comprises mRNA and / or protein corresponding to at least one of the following molecules:

[0069] AFT3, SAT1, CLK1, CRIP1, AHNAK, NR4A2, KDM6B, RSRP1, GRP183, F5, DUSP1, CSF3R, SLC38A2, SAMSN1, GSR, CD37, FOS, CKAP4, HP, LY86, SMCHD1, HES1, JUND, LST1, LIMD2, and NAPSA.

[0070] In some embodiments, the molecular marker further comprises mRNA and / or protein corresponding to at least one of the following molecules:

[0071] ATF3, SAT1, and CLK1.

[0072] In some embodiments, the quantitative detection agent includes a reagent for detecting changes in the mRNA of the molecular marker, which is suitable for at least one of the following methods: sequencing, polymerase chain reaction (PCR), isothermal amplification reaction, resonance light scattering, biological mass spectrometry, electrochemical analysis, gel electrophoresis, capillary electrophoresis, microarray, CRISPR-Cas detection system.

[0073] Among them, nucleic acid sequencing can be Maxam-Gilbert sequencing, chain termination method, shotgun sequencing, bridge PCR, single molecule real-time sequencing, ion semiconductor (ion torrent sequencing), synthesis sequencing, ligation sequencing (SOLiD sequencing), chain termination (Sanger sequencing), massively parallel tag sequencing (MPSS), polymerase clone sequencing, 454 pyrophosphate sequencing, Illumina (Solexa) sequencing, DNA nanoball sequencing, Heliscope single molecule sequencing, single molecule real-time (SMRT) sequencing, nanopore DNA sequencing, tunnel current DNA sequencing, hybridization sequencing, mass spectrometry sequencing, microfluidics Sanger sequencing, microscopy-based technology, RNAP sequencing and in vitro viral high-throughput sequencing.

[0074] Among them, PCR is preferably qRT-PCR and digital PCR.

[0075] Among them, the broad isothermal techniques can be subdivided into the following methods: methods that rely on primer displacement to initiate repeated template copies (exemplified below, HDA (helicase-dependent amplification), exonuclease-dependent amplification (EP1866434), recombinase polymerase amplification (RPA), recombinase-mediated amplification (RAA), loop-mediated amplification (LAMP), rolling circle amplification technology (RCA), multiple displacement amplification (MDA), cross-primer amplification technology (CPA)) and methods that rely on the continuous reuse of single primer molecules or de novo synthesis, SDA (strand displacement amplification and nucleic acid-based amplification (NASBA and TMA)).

[0076] Among them, according to the type of nucleic acid molecule detected, CRISPR / Cas technology nucleic acid detection can be divided into DNA (CRISPR / Cas9, CRISPR / Cas12 and CRISPR / Cas12 recognize DNA sequences) and RNA (CRISPR / Cas13 recognizes RNA sequences) detection. Further, the CRISPR-Cas includes one or more of the following: CRISPR-Cas12 detection system, CRISPR-Cas13 detection system, and Cas detection system with bypass cleavage activity similar to Cas12 and / or Cas13. Among them, the CRISPR-Cas12 detection system is preferably a CRISPR-Cas12a detection system, and the CRISPR-Cas13 detection system is preferably a CRISPR-Cas13a detection system.

[0077] In some embodiments, the quantitative detection agent includes a probe and / or primer that can specifically bind to the molecular marker mRNA or cDNA.

[0078] In some embodiments, the probe and / or the primer is detectably labeled.

[0079] In some embodiments, the quantitative detection agent includes a reagent for detecting changes in the molecular marker protein, which is suitable for at least one of the following methods:

[0080] Immunoassay, biomass spectrometry, lectin-based detection methods, and aptamer-based detection methods.

[0081] As a method for measuring the molecular marker of the present invention, any known method such as immunoassay, mass spectrometry, etc. can be used as long as it is a method for specifically measuring the molecular marker protein. Among the reagents used when measuring the marker protein of the present invention, antibodies, lectins, aptamers, etc. can be used as detection agents.

[0082] The immunoassay method is not particularly limited, and examples thereof include various enzyme immunoassays, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), double monoclonal antibody sandwich immunoassay, monoclonal polyclonal antibody sandwich immunoassay, immunostaining, immunofluorescence, protein blotting, biotin-avidin method, immunoprecipitation, colloidal gold agglutination, immunochromatography, latex agglutination (LA) and immunoturbidimetry (TIA).

[0083] As reagents used in immunoassays, commercially available antibodies against molecular markers such as TMEM176B can be used, or antibodies can be prepared by conventional methods based on the amino acid sequences of known molecular markers such as TMEM176B.

[0084] As long as it is an antibody that can detect molecular marker proteins such as TMEM176B, the animal species and clones from which it is derived are not particularly limited. Antibodies derived from rabbits, goats, mice, rats, guinea pigs, horses, sheep, camels, chickens, etc. can be cited, and both monoclonal antibodies and polyclonal antibodies are acceptable. In addition, antibodies suitable for specific binding to all subclasses of molecular marker proteins such as TMEM176B can be used. Of course, fragments such as recombinant antibodies, Fab, Fab' or F(ab')2 fragments can also be used.

[0085] As mass spectrometry, it is not particularly limited, and the ion source using electrospray ionization (ESI), matrix-assisted laser desorption ionization (MALDI), surface enhanced laser desorption ionization (SELDI) etc. can be used with a mass spectrometer combined with a time-of-flight analyzer (TOF), an ion trap analyzer (IT), a Fourier transform analyzer (FT) etc. It is possible to use LC-MS and CE-MS etc. formed by connecting a mass spectrometer with a separation device such as a high-speed liquid chromatography (HPLC) or capillary electrophoresis (CE). In addition, as a method for obtaining mass spectral data, it is possible to cite: data independent analysis (DIA), data dependent analysis (DDA), multiple reaction monitoring method (MRM) etc. The mass spectrum also includes the case where stable isotope labeling of iTRAQ reagent (SCIEX company) etc. is performed on the sample.

[0086] In some embodiments, the quantitative detection agent comprises an antibody.

[0087] In some embodiments, the antibody is a monoclonal antibody or a polyclonal antibody.

[0088] In some embodiments, at least one component of the kit is a solid, and the solid includes at least one of a lyophilized microsphere, a lyophilized cake, a lyophilized powder, and a spot that relies on the presence of a solid medium.

[0089] In the present disclosure, the terms "biological sample", "sample" and the like refer to animal samples; tissues or organs, tissue lysates, which may be from animals (preferably at least including mammals, such as primates, including humans); cells (in the subject, directly taken from the subject, or maintained in culture or from cultured cell lines), cell lysates (or lysate portions) or cell extracts; solutions containing one or more molecules derived from cells or cell materials; or solutions containing naturally or non-naturally occurring nucleic acids, which are or can be measured as described in the present disclosure. In some embodiments, the biological sample detected by the kit contains monocytes-macrophages. In some embodiments, the biological sample includes one or more of the following: blood, alveolar lavage fluid, lung tissue, nasal lavage fluid, sputum, and exhaled breath condensate. In some embodiments, the alveolar lavage fluid is bronchoalveolar lavage fluid. In some embodiments, the blood is peripheral blood.

[0090] According to another aspect of the present invention, it also relates to the use of molecules that specifically inhibit the transcription or translation of the TMEM176B gene, or can specifically inhibit the expression or activity of the TMEM176B protein in the preparation of drugs for treating severe viral pneumonia.

[0091] It is easy to understand that according to the content described in the present invention, it is effective to inhibit the expression of TMEM176B gene at the protein level or the mRNA level. The inhibition can be to partially weaken the expression of TMEM176B gene or to silence its expression.

[0092] The molecules should be understood to include but are not limited to nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, polypeptides, proteins and interfering lentiviruses, preferably nucleic acid molecules, antibody drugs or interfering lentiviruses.

[0093] In some embodiments, the nucleic acid molecule is selected from the group consisting of: antisense oligonucleotide, double-stranded RNA (dsRNA), micro RNA (micro RNA), small interfering RNA (siRNA) and short hairpin RNA (shRNA).

[0094] Embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are preferably referred to the guidance provided in the present invention, and can also be based on the experimental manual or normal conditions in this area, and can also be based on other experimental methods known in the art, or according to the conditions recommended by the manufacturer.

[0095] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0096] Unless otherwise specified, the reagents used in the context of the present invention are all commercially available. The experimental methods used in the present invention, such as bioinformatics analysis, cell experiments, DNA extraction, genome sequencing, primer design, PCR, Western blot, immunohistochemistry, etc., are all conventional methods and techniques in the art.

[0097] The specific materials and methods involved in the present invention are as follows:

[0098] Public data sources and analysis: To investigate the molecular interactions of TMEM176B in different types of samples, six gene sets extracted from the GEO database (http: / / www.ncbi.nlm.nih.gov / gds / ) were selected for study. The following table lists the detailed information of the datasets involved.

[0099]

[0100]

[0101] Classical and widely studied genes related to inflammasomes and pyroptosis were collected in combination with representative literature for correlation analysis. Inflammation-related genes: NLRC4, NLRP1, NLRP2, NLRP3, NLRP6, NLRP7, NOD1, NOD2, PLCG1, PRKACA, PYCARD, SCAF11, TIRAP, TNF. Pyroptosis-related genes: AIM2, CASP1, CASP3, CASP4, CASP5, CASP6, CASP8, CASP9, ELANE, GPX4, GSDMA, GSDMB, GSDMC, GSDMD, IL-18, IL-1B, IL6. All data were analyzed using R 4.3.1. Single cell analysis and annotation were achieved using Package Seurat 4.4. and Package SingleR 2.4.0 (https: / / github.com / dviraran / SingleR). Weighted gene co-expression network (WGCNA) analysis and high-dimensional WGCNA (hdWGCNA) analysis were implemented by Package WGCNA17.2-1 (https: / / horvath.genetics.ucla.edu / html / CoexpressionNetwork / Rpackages / WGCNA / ) and Package hdWGCNA 0.2.24 (https: / / smorabit.github.io / hdWGCNA / articles / basic_tutorial.html). Pseudo-temporal analysis was performed by Package monocle 2.30.0 (https: / / cole-trapnell-lab.github.io / monocle-release / ).

[0102] Mouse: Tmem176B - / - C57BL / 6J mice were generated by GemPharmatech (Jiangsu, China) using the CRISPR / Cas9 system. - / - The mouse genome was confirmed by PCR1 (forward: AGCTGAAAGACTGAGGCATGTC; reverse: AACATGGTTGCATTCCGAGC) and PCR2 (forward: ATTCTGACTGCCACTGATG; reverse: AASGGCCAGTTCACTGAGCTG). The micelles of the PCR1 reaction obtained a single KO band, and the PCR2 reaction without product was identified as homozygous. Tmem176B - / -Mice were bred and maintained under specific pathogen-free conditions at the Institute of Biophysics, Chinese Academy of Sciences, Beijing. WT C57BL / 6J mice were purchased from GemPharmatech, Jiangsu, China. Age- and sex-matched mice aged 6-8 weeks were used. All mice were maintained under pathogen-free conditions in the animal housing unit and transferred to an ABSL2 facility for experiments involving influenza A PR8 infection. The experimental use of mice in the present invention was performed in accordance with the guidelines of the National Institutes of Health for live animals.

[0103] Cells and viruses: Induction culture of bone marrow-derived macrophages (BMDMs) and bone marrow-derived dendritic cells (BMDCs). Bone marrow precursor cells were cultured in 30% L929 cell supernatant for 6 days for BMDM and GM-CSF (20 ng / ml; Peprotech), and IL-4 (10 ng / ml; Peplotech) for BMDC. BMDM, RAW264.7, MDCK, A549 cells were cultured in DMEM (Dulbecco's modified Eagle's medium), and BMDC, THP-1 (Procell Life Science & Technology, Wuhan, China) cell lines were cultured in ATCC modified version 1640 medium. The above culture media are routinely supplemented with 10% FBS (fetal bovine serum) and 1% penicillin / streptomycin, and the cells are cultured in a 5% CO2 incubator at 37°C. BMDM polarization induction: On day 6 of BMDM induction culture, fresh stimulation medium was replaced with RPMI 1640 medium containing 20 ng / ml M-CSF (PeproTech), 100 ng / mL LPS (Sigma) and 50 ng / mL mouse IFN-γ (PeproTech) for M1 polarization; and 10 ng / mL mouse IL-4 (PeproTech) and 10 ng / mL mouse IL-13 (PeproTech) for M2 polarization. The mouse-adapted virus strain A / Puerto Rico / 8 / 34 (H1N1) was cultured in the allantoic cavity of 10 to 11-day-old sterile egg embryos at 37°C for 2 days and a plaque assay was performed to determine the titer of the virus.

[0104] Influenza virus infection in vitro: Cells were incubated with influenza virus in 200 μL / well of 0.1% BSA-PBS for 1.5 h, washed thoroughly, and then incubated in complete medium for additional hours according to the experimental design indicated in the figure legends.

[0105] Cytokine determination: After collecting the cell supernatant of the experimental group, the concentration of IL-1β in the cell supernatant was measured using mouse IL-6, TNF-α, and IL-1β ELISA kits (NeoBioscience) and determined using a multifunctional microplate reader (TECAN).

[0106] RNA extraction and qPCR: Total RNA was extracted using the RNeasyMini kit (Qiagen 74104). RevertAid First-Strand cDNA Synthesis Kit (Thermo K1622) and Biosystems PowerUp TM SYBR TM Green Master Mix (Thermo A25741), qPCR was performed in two steps. The primers used for qPCR were as follows: Tmem176b (mouse): forward primer (5'-3'): ACTCCAGTAGAATTGCCACAG; reverse primer (5'-3'): CATCAGCATCCACATCCACC. Tmem176b (human): forward primer (5'-3'): GGCAGAAGGAGGAGTGTAGAG; reverse primer (5'-3'): CAGGAACGGGCACGGATT. Gapdh (mouse): forward primer (5'-3'): CATCACTGCCACCCAGAAGACTG; reverse primer (5'-3'): ATGCCAGTGAGCTTCCCGTTCAG. GAPDH (human): forward primer (5'-3'): TGTGAACCATAGAAGTATG; reverse primer (5'-3'): TTCACCATACAAGTGT.

[0107] Hematoxylin and eosin (H&E) staining of lung tissue: The lung injury score was evaluated using a semiquantitative scoring system. The degree of edema, interstitial and alveolar hemorrhage, atelectasis, and septal thickening were scored according to the following scoring criteria: 0 = no injury, 1 = 25% of the lung area injured, 2 = 50% of the lung area injured, 3 = 75% of the lung area damaged, and 4 = the entire lung area damaged. The infiltration score was evaluated based on the degree of inflammatory cell filtration around the three major blood vessels and main bronchi: 0 = no inflammatory cells, 1 = a small number of inflammatory cells; 2 = inflammatory cells are more unevenly distributed; 3 = a large number of inflammatory cells are relatively evenly distributed, with few aggregates; 4 = a large number of inflammatory cells aggregated. The scoring results were analyzed blindly by an experienced pathologist.

[0108] Statistical analysis: Pearson correlation analysis was used to obtain correlation analysis, and p < 0.05 indicated a significant correlation. All experimental values ​​were expressed as the mean ± standard deviation of a single sample. One-way analysis of variance (ANOVA) or student-t test was performed according to data characteristics using GraphPad Prism 9.0 to assess statistical significance. p < 0.05 was considered statistically significant.

[0109] Example 1 - Screening of myeloid immune cell biomarkers associated with severe viral pneumonia

[0110] Based on the screening of previous research reports, the inventors found that TMEM176B is an endosome membrane protein specifically expressed in myeloid immune cells, but basically not expressed in lymphoid immune cells. After bone marrow-derived dendritic cells (BMDCs) were separated from bone marrow precursor cells, Tmem176B was significantly downregulated after stimulation with LPS (0.5μg / ml) or virus-mimicking molecule poly I:C (12.5μg / ml) for 10h or 24h on the 8th day of induction. For details, see Figure 1 We then cultured multiple cell lines (about 5×10 5 / sample, n ≥ 3) were tested for the expression level of Tmem176B, see Figure 2 , it can be seen that this molecule is expressed in myeloid immune cells, but is basically not expressed in alveolar epithelial cells such as A549. In addition, we further obtained data from GEO public data sets (GSE145926, GSE149689) and performed bioinformatics analysis to find that TMEM176B is specifically expressed in monocyte-macrophage clusters, and the expression specificity of this molecule was confirmed again through public databases, see Figure 3 In addition, the expression of this gene was downregulated in multiple myeloid cell lines such as mouse primary bone marrow-derived macrophages (BMDM), mouse primary bone marrow-derived dendritic cells (BMDC), and mouse mononuclear macrophage cell line RAW264.7 after influenza infection. For details, see Figure 4 .

[0111] Subsequently, we combined multiple single-cell sequencing and common transcriptome sequencing data sets of viral pneumonia to analyze the biological functions of TMEM176B and found that TMEM176B and its interacting genes were involved in inflammatory activation ( Figure 5 ), immune cell infiltration ( Figure 6 ), myeloid cell development and differentiation ( Figure 7 ) and other important biological processes, which are closely related to the prognosis of diseases after viral infection. Based on this, we speculate that this gene may be an important biomarker for disease prognosis. Then we first performed dimensionality reduction cluster analysis on GSE202001 ( Figure 8 A), and then screened a group of intersection genes related to NLRP3 and myeloid cell differentiation ( Figure 8 B, C) and GO and KEGG analysis ( Figure 8D, E). GO analysis showed that these genes were mainly involved in macrophage activation, myeloid cell differentiation, phagocytosis, early endosomes, immune receptor activity, and MAP kinase tyrosine phosphatase activity. KEGG analysis also showed that these genes were involved in inflammatory response and cell differentiation. The above results reflect the potential regulatory role of Tmem176B in immune response, so we speculate that this gene may affect prognosis and further establish a prognostic model. We then used the random forest algorithm to screen out a total of 27 genes that interact with TMEM176B and can affect prognosis, and this group of molecules has a good degree of discrimination for people with different clinical characteristics of viral pneumonia prognosis and response prognosis, see for details. Figure 8 FK. These 27 molecules were further trained, and a prognostic model with an AUC value of 1 and 0.986 under the ROC curve was obtained in the training and internal validation sets. Finally, the model was externally validated using an independent data set, and the AUC under the ROC curve was 0.905. This means that this group of genes has a reliable ability to distinguish the severity of viral pneumonia, which helps to identify high-risk groups for severe illness through genetic testing at an early stage.

[0112] Example 2 - Effect of TMEM176B on the prognosis of influenza-infected mice

[0113] We further knocked out TMEM176B in C57B6L / J mice using Crisper / Cas9 gene editing technology. After intranasal infection with influenza A PR8, the weight and survival rate of mice were monitored. There was a significant difference in prognosis between wild mice and TMEM176B knockout mice ( Fig. 9 ), wild mice had more severe pathological damage to their lung tissues ( Fig.10 ).

[0114] Example 3 - Effect of TMEM176B on the Inflammatory Response of Myeloid Immune Cells

[0115] Excessive inflammation from myeloid immune cells is strongly associated with pathological damage to lung tissue. We then infected primary bone marrow-derived macrophages (BMDM) and dendritic cells (BMDC) with viruses in vitro and compared the differences in the release of inflammatory factors before and after TMEM176B knockout. ELISA was used to detect IL-6, TNF-α, IL-1β and other cytokines secreted by the supernatants of the two cell lines. The results showed that the release of the above inflammatory factors was reduced after TMEM176B knockout. For details, see Fig.11 The above results all confirm that this gene can act as a protective gene of the body, controlling the excessive activation of inflammation in myeloid immune cells and playing a protective role. The above studies provide evidence to support TMEM176B as a biomarker for severe viral pneumonia.

[0116] discuss

[0117] From the above results, it can be seen that TMEM176B is specifically expressed in myeloid immune cells, but is almost not expressed in alveolar epithelial cells, and the expression of this gene after virus infection is significantly different from that of normal cells. The biological processes involved in this gene and its interacting genes were analyzed by combining biological algorithms. It was found that this gene is involved in a variety of important biological processes, and the key role of this gene in inflammatory activation and pathological damage during viral infection was further confirmed by in vivo and in vitro gene knockout experiments. These findings provide potential possibilities for TMEM176B as an intervention target for severe viral pneumonia. In addition, we further screened and trained a total of 27 TMEM176B and its interacting genes as a prognostic model, which showed good prognostic prediction value in both internal and external data set verification, and provided reliable host biomarkers for early judgment and screening of severe viral pneumonia. This discovery is of great value for clinical transformation and the development of future drug targets.

[0118] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims, and the description and drawings can be used to interpret the content of the claims.

Claims

1. Application of quantitative detection agents of molecular markers in the preparation of kits for diagnosis and prognosis evaluation of severe viral pneumonia; The molecular markers include TMEM176B mRNA and / or protein.

2. The use according to claim 1, characterized in that: The molecular markers also include mRNA and / or protein corresponding to at least one of the following molecules: AFT3, SAT1, CLK1, CRIP1, AHNAK, NR4A2, KDM6B, RSRP1, GRP183, F5, DUSP1, CSF3R, SLC38A2, SAMSN1, GSR, CD37, FOS, CKAP4, HP, LY86, SMCHD1, HES1, JUND, LST1, LIMD2, and NAPSA.

3. The use according to claim 1 or 2, characterized in that: The quantitative detection agent includes a reagent for detecting changes in the molecular marker mRNA, which is suitable for at least one of the following methods: sequencing, polymerase chain reaction (PCR), isothermal amplification reaction, resonance light scattering, biomass spectrometry, electrochemical analysis, gel electrophoresis, capillary electrophoresis, microarray, CRISPR-Cas detection system.

4. The use according to claim 3, characterized in that The quantitative detection agent includes a probe and / or a primer that can specifically bind to the molecular marker mRNA or cDNA.

5. The use according to claim 1 or 2, characterized in that: The quantitative detection agent includes a reagent for detecting changes in the molecular marker protein, which is suitable for at least one of the following detection methods: immunoassay, biological mass spectrometry, lectin-based detection method and nucleic acid aptamer-based detection method.

6. The use according to any one of claims 1, 2 and 4, characterized in that: The biological sample detected by the kit contains monocytes-macrophages.

7. The use according to claim 6, characterized in that: The biological sample includes one or more of the following: blood, alveolar lavage fluid, lung tissue, nasal lavage fluid, sputum, and exhaled breath condensate.

8. Use of a molecule that specifically inhibits the transcription or translation of the TMEM176B gene, or the expression or activity of the TMEM176B protein, in the preparation of a drug for the treatment of severe viral pneumonia.

9. The use according to claim 8, wherein the molecule is selected from nucleic acid molecules, antibody drugs and interfering lentiviruses.

10. The use according to claim 9, wherein the nucleic acid molecule is selected from the group consisting of: antisense oligonucleotide, double-stranded RNA (dsRNA), micro RNA (micro RNA), small interfering RNA (siRNA) and short hairpin RNA (shRNA).

Images