Pre-eclampsia diagnosis and treatment biological marker and application thereof

Abstract

The invention discloses a preeclampsia (PE) diagnosis and treatment biological marker and an application of the preeclampsia PE diagnosis and treatment biological marker. The mechanism that overexpressed FBP2 causes PE generation by inhibiting trophoblast invasiveness is deeply demonstrated from clinical samples, cells and in-vivo levels, it is verified that NOTCH3 downstream classical gene HEY1 can be combined with an FBP2 promoter region and transcriptionally inhibits expression of the FBP2, the FBP2 is combined with c-MYC protein and inhibits c-MYC transcriptional activity, TFAM transcriptional expression is down-regulated, and the expression of the FBP2 is inhibited. The mechanism which causes mitochondrial dysfunction, weakens the migration and invasion ability of trophoblasts and participates in PE generation is a new mechanism clue obtained according to a pre-experiment result and informatics analysis and is a new target for deeply exploring PE clinical diagnosis and treatment, and research results can provide a theoretical basis for guiding PE early prediction and intervention in the future.

Description

Technical Field

[0001] The present invention belongs to the field of clinical medicine, and specifically relates to a biological marker for diagnosing and treating preeclampsia and an application thereof. Background Art

[0002] Preeclampsia (PE) is one of the idiopathic diseases of pregnancy. It occurs after 20 weeks of pregnancy and is characterized by high blood pressure (systolic blood pressure ≥140 mmHg or diastolic blood pressure ≥90 mmHg, combined with proteinuria, headache, dizziness, nausea, vomiting, upper abdominal discomfort and other symptoms. It is one of the key factors leading to increased maternal and perinatal mortality (Gestational Hypertension and Preeclampsia: ACOG Practice Bulletin, Number 222 [J]. Obstet Gynecol, 2020, 135(6): e237-e60.; KARUMANCHI SA, GRANGER J P. Preeclampsia and Pregnancy-Related Hypertensive Disorders [J]. Hypertension, 2016, 67(2):238-42). It is reported that 10-15% of pregnant women usually develop PE within 1-5 weeks (Kong Beihua, Ma Duantao. Obstetrics and Gynecology (10th Edition) [M]. People's Medical Publishing House, 2024. ARUTYUNYAN A, ROBERTS K, TROULÉ K, et al. Spatial multiomics map of trophoblast development in early pregnancy [J]. Nature, 2023, 616(7955): 143-51). To date, the etiology and pathogenesis of preeclampsia are still unclear.

[0003] PE is a pregnancy-induced syndrome with multiple factors, multiple pathways and multiple mechanisms. Its occurrence is mainly related to abnormal placental formation and abnormal interaction between the fetus and the mother at the maternal-fetal interface. The ability of extravillous trophoblast cells (EVTs) to invade the decidua, myometrium and blood vessels is reduced, and the disorder of uterine spiral artery remodeling (SAR) leads to placental dysplasia, prompting the placenta to release a variety of inflammatory and anti-angiogenic factors into the maternal circulation, thereby leading to systemic arteriolar spasm and activating multi-system and diverse clinical syndromes (NGENE NC, MOODLEY J. Role of angiogenic factors in the pathogenesisand management of pre-eclampsia [J]. Int J Gynaecol Obstet, 2018, 141(1): 5-13.;HOLLAND OJ, CUFFE JSM, DEKKER NITERT M, et al. Placental mitochondrialadaptations in preeclampsia associated with progression to term delivery [J]. Cell Death Dis, 2018, 9(12): 1150). Therefore, in-depth research on the pathogenesis of PE is of great significance for the prevention, diagnosis and treatment of PE. It can even serve as a potential target for clinical prediction, diagnosis and even treatment of PE, which is of great significance for protecting maternal and child health and reducing morbidity and maternal mortality. Summary of the invention

[0004] To solve the above problems, the present invention discloses a PE diagnosis and treatment biological marker and its application. The present invention deeply demonstrates the mechanism of FBP2 in in vivo level by inhibiting the invasiveness of trophoblastic cells, and verifies the transcriptional repressor HEY1, which can bind and bind to the FBP2 promoter region as a classic downstream target gene of NOTCH3, and transcriptionally inhibits the expression of FBP2. FBP2 binds and downregulates the transcriptional activity of c-MYC, inhibits the transcriptional expression of TFAM, leads to mitochondrial dysfunction, weakens the migration and invasion ability of trophoblastic cells, and participates in the mechanism of PE occurrence. It is a new mechanism clue obtained by the present invention based on the preliminary experimental results and informatics analysis. No relevant reports have been found in the literature search. The present invention is a new target for in-depth exploration of the clinical diagnosis and treatment of PE, and the research results can provide a theoretical basis for guiding the early prediction and intervention of PE in the future.

[0005] To achieve the above object, the technical solution of the present invention is as follows: The present invention provides use of a reagent for detecting FBP2 in preparing a PE diagnostic kit, wherein the sequence of the FBP2 is shown in SEQ ID NO.1.

[0006] SEQ ID NO. 1 FBP2 (NM_003837) CCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCTATCGATA GGTACC CTCGAG ATCTGCGATCTAAGTAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGGAAGACGCCAAAAACATAAAGAAAGG.

[0007] Furthermore, the reagent for detecting FBP2 includes a primer pair for specifically detecting FBP2 expression.

[0008] Furthermore, the upstream primer sequence of the primer pair is shown as SEQ ID NO.2, and the downstream primer sequence of the primer pair is shown as SEQ ID NO.3.

[0009] SEQ ID NO.2: 5'-3'GACCCGCTACGTTATGGAAA; SEQ ID NO.3: 5'-3'TCACCAGGGAATTGGATAGC; The present invention also provides the use of a FBP2 low expression reagent in the preparation of a drug for treating PE, wherein the sequence of the FBP2 is shown in SEQ ID NO.1.

[0010] Furthermore, the low expression reagent includes FBP2 siRNA-1#, FBP2 siRNA-2#, and FBP2 siRNA-3#.

[0011] The sequence of FBP2 siRNA-1# is shown in SEQ ID NO. 4 and SEQ ID NO. 5.

[0012] SEQ ID NO.4: 5'-3'GCGCUGUACGGUAGUGCAATT; SEQ ID NO.5: 5'-3'UUGCACUACCGUACAGCGCTT.

[0013] The sequence of FBP2 siRNA-2# is shown in SEQ ID NO. 6 and SEQ ID NO. 7.

[0014] SEQ ID NO.6: 5'-3' GGUAGCUAUGAGUAUA CAATT; SEQ ID NO.7: 5'-3'UUGUAUACUCAUAGCUACCTT.

[0015] The sequence of FBP2 siRNA-3# is shown in SEQ ID NO. 8 and SEQ ID NO. 9.

[0016] SEQ ID NO.8: 5'-3' CCUGGCUACA AUGGUGAUATT; SEQ ID NO.9: 5'-3'UAUCACCAUUGUAGCCAGGTT.

[0017] The present invention also provides the use of a low-expression reagent of FBP2 in promoting the proliferation, migration and invasion ability of trophoblast cells, wherein the sequence of the FBP2 is shown in SEQ ID NO. 1. The low-expression reagent includes FBP2 siRNA-1#, FBP2 siRNA-2#, and FBP2 siRNA-3#; the sequence of FBP2 siRNA-1# is shown in SEQ ID NO. 4 and SEQ ID NO. 5; the sequence of the FBP2 siRNA-2# is shown in SEQ ID NO. 6 and SEQ ID NO. 7; the sequence of the FBP2 siRNA-3# is shown in SEQ ID NO. 8 and SEQ ID NO. 9.

[0018] The present invention also provides a kit for diagnosing PE disease, which comprises the primer pair of SEQ ID NO.2 and SEQ ID NO.3 described above.

[0019] The present invention also provides a medicine for treating PE, the medicine comprising a FBP2 low expression agent, and the sequence of the FBP2 is shown as SEQ ID NO.1.

[0020] The beneficial effects of the present invention are: The present invention discovered for the first time that the expression of FBP2 in PE placental tissue is significantly higher than that in normal pregnancy tissue, and FBP2 can be used as a biological marker for the diagnosis and treatment of PE.

[0021] The present invention further utilizes a large number of mitochondrial function experiments (OCR experiments, IF MitoTracker® RedCMXRos experiments, flow cytometric analysis experiments, etc.) to prove that overexpressed FBP2 can inhibit mitochondrial function, affect cell biological functions such as trophoblast cell migration and invasion, and then induce SAR, leading to the occurrence and development of PE.

[0022] The activation of the HEY1-FBP2 / c-MYC-TFAM signaling pathway plays a certain role in biological processes such as the invasion and migration of extravillous trophoblast A by regulating mitochondrial function.

[0023] The present invention is helpful for the prediction and diagnosis of PE, and provides a deep understanding of the embryo implantation mechanism, and provides a new theoretical basis for the clinical treatment of PE with FBP2 as the target. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 FBP2 is significantly highly expressed in PE placenta tissue; Among them, (a) RT-qPCR was used to detect the expression level of FBP2 mRNA in normal placenta tissue (n=40) and PE placenta tissue (n=40); (b) Western blotting experiment was used to detect the expression level of FBP2 protein in 6 pairs of normal placenta and PE placenta tissues; (c) Western blotting experiment was used to detect the relative expression level of FBP2 after trophoblast cell lines HTR-8 / SVneo and BeWo were transfected with FBP2 specific siRNA; (d) Western blotting experiment was used to detect the relative expression level of FBP2 after trophoblast cell lines HTR-8 / SVneo and BeWo were transfected with FBP2 overexpression plasmid; the above experiments were repeated three times; * P<0.05, ** P<0.01); Figure 2 The high expression of FBP2 inhibits the migration and invasion ability of trophoblastic cells HTR-8 / SVneo and BeWo; Among them, (ab) Transwell assay was used to detect the changes in cell invasion and migration ability after knockdown and overexpression of FBP2 in HTR-8 / SVneo; (cd) Transwell assay was used to detect the changes in cell invasion and migration ability after knockdown and overexpression of FBP2 in BeWo, scale bar: 100 μm; Figure 3 HEY1 regulates FBP2 expression by binding to the FBP2 promoter region; Among them, (a) the JASPAR website was used to predict the specific binding site of HEY1 in the FBP2 promoter region; (b) the luciferase reporter gene experiment was used to detect the specific binding site of HEY1 in the FBP2 promoter region; (c) the ChIP-qPCR experiment was used to analyze the specific binding site of HEY1 in the FBP2 promoter region and the specific regulatory mechanism; (de) RT-qPCR and western blotting experiments were used to detect the mRNA and protein levels of FBP2 in the HTR-8 / SVneo trophoblast cell line transfected with si-Control and si-HEY1; (fg) RT-qPCR and western blotting experiments were used to detect the mRNA and protein levels of FBP2 in the BeWo trophoblast cell line transfected with si-Control and si-HEY1; (hi) RT-qPCR and western blotting experiments were used to detect the difference in FBP2 expression in the HTR-8 / SVneo trophoblast cell line after overexpression of HEY1; (jk) RT-qPCR and western blotting experiments were used to detect the difference in FBP2 expression in BeWo trophoblast cell lines after overexpression of HEY1; the above experiments were repeated three times; (*P<0.05, **P<0.01); Figure 4 Overexpression of FBP2 inhibited c-MYC expression, and FBP2 and c-MYC colocalized in the TFAM promoter region; Among them, (a) Co-IP experiment combined with western blotting experiment verified that at the cellular level, c-MYC protein was pulled down by using FBP2 antibody, and FBP2 protein was pulled down by using c-MYC antibody; (bc) RT-qPCR and western blotting experiments were used to detect the changes in mRNA and protein expression of c-MYC and TFAM in HTR-8 / SVneo trophoblasts transfected with si-Control or si-FBP2; (de) RT-qPCR and western blotting experiments were used to detect the changes in mRNA and protein expression of c-MYC and TFAM in BeWo trophoblasts transfected with si-Control or si-FBP2; (fg) RT-qPCR and western blotting experiments were used to analyze the mRNA expression of c-MYC and TFAM in HTR-8 / SVneo trophoblasts after overexpression of FBP2; (hi) RT-qPCR and western blotting experiments were used to analyze the mRNA expression of c-MYC and TFAM in BeWo trophoblasts after overexpression of FBP2; (j) ChIP-qPCR experiments verified the binding of c-MYC to the TFAM promoter region. The above experiments were repeated three times; * P <0.05, ** P <0.01); Figure 5 To inhibit the expression of TFAM by low expression of c-MYC Among them, (ab) RT-qPCR and western blotting experiments were used to detect the relative expression of c-MYC in the extravillous trophoblast cell lines HTR-8 / SVneo and BeWo after transfection with c-MYC-specific siRNA; (cd) RT-qPCR and western blotting experiments were used to analyze the mRNA and protein expression of TFAM in the trophoblast cell line HTR-8 / SVneo after knocking down c-MYC; (ef) RT-qPCR and western blotting experiments were used to analyze the mRNA and protein expression of TFAM in the trophoblast cell line BeWo after knocking down c-MYC; the above experiments were repeated three times; ( * P <0.05, ** P <0.01); Figure 6 Abnormal expression of FBP2 and its downstream c-MYC affects changes in mitochondrial morphology and quality; Among them, (a) the change in the ratio of mtDNA / nDNA in HTR-8 / SVneo and BeWo trophoblasts after knocking down FBP2 was verified by mitochondrial separation experiments and RT-qPCR experiments; (b) the change in the ratio of mtDNA / nDNA in HTR-8 / SVneo and BeWo trophoblasts after overexpressing FBP2 was verified by mitochondrial separation experiments and RT-qPCR experiments; (c) the change in the ratio of mtDNA / nDNA in HTR-8 / SVneo and BeWo trophoblasts after knocking down c-MYC was verified by mitochondrial separation experiments and RT-qPCR experiments; (de) the changes in mitochondrial morphology and fluorescence intensity in HTR-8 / SVneo and BeWo trophoblast cell lines after overexpressing FBP2 under confocal microscopy, the fluorescence intensity of TFAM and the corresponding quantitative graph; scale bar: 20 μm; (fg) the changes in mitochondrial morphology and fluorescence intensity in HTR-8 / SVneo and BeWo trophoblast cell lines after knocking down c-MYC under confocal microscopy, the fluorescence intensity of TFAM and the corresponding quantitative graph; scale bar: 20 μm; (h) Flow cytometry was used to verify the mitochondrial fluorescence intensity after overexpression of FBP2 in HTR-8 / SVneo and BeWo trophoblast cell lines; Mitotracker GreenFM was used as mitochondrial dye; the above experiments were repeated three times; ( * P <0.05, ** P <0.01); Figure 7 Abnormal expression of FBP2 and its downstream c-MYC affects mitochondrial oxidative phosphorylation; Among them, (ab) using Seahorse XF experiment to detect abnormal changes in OCR after knocking down FBP2 in HTR-8 / SVneo and BeWo trophoblasts and quantitative analysis; (cd) using Seahorse XF experiment to detect abnormal changes in OCR after overexpressing FBP2 in HTR-8 / SVneo and BeWo trophoblasts and quantitative analysis; (ef) using Seahorse XF experiment to detect abnormal changes in OCR after knocking down c-MYC in BeWo trophoblasts and quantitative analysis; (gh) Western blotting experiment to detect the difference in TFAM protein expression in HTR-8 / SVneo and BeWo trophoblasts after transfection of Vector, OE-FBP2, OE-FBP2&OE-c-MYC and quantitative graph; the above experiments were repeated three times; ( * P<0.05, ** P<0.01); Figure 8 To validate the FBP2 pathway in human tissue experiments; Among them, (a) qPCR experiment verified the difference in HEY1, FBP2, c-MYC and TFAM mRNA levels in 6 pairs of normal and PE patient placental tissues; (b) Western Blotting experiment verified the difference in HEY1, FBP2, c-MYC and TFAM protein expression in 6 pairs of normal and PE patient placental tissues; (c) IF experiment detected the positive expression of TFAM in PE group and control placental tissues and quantification graph. Scale bar, 50 μm; (d) After immunofluorescence experiment and related antibodies (HCG & HLA-G antibodies) were used to identify primary trophoblasts, qPCR experiment was used to verify the difference in HEY1, FBP2, c-MYC and TFAM mRNA levels; scale bar, 10 μm. (fg) IF experiment detected the positive expression of FBP2 and TFAM in PE group and control placental tissues and quantification graph; scale bar, 50 μm; the above experiments were repeated three times. ( * P<0.05, ** P<0.01); Fig. 9 To verify the HEY1-FBP2 / c-MYC-TFAM pathway in animal experiments; Among them, (a) a simplified diagram of the pregnant mouse model of L-NAME-induced PE and the timeline of drug injection and sample collection; (b) changes in blood pressure (systolic and diastolic) during pregnancy in the control group and L-NAME group; (c) images of fetuses and placentas of pregnant mice in the control group and pregnant mice with L-NAME-induced PE; (d) Western blotting experiments to verify the expression differences and quantification of HEY1, FBP2, c-MYC and TFAM in the placental tissues of the control group and PE; all the above experiments were repeated three times; * P <0.05, ** P <0.01).

[0025] Fig.10 Schematic diagram of the c-MYC / FBP2-TFAM regulatory axis regulated by the classic downstream target gene HEY1 of NOTCH3. DETAILED DESCRIPTION

[0026] The present invention will be further explained below in conjunction with the accompanying drawings and specific embodiments. It should be understood that the following specific embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention. Example 1

[0027] RT-qPCR and western blotting experiments were used to detect the mRNA expression level of FBP2 in placental tissue, and Transwell experiments were used to verify that FBP2 was involved in inhibiting the invasion and migration ability of trophoblastic cells.

[0028] method Sample collection Placental tissues were collected from 40 pairs of normal pregnant women and PE pregnant women who delivered by cesarean section at Nanjing Maternal and Child Health Hospital from January to December 2021. The placental tissue samples were collected on the maternal side of the umbilical cord attachment site, avoiding the placental calcification infarction focus. The sample size was 1*1*1cm and stored in liquid nitrogen for extraction of tissue RNA and tissue protein. This study has been approved by the Ethics Committee of Nanjing Maternal and Child Health Hospital, and all patients signed written informed consent. The general conditions of pregnant women in the normal control group and PE group, including age, pre-pregnancy weight, blood pressure, gestational age at termination, and neonatal weight, were collected, as shown in Table 1.

[0029] Table 1 Comparison of clinical characteristics of patients in the control group and PE group

[0030] Extraction of tissue (cell) RNA and RT-qPCR Total RNA was isolated from tissues and cultured cells using Trizol reagent (Invitrogen), and its quality and quantity were assessed by anoDrop2000c (Fisher Scientific, Waltham, Massachusetts, USA). RNA was reverse transcribed into cDNA using HIScriptIII All-in-one RT SuperMix Kit (Vazyme). Quantitative PCR was then performed using Taq Prouniversal SYBR qPCR Master Mix Kit (Vazyme) and FBP2 primers, the FBP2 primer sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0031] Western blotting experiments HTR-8 / SVneo and BeWo cells were harvested after transfection in 6-well plates. Then, total cell protein was extracted using RIPA protein extraction reagent (MCE, USA) and protease inhibitors (MCE, USA). Proteins were separated by 10% SDS-PAGE and transferred to 0.22 μm PVDF membranes (Sigma). The PVDF membranes were blocked in 5% skim milk and then placed on a shaker at 4 °C and infiltrated with diluted FBP2 primary antibody (1:1000, Proteintech). The next day, after TBST washing, the secondary antibody (1:10000, Proteintech) was incubated, and the images were collected and processed by FusionCapt Advance Fx5 software (Vilber Lourmat). All experiments were repeated three times independently.

[0032] Transwell experiment The cells transfected for 24-48 h in a 6-well plate were digested and resuspended, and the cell density was adjusted (cell density 1×10 5 / ml), 700 μl of complete medium was added to the lower chamber of the 24-well plate, and 3×10 cells were added to the small chamber. 4 300 μl of cell suspension was cultured until a specific time point (30 h), and the cells were taken out, fixed with 4% paraformaldehyde and stained with crystal violet, washed with PBS several times, and photographed and counted, and the results were statistically analyzed.

[0033] Statistical analysis Normally distributed data are shown as mean ± SEM and compared by two-tailed Student's t-test using GraphPad Prism 7.0 (www.GraphPad.com). The number of independent experiments is indicated in the figure legends. P values ​​less than 0.05 were considered statistically significant (*p < 0.05 and **p < 0.01; ns, not statistically significant).

[0034] result FBP2 is significantly overexpressed in PE placenta tissue, and overexpression of FBP2 can inhibit the invasion and migration ability of trophoblastic cells The general conditions (age, BMI, systolic / diastolic blood pressure, etc.) of 40 pairs of pregnant women in the normal group and the PE group were compared and analyzed. The systolic and diastolic blood pressures of the PE group were significantly higher than those of the normal control group (P<0.01), and the proportion of proteinuria in the PE group was significantly higher than that of the pregnant women in the control group (P<0.05). In terms of newborns, the weight of newborns in the PE group was nearly 300g lighter than that in the control group, and the difference was statistically significant. There were no significant differences between the two groups in other aspects (P>0.05) ( surface 1). To confirm the difference in the expression of FBP2 in the placenta tissue of PE patients, RT-qPCR and western blotting were used to detect the mRNA and protein levels of FBP2 between the placenta tissue of the PE group and the control group. The results showed that compared with the control group, the expression levels of FBP2 mRNA and protein in the placenta tissue of the PE group were significantly upregulated ( Figure 1 ab).

[0035] Based on the fact that weakened trophoblast invasion is a key factor leading to uterine spiral artery remodeling disorder, the present invention further analyzed the effect of FBP2 on the invasion and migration ability of trophoblast cell lines. First, the present invention used western blotting experiments to verify the knockdown efficiency of FBP2 siRNA, and selected FBP2-siRNA-1# and 2# as siRNA for subsequent experiments ( Figure 1 c), and the present invention also verifies the overexpression effect of FBP2 plasmid ( Figure 1d). Transwell assay was used to verify that the reduction of FBP2 expression can promote the migration and invasion ability of trophoblast cell lines HTR-8 / SVneo and BeWo ( Figure 2 ab), while overexpression of FBP2 inhibited the migration and invasion abilities of trophoblast cell lines HTR-8 / SVneo and BeWo ( Figure 2 cd). Example 2

[0036] Fluorescent reporter enzyme and ChIP-qPCR experiments verified that HEY1 inhibited FBP2 expression by binding to and methylating the FBP2 promoter region method Luminescent reporter enzyme assay The amplified cDNA fragments of the HEY1 and FBP2 promoter regions were subcloned into the downstream of the luciferase gene in the pGL3 plasmid. The sequence of HEY1 is shown in SEQ ID NO. 10, and the sequence of the FBP2 promoter region is shown in SEQ ID NO. 11. DNA polymerase was used to obtain mutant plasmids (i.e., pGL3-HEY1-30-UTR-MUT and pGL3-FBP2-MUT). The luciferase activity was determined using the dual luciferase reporter assay system (Promega, Madison, WI). Briefly, HTR-8 / SVneo cells (1×10 cells per well) were cultured and plated with 1% paraformaldehyde (1% paraformaldehyde) for 24 h. 5 ) were placed in 24-well plates for 36 hours. 48 hours after transfection, cells were lysed and collected. Relative luciferase activity was normalized to renal luciferase activity.

[0037] SEQ ID NO.10 HEY1(NM_012258) CCACTCCCAGGTCCAACTGCACCTCGGTTCTGCTAGCGTTTAAACGGGCCC TCTAGACGCCACCATGAAGCGAGCTCACCCCGAGTACAGCTCCTCGGACAGCGAGCTGGACGAGACCATCGAGGTGGAGAAGGAGAGTGCGGACGAGAATGGAAACTTGAGTTCGGCTCTAGGTTCCATGTCCCCAACTACATCTTCCCAGATTTTGGCCAGAAAAAGACGGAGAGGAATAATTGAGAAGCGCCGACGAGACCGGATCAATAACAGTTTGTCTGAGCTGAGAAGGCTGGTACCCAGTGCTTTTGAGAAGCAGGGATCTGCTAAGCTAGAAAAAGCCGAGATCCTGCAGATGACCGTGGATCACCTGAAAATGCTGCATACGGCAGGAGGGAAAGGTTACTTTGACGCGCACGCCCTTGCTATGGACTATCGGAGTTTGGGATTTCGGGAATGCCTGGCAGAAGTTGCGCGTTATCTGAGCATCATTGAAGGACTAGATGCCTCTGACCCGCTTCGAGTTCGACTGGTTTCGCATCTCAACAACTACGCTTCCCAGCGGGAAGCCGCGAGCGGCGCCCACGCGGGCCTCGGACACATTCCCTGGGGGACCGTCTTCGGACATCACCCGCACATCGCGCACCCGCTGTTGCTGCCCCAGAACGGCCACGGGAACGCGGGCACCACGGCCTCACCCACGGAACCGCACCACCAGGGCAGGCTGGGCTCGGCACATCCGGAGGCGCCTGCTTTGCGAGCGCCCCCTAGCGGCAGCCTCGGACCGGTGCTCCCTGTGGTCACCTCCGCCTCCAAACTGTCGCCGCCTCTGCTCTCCTCAGTGGCCTCCCTGTCGGCCTTCCCCTTCTCTTTCGGCTCCTTCCACTTACTGTCTCCCAATGCACTGAGCCCTTCAGCACCCACGCAGGCTGCAAACCTTGGCAAGCCCTATAGACCTTGGGGGACGGAGATCGGAGCTTTTTAA T CTAGATAGTTAAACCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTTGTTTGCCCCTCCCCGTGCC.

[0038] SEQ ID NO.11 FBP2(80685-1)-p1:TTTCTCTATCGATAGGTACCTTGGACATCTTCCCATAATATTTG; FBP2(80685-1)-p2:CTTAGATCGCAGATCTCGAGTTTGGCTGGAATGCTTCAAATCC.

[0039] Chromatin immunoprecipitation The experiment used Merck's EZ Magna ChIP A / G (Merck, 17-10086). After the intracellular DNA was fixed and cross-linked with formaldehyde, the cells were lysed with cell lysis buffer and cell nuclear lysis buffer to release the nuclear chromatin. After further ultrasonic disruption of the chromatin, FBP2 antibody was added to the cell lysis buffer (1:50) and placed in a vertical suspension instrument for suspension overnight at 4°C. The next day, EZ Magna ChIP A / G magnetic beads (Merck, 17-10086) were added to the antibody-cell lysis buffer and incubated at 4°C for 4-6 hours. The precipitated complex was subsequently collected and washed to remove non-specific binding proteins; eluted to obtain the enriched target protein-DNA complex, and the enriched DNA fragments were de-crosslinked and purified, and then verified by qPCR analysis using the primer sequence of FBP2. The FBP2 primer sequence is shown in SEQ ID NO.2 and SEQ ID NO.3.

[0040] Extraction of tissue (cell) RNA and RT-qPCR Total RNA was isolated from tissues and cultured cells using Trizol reagent (Invitrogen), and its quality and quantity were assessed by anoDrop2000c (Fisher Scientific, Waltham, Massachusetts, USA). RNA was reverse transcribed into cDNA using HIScriptIII All-in-one RT SuperMix Kit (Vazyme). Quantitative PCR was then performed using Taq Prouniversal SYBR qPCR Mix Kit (Vazyme) and specific FBP2 primers, the FBP2 primer sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0041] Cell culture and transfection Trophoblast cell lines were cultured in an incubator with 90% humidity, 37°C and 5% CO2. Both human trophoblast cell lines (HTR-8 / SVneo and BeWo) were purchased from the cell bank of the Chinese Academy of Sciences (Shanghai, China). HTR-8 / SVneo cells were cultured in DMEM (Gibco, USA) medium containing 10% FBS, and 100 U / ml penicillin and 100 mg / ml streptomycin were added to the above culture. Trophoblast cell lines HTR-8 / SVneo and BeWo cells were cultured in 6-well plates until 80% confluence, and si-HEY1-1# and si-HEY1-2# were constructed. The sequences of HEY1 siRNA-1# are shown in SEQ ID NO.12 and SEQ ID NO.13; the sequences of HEY1 siRNA-2# are shown in SEQ ID NO.14 and SEQ ID NO.15. HEY1 high expression reagent was constructed, and the sequence of HEY1 was shown in SEQ ID NO. 10. siRNA or overexpression reagent was transfected using lipo 2000 (Invitrogen, USA), and cells were collected 24-48 hours after transfection for RT-qPCR and western blotting experimental verification. RT-qPCR used HEY1 and FBP2 primer pairs, and the HEY1 primer sequences were shown in SEQ ID NO. 16 and SEQ ID NO. 17, and the FBP2 primer sequences were shown in SEQ ID NO. 2 and SEQ ID NO. 3. HEY1 antibody (dilution ratio 1: 1000, Proteintech) and FBP2 antibody (dilution ratio 1: 1000, Proteintech) were used in Western blotting experiments.

[0042] SEQ ID NO.12 5'-3' GCAGGAGGGAAAGGUUACUUUTT; SEQ ID NO.13 5'-3'AAAGUAACCUUUCCCUCCUGCTT; SEQ ID NO.14 5'-3'CCGACGAGACCGGAUCAAUAATT; SEQ ID NO.15 5'-3' UUAUUGAUCCGGUCUCGUCGGTT; SEQ ID NO.16 5′-3′ AAGCAGGTAATGGAGCAAGG; SEQ ID NO.17 5′-3′ CGAAATCCCAAACTCCGATA.

[0043] result The JASPAR website predicted that there were binding sites in the promoter regions of the classic target genes HEY1 and FBP2 downstream of NOTCH3 ( Figure 3 a), so a reporter gene plasmid vector3.1(+)-HEY1 was constructed in which a specific fragment of the FBP2 promoter was inserted in front of the luciferase expression sequence. The reporter gene plasmid and vector3.1(+)-HEY1 were co-transfected into HEK293T cells. The results showed that the HEY1 transcription factor could activate the FBP2 promoter region, and the luciferase gene was inhibited from being expressed. The expression of luciferase was inversely proportional to the intensity of the transcription factor. After mutating a specific site in the promoter region of FBP2, the expression of luciferase increased significantly. The experimental results show that HEY1 inhibits the expression of FBP2 by binding to the promoter region of FBP2 ( Figure 3 b). By consulting the literature, the present invention speculates that HEY1 usually binds to histone H3 in the promoter region of downstream target genes and regulates the expression of target genes through methylation. In order to verify the viewpoint of the literature and specifically analyze the relationship between HEY1 and FBP2, the present invention adopts the method of chromosome immunocoprecipitation (Chromatin immunocoprecipitation, CHIP). The results show that HEY1 is highly bound to the promoter region of FBP2, and is highly bound to histone H3 ( Figure 3 c). Further, after knocking down HEY1, the expression of FBP2 in HTR-8 / SVneo and BeWo trophoblasts increased ( Figure 3 dg), while FBP2 expression in trophoblasts was inhibited after overexpression of HEY1 ( Figure 3 hk). Example 3

[0044] Analysis of FBP2 downstream signaling pathway method Extraction of tissue (cell) RNA and RT-qPCR Total RNA was isolated from tissues and cultured cells using Trizol reagent (Invitrogen), and its quality and quantity were assessed by anoDrop2000c (Fisher Scientific, Waltham, Massachusetts, USA). RNA was reverse transcribed into cDNA by HIScriptIII All-in-one RT SuperMix Kit (Vazyme). Quantitative PCR was then performed using Taq Prouniversal SYBR qPCR Mix Kit (Vazyme) and specific FBP2, c-MYC and TFAM primers, the FBP2 primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3; the c-MYC primer sequences are shown in SEQ ID NO.18 and SEQ ID NO.19, and the TFAM primer sequences are shown in SEQ ID NO.20 and SEQ ID NO.21.

[0045] SEQ ID NO.18 5′-3′ CCGCCTGCGATGATTTATAC; SEQ ID NO.19 5′-3′ CAGCCGAGCACTCTAGCTCT; SEQ ID NO.20 5′-3′ GCCCTAAGTCCCTGTGTCAT; SEQ ID NO.21 5′-3′ TGCATTTGTCCCGAGATGTT.

[0046] Cell culture and transfection Trophoblast cell lines were cultured in an incubator with 90% humidity, 37°C, and 5% CO2. Both human trophoblast cell lines (HTR-8 / SVneo and BeWo) were purchased from the cell bank of the Chinese Academy of Sciences (Shanghai, China). HTR-8 / SVneo cells were cultured in DMEM (Gibco, USA) medium containing 10% FBS, and 100 U / ml penicillin and 100 mg / ml streptomycin were added to the above culture medium. Trophoblast cell lines HTR-8 / SVneo and BeWo cells were cultured in 6-well plates until 80% confluence, and si-Control, si-FBP2-1#, and si-FBP-2# were constructed. The sequence of the FBP2 siRNA-1# was shown in SEQ ID NO.4 and SEQ ID NO.5; the sequence of the FBP2 siRNA-2# was shown in SEQ ID NO.6 and SEQ ID NO.7; a FBP2 overexpression reagent was constructed, and the FBP2 sequence was shown in SEQ ID NO.1; c-MYC siRNA-1, 2# were constructed, and the sequence of the c-MYC siRNA-1# was shown in SEQ ID NO.22 and SEQ ID NO.23; the sequence of the c-MYC siRNA-2# was shown in SEQ ID NO.24 and SEQ ID NO.25; siRNA was transfected using lipo 2000 (Invitrogen, USA), and cells were collected 24-48 hours after transfection for RT-qPCR and western blot. Western blotting experiments were performed using HEY1 antibody (dilution ratio 1:1000, Proteintech), FBP2 antibody (dilution ratio 1:1000, Proteintech), and TFAM antibody (dilution ratio 1:2000, Proteintech).

[0047] SEQ ID NO.22 5'-3' CAGAAAUGUCCUGAGCAAUTT; SEQ ID NO.23 5'-3' AUUGCUCAGGACAUUUCUGTT; SEQ ID NO.24 5'-3'CGAGCUAAAACGGAGCUUUTT; SEQ ID NO.25 5'-3'AAAGCUCCGUUUUAGCUCGTT.

[0048] Co-Immunoprecipitation (Co-IP) NP-40 lysis buffer (MCE, USA) and protease inhibitor cocktail (MCE, USA) were mixed at a ratio of 1:100 and added to HTR-8 / SVneo cells for lysis and protein extraction. The protein lysis buffer was incubated with anti-IgG (3-5ug) and target gene antibody (FBP2 or c-MYC, 3-5ug) at 4°C overnight. The next day, after washing A / G agarose beads (Santa, USA) several times with PBST buffer, the protein antibody complex was incubated with agarose beads at 4°C for 4-6 hours. The agarose beads were then extracted and washed 3 times with PBST. Finally, 1x loading buffer was added and heated at 95°C for 10 minutes, followed by western blot analysis.

[0049] Chromatin immunoprecipitation (ChIP-qPCR) The experiment used Merck's EZ Magna ChIP A / G (Merck, 17-10086). After the intracellular DNA was fixed and cross-linked with formaldehyde, the cells were lysed with cell lysis buffer and cell nuclear lysis buffer to release the nuclear chromatin. After further ultrasonic disruption of the chromatin, FBP2 antibody was added to the cell lysis buffer (1:50) and placed in a vertical suspension instrument for suspension overnight at 4°C. The next day, EZ Magna ChIP A / G magnetic beads (Merck, 17-10086) were added to the antibody-cell lysis buffer and incubated at 4°C for 4-6 hours. The precipitated complex was subsequently collected and washed to remove non-specific binding proteins; eluted to obtain the enriched target protein-DNA complex, and the de-crosslinking and purification of the enriched DNA fragments were verified by qPCR analysis. The qPCR used a TFAM primer pair, and the TFAM primer sequences are shown in SEQ ID NO.20 and SEQ ID NO.21.

[0050] result The present invention uses Co-IP experiments to verify the binding of FBP2 to c-MYC protein ( Figure 4 a), and then further analyzed the regulatory relationship between FBP2, c-MYC and TFAM. First, this study used RT-qPCR and western blotting experiments to verify that after siFBP2 was transfected into HTR-8 / SVneo and BeWo cells, the expression of c-MYC and TFAM increased significantly ( Figure 4be). In contrast, after overexpression of FBP2 in the above two trophoblast cell lines, the results of RT-qPCR and western blotting experiments showed that the expression levels of c-MYC and TFAM were significantly lower than those in the control group ( Figure 4 fi). Secondly, in order to clarify the linear regulatory relationship between c-MYC and TFAM, the present invention uses ChIP-qPCR experiments to verify that c-MYC binds to the TFAM promoter region and transcriptionally upregulates the expression of TFAM ( Figure 4 j). At the same time, this study constructed c-MYC knockdown siRNA and transfected it into trophoblast cell lines ( Figure 5 ab), RT-qPCR and western blotting results showed that decreased c-MYC expression could inhibit the expression of TFAM ( Figure 5 cf). In summary, the present invention infers that FBP2 can bind to c-MYC protein and transcriptionally regulate the expression of TFAM. Example 4

[0051] FBP2 is involved in regulating mitochondrial function method qPCR detection of mtDNA / nDNA ratio after mitochondrial isolation experiment After the cells were broken by a grinder, the cell nucleus and mitochondria were separated using a mitochondrial separation and protein extraction kit (Proteintech, PK10016). The cell nucleus and mitochondria were lysed using a nuclear lysis buffer and a mitochondrial lysis buffer. The nuclear DNA and mitochondrial DNA were extracted using a DNA extraction kit and then quantified and compared by qPCR. tRNA was used for qPCR. Leu and β2M primer pair, the tRNA Leu The primer sequences are shown in SEQ ID NO.26 and SEQ ID NO.27; the β2M primer sequences are shown in SEQ ID NO.28 and SEQ ID NO.29.

[0052] SEQ ID NO.26 5′-3′ CACCCAAGAACAGGGTTTGT; SEQ ID NO.27 5′-3′ TGGCCATGGGTATGTTGTTA; SEQ ID NO.28 5'-3'TGCTGTCTCCATGTTTGATGTATCT; SEQ ID NO.29 5'-3'TCCTCTGCTCCCCACCTCTAAGT.

[0053] MitoTracker® Red CMXRos staining and confocal microscopy imaging After inoculating trophoblast cell lines HTR-8 / SVneo and BeWo on cell slides, they were transfected with Vector and FBP2 siRNA, respectively, and stained with MitoTracker Red CMXRos (100 nM, Invitrogen, USA) at 37°C for 30 min. After staining, the cells were washed twice with preheated PBS and fixed with preheated 4% paraformaldehyde (biosharp, China) for 15 min. After washing with PBS, 0.1% TritonX-100 solution (biosharp, China) was added to permeabilize the cells. After washing with PBS, antifade containing DAPI (biosharp, China) was added and the slides were mounted. Fluorescence images were acquired using a Zeiss LSM 700 laser scanning confocal microscope (Zeiss, Germany). The excitation wavelengths of MitoTracker Red CMXRos and DAPI were 579 nm and 405 nm, respectively, and images were collected and analyzed.

[0054] MitoTracker® Green FL staining and flow cytometric analysis Trophoblast cells were digested and resuspended with 0.25% trypsin (Gibco, USA) and seeded in 6-well plates. After 24 h, MitoTracker® Green FL reagent (ratio 1:2 000, Invitrogen, USA) was added to the cell wells and incubated at 37 °C for 30 min. The cells were washed with PBS (Gibco, USA), and EDTA-free trypsin (Gibco, USA) was added to digest and resuspend the cells. The cells were analyzed on a flow cytometer (Beckman, USA).

[0055] Transmission electron microscopy to examine mitochondrial morphology Use a cell scraper to scrape the cells off the wall of the cultured porous plate, then place in a centrifuge at 2000-3000r / min and centrifuge for 5 minutes; then discard the supernatant to retain the cell pellet, and add a high concentration of about 4% glutaraldehyde (Invitrogen, USA) to fix it (do not suspend the cells during fixation). After fixation for three or four hours, use a cell picking needle to gently pick up the cells along the side of the centrifuge tube (note that the cells should not be scattered when picking. If the cells are large after clustering, use a double-sided blade to cut the cell clusters into pieces ≤1mm 3 The cell clusters were then fixed in 2.5% to 3% glutaraldehyde (Invitrogen, USA), followed by washing, osmium acid post-fixation, embedding, sectioning, staining, observation, and photography using a transmission electron microscope.

[0056] Seahorse XF Experiment Mitochondrial stress test (Oxygen consumption rate, OCR) Preparation before the experiment: Cells were seeded at an appropriate density in an XF-24-well cell culture plate (Agilent, USA), and XF Cell Mitochondrial Stress Test Solution (Agilent, USA) and XF Cell Mitochondrial Stress Test Reagent (Agilent, USA) were incubated at 37°C in advance. The probe plate was hydrated overnight before the experiment. (1) Remove the cells that have been transfected for 24 to 48 hours from the CO2 cell culture incubator and observe the cell status under an optical microscope. If the cells are in good condition, continue the experiment; (2) Discard the culture medium in the original well, wash the cells twice with XF Mitochondrial Stress Test Detection Solution (1 mL), and finally add about 500 μl of the detection solution. Observe under a microscope to ensure that the cells have not been sucked away; (3) Then place the cell plate treated in step (2) in a 37°C incubator (no CO2) for 1 hour, then use the Mitochondrial Stress Test Detection Solution to fully dissolve the drug and adjust the drug concentration; (4) Remove the hydrated probe plate (Agilent, USA) from the CO2-free incubator and add drugs to the drug wells of the probe plate: A well - 1 μM oligomycin (Agilent, USA) final concentration per well, B well - 1 μM carbonylcyanide-4-trifluoromethoxyaniline (carbonylcyanide p-trifluoromethoxyphenylhydrazone, FCCP) (Agilent, USA) uncoupler diluent, C well - 0.5 μM rotenone / antimycin A (Agilent, USA) final concentration per well; (5) Open the Seahorse software and set the mitochondrial stress experiment program. The default Mix-Wait-Measure time is 3 min-2 min-3 min. In the running interface, remove the support plate and cover plate, and put in the probe plate for self-test for about 20 minutes; (6) After the self-test is completed, replace the function plate with the cell plate and continue the experiment. The reagents for cell transfection are (1) FBP2 siRNA-1, 2#, the sequence of the FBP2 siRNA-1# is shown in SEQ ID NO.4 and SEQ ID NO.5; the sequence of the FBP2 siRNA-2# is shown in SEQ ID NO.6 and SEQ ID NO.7; (2) FBP2 overexpression plasmid, the sequence of the FBP2 is shown in SEQ ID NO.1; (3) c-MYC siRNA-1, 2#, the sequence of the c-MYC siRNA-1# is shown in SEQ ID NO.22 and SEQ ID NO.23; the sequence of the FBP2 siRNA-2# is shown in SEQ ID NO.24 and SEQ ID NO.25; Extracellular Acidification Rate (ECAR) Preparation before the experiment: Cells were seeded at an appropriate density in an XF-24-well cell culture plate, and XF Cell XF Glycolysis Assay Solution (Agilent, USA) and XF Cell Glycolysis Assay Reagent (Agilent, USA) were incubated at 37°C in advance. The probe plate was hydrated overnight before the experiment. (1) Remove the cells that have been transfected for 24 to 48 hours from the CO2 cell culture incubator and observe the cell status under an optical microscope. If the cells are in good condition, continue the experiment; (2) Discard the culture medium in the original well, wash the cells twice with XF Glycolysis Detection Solution (1 mL), and finally add about 500 μl of the detection solution. Observe under a microscope to ensure that the cells have not been sucked away; (3) Then place the cell plate treated in step (2) in a 37°C incubator (no CO2) for 1 hour, then use XF Glycolysis Detection Solution to fully dissolve the drug and adjust the drug concentration; (4) Remove the hydrated probe plate from the CO2-free incubator and add drugs to the drug wells of the probe plate: A well - 10 mM glucose (Glucose, Agilent, USA) final concentration per well, B well - 1 μM oligomycin dilution, C well - 50 mM 2-Deoxy-D-glucose (2-DG) (Agilent, USA) final concentration; (5) Open the Seahorse software and set the glycolysis detection program. The default Mix-Wait-Measure time is 3 min-2 min-3 min. In the running interface, remove the support plate and cover plate, and put in the probe plate for self-test for about 20 minutes; (6) After the self-test is completed, replace the function plate with the cell plate and continue the experiment.

[0057] result The results of RT-qPCR experiments after knocking down or overexpressing FBP2 at the cellular level in the present invention showed that knocking down FBP2 could upregulate the ratio of mtDNA / nDNA in HTR-8 / SVneo and BeWo cells ( Figure 6 a), while overexpression of FBP2 led to a downregulation of the mtDNA / nDNA ratio in HTR-8 / SVneo and BeWo cells ( Figure 6 b). In addition, knockdown of c-MYC reduced the ratio of mtDNA / nDNA in HTR-8 / SVneo and BeWo cells ( Figure 6 c). To further verify the effect of FBP2 on mitochondrial quality and morphological changes, the present invention used IF experiments to perform fluorescence co-localization of mitochondria and the downstream gene TFAM, and found that compared with the control group, the mitochondrial morphology in the HTR-8 / SVneo and BeWo trophoblast cell lines with FBP2 overexpression showed a dot-like fragmentation change, and the mitochondrial staining fluorescence intensity and TFAM immunofluorescence intensity were also significantly downregulated ( Figure 6de). In addition, the present invention also uses a flow analyzer to quantitatively analyze the changes in mitochondrial staining fluorescence intensity in the control group and the FBP2 overexpression group. The results show that overexpression of FBP2 can lead to a decrease in mitochondrial mass ( Figure 6 f). Similarly, the present invention also verifies the changes in mitochondrial morphology caused by the c-MYC gene downstream of FBP2. The results show that the mitochondrial morphology in the trophoblast cell line with c-MYC knockdown is fragmented, and the mitochondrial fluorescence intensity and TFAM protein immunofluorescence intensity are weakened ( Figure 6 gh).

[0058] Secondly, the present invention uses Seahorse XF experiment to verify the effect of FBP2 on mitochondrial oxidative phosphorylation. OCR experiment verifies that FBP2 is involved in regulating mitochondrial oxidative phosphorylation capacity, among which the basal respiration rate, maximum respiration rate, proton leakage and ATP output in HTR-8 / SVneo and BeWo trophoblasts with low expression of FBP2 are significantly higher than those in the control group ( Figure 7 ab), while overexpression of FBP2 significantly downregulated oxidative phosphorylation ( Figure 7 cd). In addition, knockdown of c-MYC significantly inhibited oxidative phosphorylation in trophoblastic cell lines ( Figure 7 ef). In summary, FBP2 and its downstream c-MYC can regulate the changes in mtDNA quantity, affect the changes in mitochondrial morphology and quality, and affect the oxidative phosphorylation of mitochondria in trophoblasts.

[0059] Finally, the present invention used western blotting experiments to verify the regulatory relationship among FBP2, c-MYC and TFAM. After overexpression of FBP2, TFAM was significantly downregulated, while after overexpression of c-MYC on the basis of overexpression of FBP2, TFAM expression increased compared with the previous expression ( Figure 7 gh). Example 5

[0060] Tissue Immunofluorescence (IF) Prepare frozen tissue sections and place them on slides. Fix with 4% paraformaldehyde for 15 min and then use 0.1% Triton X-100 reagent to increase the permeability of tissue cell membranes. According to the immunofluorescence procedure, after blocking with 5% BSA solution for 2 h, wash with PBS three times, add TFAM antibody (1:500, Proteintech), and incubate overnight at 4 °C. The next day, add fluorescently labeled secondary antibodies (1:500, Abcam) in turn, and observe and take pictures under a fluorescent microscope.

[0061] Primary placental trophoblast extraction method Placental tissue specimens of the normal group and patients with early-onset PE were obtained from patients undergoing cesarean section in the obstetrics department of Nanjing Maternal and Child Health Hospital. After the placenta was removed from the body, it was placed on a sterile operating table and cut with sterile scissors and forceps. The maternal surface of the placenta at the site of umbilical cord attachment was selected, and the vascular infarction lesions and fibrous connective tissue were avoided. The placental tissue was repeatedly rinsed with sterile PBS (containing double antibodies), and the tissue was minced as much as possible to remove the visible blood vessels and fibrous tissue; the minced placental tissue was added to a mixture of 0.3% collagenase IV (Biyuntian, China) and 0.2 mg / mL DNAse I (Biyuntian, China), and digested at 120 r / min for 230 min in a shaking incubator at 37 ℃. Serum was then added to terminate the digestion, and the tissue residue was filtered out with a 100-mesh cell sieve to collect the digestion solution; the digestion solution was collected and placed in a precooled 4 ℃ centrifuge, and centrifuged at 1500 r / min×15 min after balancing. After centrifugation, the precipitate was retained and resuspended in 3 mL of DMEM / F-12 culture medium (Gibco, USA).

[0062] Purification and identification of primary placental trophoblast cells Using the discontinuous Percoll density gradient separation method, 4 densities of Percoll separation solutions (Biyuntian, China) (70%, 50%, 30%, 10%) were layered in a 15 mL sterile centrifuge tube in descending order of concentration. 3 mL of each Percoll separation solution was layered, and then 3 mL of cell suspension was slowly added to the upper layer of the Percoll separation solution; the above 15 mL centrifuge tube was placed in a precooled 4 ℃ centrifuge and balanced at 2 000 r / min×20 min. The cloudy cell layer of the specific density Percoll layer (density between 30% and 50%) was carefully aspirated with a 1 mL pipette tip and placed in a sterile 15 ml centrifuge tube, then 4 mL of DMEM medium (Gibco, USA) was added to resuspend, and the cell pellet was retained in a centrifuge at room temperature for 1 000 r / min×5 min; the cell pellet in the centrifuge tube was resuspended with DMEM / F-12 containing 15% fetal bovine serum, and the concentration of the cell suspension was adjusted to 1×10 6 / well, seeded in a 6-well plate pre-installed with a cover glass and ECM glue, and cultured in a cell culture incubator.

[0063] After 24 hours of cell culture, the cell slides in the 6-well plate were removed, washed 3 times with PBS, fixed with 4% paraformaldehyde for 15 minutes, and then 0.1% Triton X-100 reagent was used to increase the permeability of the cell membrane. According to the immunofluorescence procedure, after blocking with 5% BSA solution for 2 hours, PBS was washed 3 times, and human chorionic gonadotropin (β-humanchorionic gonadotrophin, β-HCG) (1:200, Abcam, USA) and human leucocyte antigen-G (human leucocyte antigen-G, HLA-G) monoclonal antibody (1:200, Abcam, USA) were added respectively, and incubated overnight at 4 °C. The next day, fluorescently labeled secondary antibodies (1:500, Abcam, USA) were added in sequence, and the purity was calculated by observation and photography under a fluorescent microscope. After the purity was determined, primary placental trophoblasts were collected for subsequent immunofluorescence and qPCR experiments. The qPCR experiment utilized specific FBP2, c-MYC and TFAM primer pairs, wherein the FBP2 primer sequences were as shown in SEQ ID NO.2 and SEQ ID NO.3; the c-MYC primer sequences were as shown in SEQ ID NO.18 and SEQ ID NO.19; and the TFAM primer sequences were as shown in SEQ ID NO.20 and SEQ ID NO.21.

[0064] result The present invention uses qPCR and western blotting experiments to verify the expression differences of HEY1, FBP2 and TFAM in normal and PE placenta tissues. The results show that the mRNA and protein expression of HEY1 and TFAM in PE placenta tissues are significantly downregulated, while the expression of FBP2 is upregulated ( Figure 8 ab). We also used tissue IF to verify that TFAM was significantly underexpressed in PE placenta ( Figure 8 c).

[0065] Secondly, the present invention extracts and purifies primary trophoblast cells (PTC) from placental tissue. The present invention uses IF experiments (HLA-G and β-HCG antibodies) to identify ( Figure 8 d), and the qPCR experimental results verified that the expression of HEY1, c-MYC and TFAM in the early-onset PE group PTC was significantly downregulated, while the expression of FBP2 was significantly upregulated. In addition, the present invention used MitoTracker Red CMXRos mitochondrial dye, FBP2 and TFAM antibodies to perform fluorescent staining on PTC cells and took pictures using a confocal microscope. The results showed that the fluorescence intensity of mitochondrial staining in the PE group PTC was significantly downregulated, and the fluorescence intensity of FBP2 and TFAM was also significantly downregulated ( Figure 8fg). Example 6

[0066] Animal level observation of L-NAME induced PE rat model - simulated PE-like manifestations and placental damage method Mature female Sprague–Dawley (SD) rats (8 weeks old, weighing 200–250 g) were randomly divided into two groups after thrombus examination: control group (n=10) and L-nitroso-L-arginine methyl ester (L-NAME) modeling group (n=10). They were placed in individual cages and maintained in an air-conditioned room at an ambient temperature of 21±3°C. Pregnant rats in the L-NAME modeling group were given 100 mg / kg / d of L-NAME by intraperitoneal injection every other day from gestational day (GD) 7.5 to gestational day 18.5. The blood pressure fluctuations in the control group and L-NAME modeling group were evaluated using a customer-programmed electronic sphygmomanometer (BP-98A; Softron, Tokyo, Japan). The placental tissues of the rats were collected after termination of pregnancy on gestational day 18.5 for subsequent experiments. This model was used to study the molecular mechanism of FBP2 in vivo. This study was approved by the Animal Care and Use Committee of Nanjing Medical University in accordance with the Guidelines for the Use of Animals of the National Institutes of Health.

[0067] 〈Testing and verification of relevant indicators〉 (1) Observation of the general condition of pregnant mice: observe the general condition of pregnant mice in each group, such as body weight, blood pressure, etc. After 18.5 days of pregnancy, euthanize the experimental mice and obtain placental tissue samples. Dissect the pups and placentas and record the litter size. The fetuses and placentas are sucked dry and weighed.

[0068] (2) Animal blood pressure: The rats in the experimental and control groups were fixed in round cages with their tails fully exposed. The blood pressure of the rats in all groups was measured by the tail cuff method using a programmed electronic sphygmomanometer in a quiet state.

[0069] (3) Western blotting was used to detect the expression levels of HEY1, FBP2 and their downstream gene-related molecules c-MYC and TFAM in the placenta. Western blotting experiments were performed using HEY1 antibody (dilution ratio: 1:000, Proteintech, China), FBP2 antibody (dilution ratio: 1:000, Proteintech, China), c-MYC antibody (dilution ratio: 1:000, Proteintech, China) and TFAM antibody (dilution ratio: 1:000, Proteintech, China).

[0070] result The present invention constructs a control pregnant mouse group and an L-NAME-induced PE pregnant mouse group model ( Fig. 9 a), During the gestation period of rats (), we recorded the fluctuation of blood pressure (systolic and diastolic) of the two groups of pregnant rats. The results showed that compared with the control group, the blood pressure of pregnant rats in the L-NAME group showed a gradual increase after GD 7.5 days ( Fig. 9 b). The pregnancy of the pregnant mice was terminated on GD 18.5, and the weight of the fetuses and placentas of the control group and L-NAME-induced PE group were collected and weighed. The results showed that the weight of the fetuses and placentas of the L-NAME-induced PE rats were significantly smaller than those of the control group ( Fig. 9 c).

[0071] The present invention further uses western blotting experiments to verify that the expression of HEY1, c-MYC and TFAM in the rat placenta induced by L-NAME is reduced, while the expression of FBP2 is upregulated. These results indicate that the HEY1-FBP2 / c-MYC-TFAM regulatory axis is involved in the occurrence and progression of PE ( Fig. 9 d).

[0072] It should be noted that the above content only illustrates the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications all fall within the protection scope of the claims of the present invention.

Claims

1. Use of a reagent for detecting FBP2 in preparing a PE diagnostic kit, characterized in that: The sequence of FBP2 is shown as SEQ ID NO.

1.

2. Use of the reagent for detecting FBP2 according to claim 1 in preparing a PE diagnostic kit, characterized in that: The reagent for detecting FBP2 includes a primer pair for specifically detecting the expression of FBP2.

3. Use of the reagent for detecting FBP2 according to claim 2 in preparing a PE diagnostic kit, characterized in that: The upstream primer sequence of the primer pair is shown as SEQ ID NO.2, and the downstream primer sequence of the primer pair is shown as SEQ ID NO.

3.

4. The use of a FBP2 low expression reagent in the preparation of a drug for treating PE, characterized in that: The sequence of the FBP2 is shown in SEQ ID NO.

1.

5. Use of the FBP2 low expression reagent according to claim 4 in the preparation of a drug for treating PE, characterized in that: The low expression reagents include FBP2 siRNA-1#, FBP2 siRNA-2#, and FBP2 siRNA-3#; the sequence of the FBP2 siRNA-1# is shown in SEQ ID NO.4 and SEQ ID NO.5; the sequence of the FBP2 siRNA-2# is shown in SEQ ID NO.6 and SEQ ID NO.7; the sequence of the FBP2 siRNA-3# is shown in SEQ ID NO.8 and SEQ ID NO.

9.

6. Application of FBP2 low expression reagent in promoting the migration and invasion ability of trophoblast cells, characterized in that: The sequence of the FBP2 is shown in SEQ ID NO.

1.

7. Use of the FBP2 low expression reagent according to claim 7 in promoting the migration and invasion ability of trophoblast cells, characterized in that: The low expression reagents include FBP2 siRNA-1#, FBP2 siRNA-2#, and FBP2 siRNA-3#; the sequence of the FBP2 siRNA-1# is shown in SEQ ID NO.4 and SEQ ID NO.5; the sequence of the FBP2 siRNA-2# is shown in SEQ ID NO.6 and SEQ ID NO.7; the sequence of the FBP2 siRNA-3# is shown in SEQ ID NO.8 and SEQ ID NO.

9.

8. A kit for diagnosing PE disease, characterized in that: The kit comprises the primer pair according to claim 2 or 3.

9. A drug for treating PE, characterized in that: The drug includes a FBP2 low expression agent, and the sequence of the FBP2 is shown as SEQ ID NO.1.

Images