Recombinant plasmid for vaccine preparation, preparation method thereof and DNA-started attenuated live hand-foot-and-mouth disease vaccine

Abstract

The invention relates to the technical field of biology, and discloses a recombinant plasmid for vaccine preparation, a preparation method of the recombinant plasmid and an attenuated live hand-foot-and-mouth disease vaccine started by DNA (Deoxyribose Nucleic Acid). The recombinant plasmid provided by the invention comprises an expression vector, an insertion element and a virus genome sequence, the expression vector is selected from a eukaryotic expression vector; the insertion element is selected from a eukaryotic promoter and an optional element capable of improving the expression of the recombinant plasmid; the virus genome sequence is selected from an enterovirus 71 type genome sequence. The recombinant plasmid has the characteristics of high genetic stability, high safety, low requirements on transportation and preservation conditions and the like, experiments prove that the recombinant plasmid can rescue in RD cells and normally start transcription and express virus proteins, shows good safety and immune protection effects in animal experiments, and has the potential of preparing DNA-started attenuated live hand-foot-and-mouth disease vaccines.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a recombinant plasmid for vaccine preparation and a preparation method thereof, and a DNA-activated attenuated live hand, foot and mouth disease vaccine. Background Art

[0002] The clinical manifestations of hand, foot and mouth disease (HFMD) mainly include fever, rash on the hands, feet, mouth, herpes, herpetic pharyngitis, etc., and sometimes serious neurological complications such as aseptic meningitis, brainstem encephalitis, neurogenic pulmonary edema, acute flaccid paralysis and myocarditis. The disease is more common in children under 5 years old, posing a great threat to the health of young children. In the Western Pacific region, hand, foot and mouth disease has become one of the main causes of death in children under 5 years old.

[0003] Hand, foot and mouth disease is a self-limiting disease caused by human enterovirus infection. The main pathogens include echovirus, coxsackievirus A group (types 4, 5, 9, 10 and 16, namely CA4, CA5, CA9, CA10 and CA16), coxsackievirus B group (types 2 and 5, namely CB2, CB5) and enterovirus 71 (EV71), among which EV17 and CA16 are the most common. Therefore, developing vaccines against the above viruses, especially EV71 and CA16, can effectively control the occurrence of hand, foot and mouth disease.

[0004] However, the existing hand, foot and mouth disease vaccines are mainly inactivated vaccines, which have high requirements for production, storage and transportation. In addition, researchers have also found that the immune response induced by the existing hand, foot and mouth disease vaccines lasts for a short time, requiring multiple vaccinations, which increases the cost of vaccination and reduces the compliance of the vaccinated population, which is not conducive to promotion and application. Summary of the invention

[0005] The purpose of the present invention is to overcome the problems that the immune response induced by the existing hand, foot and mouth disease vaccine is short in duration, multiple vaccinations are required, and the production, storage and transportation requirements are high, and a recombinant plasmid preparation method and a DNA-activated attenuated live vaccine for vaccine preparation are provided. The recombinant plasmid provided by the present invention is a candidate for a DNA-activated attenuated live vaccine, and a single injection of immunization can effectively induce high levels of IgG and neutralizing antibodies against enterovirus 71, and provide complete protection against viral infection, and has the advantages of simple preparation method, easy large-scale production, no need for cold chain transportation, and high safety.

[0006] In order to achieve the above object, the present invention provides a recombinant plasmid for vaccine preparation, wherein the recombinant plasmid comprises an expression vector, an insertion element and a viral genome sequence;

[0007] Wherein, the expression vector is selected from a eukaryotic expression vector;

[0008] The insertion element is selected from a eukaryotic promoter and an optional element capable of increasing the expression of the recombinant plasmid;

[0009] The viral genome sequence is selected from the enterovirus 71 genome sequence.

[0010] A second aspect of the present invention provides a method for preparing a recombinant plasmid, the method comprising inserting an insertion element and a viral genome sequence into an expression vector;

[0011] Wherein, the expression vector is selected from a eukaryotic expression vector;

[0012] The insertion element is selected from a eukaryotic promoter and an optional element capable of increasing the expression of the recombinant plasmid;

[0013] The viral genome sequence is selected from the enterovirus 71 genome sequence.

[0014] The third aspect of the present invention provides a recombinant plasmid prepared by the method as described above.

[0015] The fourth aspect of the present invention provides a DNA-activated live attenuated hand, foot and mouth disease vaccine, which contains the recombinant plasmid as described above.

[0016] Through the above technical scheme, the recombinant plasmid preparation method provided by the present invention is simple, has high genetic stability and safety, and has low requirements for transportation and storage conditions. It has been experimentally confirmed that the recombinant plasmid provided by the present invention can rescue and normally initiate transcription in cells commonly used in vaccine development (such as RD cells, etc.), express viral proteins, and effectively activate the host's immune protection against enterovirus 71, and has the potential to be used for the preparation of DNA-activated attenuated live hand, foot and mouth disease vaccines, filling the gap of the current lack of DNA attenuated live vaccines for hand, foot and mouth disease pathogens such as enterovirus 71. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of the construction of recombinant plasmid I in Example 1.

[0018] Figure 2 It is a schematic diagram of the construction of the recombinant plasmid II in Example 1.

[0019] Figure 3 The results of indirect immunofluorescence experiments of RD cells transfected with recombinant plasmids I and II in Example 2 are shown.

[0020] Figure 4 These are the results of the proliferation characteristics of the recombinant plasmids I and II in Example 2 in RD cells.

[0021] Figure 5 The morphology of viral plaques obtained by rescuing recombinant plasmids I and II in RD cells in Example 2 is shown.

[0022] Figure 6 This is a schematic diagram of the process of immunizing mice with recombinant plasmids I and II in Example 3.

[0023] Figure 7 The viral load results in the serum of mice immunized with recombinant plasmids I and II in Example 3.

[0024] Figure 8 The results of body weight changes after mice were immunized with recombinant plasmids I and II in Example 3.

[0025] Fig. 9 This is the result of an indirect immunofluorescence experiment on RD cells infected with the supernatant of muscle ground from the inoculated site after mice were immunized with the recombinant plasmid I in Example 4.

[0026] Fig.10 The viral plaque morphology was obtained after the recombinant plasmid I in Example 4 was used to immunize mice and the supernatant from the muscles of the inoculated site was ground and infected with RD cells.

[0027] Fig.11 This is a schematic diagram of the process of immunizing mice with the recombinant plasmid I in Example 5.

[0028] Fig.12 It is the IgG antibody level in the serum of mice immunized with the recombinant plasmid I in Example 5.

[0029] Fig.13 The neutralizing antibody titer of the serum of mice immunized with the recombinant plasmid I in Example 5.

[0030] Fig.14 These are the results of the immune protection evaluation of suckling mice immunized with the recombinant plasmid I in Example 5. DETAILED DESCRIPTION

[0031] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0032] The inventors of the present invention cleverly discovered during the research process that by inserting the viral genome sequence (mainly in the form of cDNA) and specific insertion elements into an expression vector in a certain order, a recombinant plasmid that initiates transcription in vivo and produces (attenuated) live viruses can be obtained. The recombinant plasmid can be used to initiate the development of attenuated live vaccines in vivo using DNA immunization.

[0033] The first aspect of the present invention provides a recombinant plasmid for vaccine preparation, the recombinant plasmid comprising an expression vector, an insertion element and a viral genome sequence;

[0034] Wherein, the expression vector is selected from a eukaryotic expression vector;

[0035] The insertion element is selected from a eukaryotic promoter and an optional element capable of increasing the expression of the recombinant plasmid;

[0036] The viral genome sequence is selected from the enterovirus 71 (EV71) genome sequence.

[0037] The DNA-initiated live attenuated virus vaccine prepared using the above-mentioned recombinant plasmid produces live attenuated virus in vivo by inoculating the recombinant plasmid carrying the (full-length) EV71 genome, which can effectively induce high levels of protective antibodies against EV71, thereby providing effective protection against the virus infection and preventing the occurrence of hand, foot and mouth disease.

[0038] In the present invention, the eukaryotic expression vector can be any eukaryotic expression vector that can be used for preparing recombinant plasmids in the art. It can be a eukaryotic expression vector prepared by itself according to the prior art, or a commercially available related product. According to a preferred embodiment of the present invention, the expression vector is selected from pBR322 and / or pVax1.

[0039] In the present invention, the eukaryotic promoter can be any existing eukaryotic promoter in the art. It can be prepared by itself according to the prior art, or it can be a commercially available related product. According to a preferred embodiment of the present invention, the eukaryotic promoter is selected from at least one of SV40 and CMV.

[0040] In the present invention, the recombinant plasmid contains an element capable of improving the expression of the recombinant plasmid. Any element in the art having the above-mentioned function and capable of being used for the preparation of a recombinant plasmid can be used in the recombinant plasmid provided by the present invention. For example, an enhancer, a poly A tail, etc. In order to further improve the expression and stability of the recombinant plasmid provided by the present invention, according to a preferred embodiment of the present invention, the element capable of improving the expression of the recombinant plasmid is selected from at least one of HDVr, SV40 polyA tail and BGH polyA tail.

[0041] Any existing enterovirus 71 strain genome sequence (cDNA) can be used in the recombinant plasmid provided by the present invention. According to a preferred embodiment of the present invention, the enterovirus 71 genome sequence is derived from the enterovirus 71 strain AH / 08 / 06.

[0042] Preferably, the enterovirus 71 genome sequence is derived from the full-length cDNA clone of the enterovirus 71 AH / 08 / 06 strain.

[0043] According to a preferred embodiment of the present invention, the enterovirus type 71 genome sequence is shown as SEQ ID NO: 1.

[0044] According to a preferred embodiment of the present invention, the sequence of the eukaryotic promoter SV40 is shown as SEQ ID NO:2.

[0045] According to a preferred embodiment of the present invention, the sequence of the eukaryotic promoter CMV is shown as SEQ ID NO:3.

[0046] According to a preferred embodiment of the present invention, the sequence of HDVr is shown as SEQ ID NO:4.

[0047] According to a preferred embodiment of the present invention, the SV40 polyA tail is a sequence containing 120-250 nucleotides.

[0048] Preferably, the sequence of the SV40 polyA tail is as shown in SEQ ID NO:5.

[0049] According to a preferred embodiment of the present invention, the BGH polyA tail is a sequence containing 200-250 nucleotides.

[0050] Preferably, the sequence of the BGH polyA tail is as shown in SEQ ID NO:6.

[0051] According to a preferred embodiment of the present invention, Figure 1 As shown, in the direction from 5' to 3', in the recombinant plasmid, the eukaryotic promoter (SV40 or CMV) is located at the front end of the viral genome sequence, and the element capable of improving the expression of the recombinant plasmid is located at the rear end of the chimeric viral genome sequence.

[0052] Preferably, in the recombinant plasmid, from the 5' end to the 3' end, when the elements capable of improving the expression of the recombinant plasmid are HDVr and SV40 polyA tail and / or BGH polyA tail, the SV40 polyA tail and / or BGH polyA tail are located at the rear end of HDVr.

[0053] In the recombinant plasmid provided by the present invention, the chimeric viral genome sequence as described above and the insertion element as described above are inserted into the expression vector by serial connection. The "serial connection" means that the polynucleotide elements (or polypeptides) are connected in a functional manner, and the elements (or polypeptides) do not interfere with each other's expression or performance, and the connected polynucleotide (or polypeptide) sequences can be continuous or discontinuous.

[0054] In the present invention, inserting an insertion element with a preferred sequence at a specific position can achieve the effect of obtaining a better expression amount and expression stability of the obtained recombinant plasmid.

[0055] A second aspect of the present invention provides a method for preparing a recombinant plasmid, the method comprising inserting an insertion element and a viral genome sequence into an expression vector;

[0056] Wherein, the expression vector is selected from a eukaryotic expression vector;

[0057] The insertion element is selected from a eukaryotic promoter and an optional element capable of increasing the expression of the recombinant plasmid;

[0058] The viral genome sequence is selected from the enterovirus 71 genome sequence.

[0059] Preferably, the enterovirus type 71 genome sequence is shown as SEQ ID NO: 1.

[0060] In the present invention, the eukaryotic expression vector can be any eukaryotic expression vector that can be used for preparing recombinant plasmids in the art. It can be a eukaryotic expression vector prepared by itself according to the prior art, or a commercially available related product. According to a preferred embodiment of the present invention, the expression vector is selected from pBR322 and / or pVax1.

[0061] In the present invention, the eukaryotic promoter can be any existing eukaryotic promoter in the art. It can be prepared by itself according to the prior art, or it can be a commercially available related product. According to a preferred embodiment of the present invention, the eukaryotic promoter is selected from SV40 and / or CMV.

[0062] Preferably, the sequence of the eukaryotic promoter SV40 is shown in SEQ ID NO:2.

[0063] Preferably, the sequence of the eukaryotic promoter CMV is shown in SEQ ID NO:3.

[0064] In the present invention, the recombinant plasmid contains an element capable of improving the expression of the recombinant plasmid. Any element in the art having the above-mentioned function and capable of being used for the preparation of a recombinant plasmid can be used in the recombinant plasmid provided by the present invention. For example, an enhancer, a poly A tail, etc. In order to further improve the expression and stability of the recombinant plasmid provided by the present invention, according to a preferred embodiment of the present invention, the element capable of improving the expression of the recombinant plasmid is selected from at least one of HDVr, SV40 polyA tail and BGH polyA tail.

[0065] Preferably, the sequence of the HDVr is as shown in SEQ ID NO:4.

[0066] Preferably, the SV40 polyA tail is a sequence containing 120-250 nucleotides.

[0067] Preferably, the BGH polyA tail is a sequence containing 200-250 nucleotides.

[0068] More preferably, the sequence of the SV40 polyA tail is as shown in SEQ ID NO:5.

[0069] More preferably, the sequence of the BGH polyA tail is as shown in SEQ ID NO:6.

[0070] According to a preferred embodiment of the present invention, the method of inserting the insertion element and the viral genome sequence into the expression vector includes: after enzyme digestion of the expression vector, the insertion element and the viral genome sequence are connected to the expression vector after enzyme digestion by a ligase.

[0071] Preferably, in the recombinant plasmid, the eukaryotic promoter is inserted at the front end of the chimeric viral genome sequence, and the element capable of improving the expression of the recombinant plasmid is inserted at the back end of the chimeric viral genome sequence in the direction from the 5' end to the 3' end.

[0072] More preferably, in the recombinant plasmid, from the 5' end to the 3' end, when the elements capable of improving the expression of the recombinant plasmid are HDVr and SV40 polyA tail and / or BGH polyA tail, the SV40 polyA tail and / or BGH polyA tail are located at the rear end of HDVr.

[0073] The third aspect of the present invention provides a recombinant plasmid prepared according to the method described above.

[0074] The fourth aspect of the present invention provides a DNA-activated live attenuated hand, foot and mouth disease vaccine, which contains the recombinant plasmid described in the preceding item.

[0075] According to a preferred embodiment of the present invention, the vaccine further contains a pharmaceutically acceptable excipient. Alternatively, the vaccine only contains the aforementioned recombinant plasmid as an active component.

[0076] Preferably, the auxiliary material comprises at least one of a buffer, an excipient, a stabilizer and a preservative. The auxiliary material can be selected from any commonly used types in the art, for example, the buffer can be a sodium citrate buffer, a phosphate buffered saline (PBS), a Dulbecco's phosphate buffered saline (DPBS) and other commonly used buffers in the art.

[0077] The present invention will be described in detail below by way of examples. It should be understood that the following examples are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.

[0078] In the following examples, unless otherwise specified, the sequences of vectors, templates, synthetic fragments, primers, etc. used were all commissioned to be synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0079] Example 1

[0080] This example is used to illustrate the construction of the DNA-initiated EV71 virus recombinant plasmid provided by the present invention.

[0081] Recombinant plasmid I: DNA-promoted pDL-EV71-CMV recombinant plasmid selected the eukaryotic expression vector pVax1 (purchased from Thermo Fisher), inserted the eukaryotic promoter CMV (SEQ ID NO: 3) before the viral genome sequence of the full-length infectious cDNA clone of EV71 virus, and inserted HDVr (SEQ ID NO: 4) and BGHpA (i.e., BGH poly A tail, SEQ ID NO: 6) after the viral genome. See the construction schematic for details. Figure 1 .

[0082] Recombinant plasmid II: DNA-promoted pDL-EV71-SV40 recombinant plasmid selected the eukaryotic expression vector pVax1, inserted the eukaryotic promoter SV40 (SEQ ID NO: 2) before the viral genome sequence of the full-length infectious cDNA clone of EV71 virus, and inserted HDVr (SEQ ID NO: 4) and SV40 pA (i.e., SV40 poly A tail, SEQ ID NO: 5) after the viral genome. See the construction schematic for details. Figure 2 .

[0083] The viral genome sequence of the full-length infectious cDNA clone of the EV71 virus used in the above-mentioned recombinant plasmid is a cDNA sequence corresponding to the recovered viral RNA rescued by the reverse genetics system based on the EV71 virus AH / 08 / 06 strain (Genbank accession number: HQ611148.1), and the specific sequence is shown in SEQ ID NO: 1. Among them, from the 5' end, the nucleotides 1-742 are 5'UTR (untranslated region), the nucleotides 743-949 are the coding gene of the capsid protein VP4, the nucleotides 950-1711 are the coding gene of the capsid protein VP2, the nucleotides 1712-2437 are the coding gene of the capsid protein VP3, the nucleotides 2438-3328 are the coding gene of the capsid protein VP1, the nucleotides 3329-3778 are the coding gene of the non-structural protein 2A, and the nucleotides 3779-4075 are the coding gene of the non-structural protein The nucleotides 4076-5062 are the coding genes of nonstructural protein 2C, the nucleotides 5063-5320 are the coding genes of nonstructural protein 3A, the nucleotides 5321-5386 are the coding genes of nonstructural protein 3B, the nucleotides 5387-5935 are the coding genes of nonstructural protein 3C, the nucleotides 5936-7321 are the coding genes of nonstructural protein 3D, and the nucleotides 7322-7430 are 3'UTR. The EV71 virus AH / 08 / 06 strain was isolated from throat swab specimens collected by the Virus Laboratory of Microbiology and Epidemiology of the Beijing Academy of Military Medical Sciences in 2008 in the hand, foot and mouth disease epidemic area of ​​Anhui Province. Informed consent has been obtained from the relevant personnel for the relevant research.

[0084] The preparation of recombinant plasmid I and recombinant plasmid II was entrusted to Suzhou Advaccine Biopharmaceutical Co., Ltd.

[0085] Example 2

[0086] This example is used to illustrate the rescue and identification of the recombinant plasmids I and II obtained in Example 1.

[0087] Using Lipofectamine TM The recombinant plasmids I and II obtained in Example 1 were transfected into RD cells (purchased from ATCC) using the 3000 kit (purchased from Invitrogen).

[0088] Specific transfection method:

[0089] 1. Inoculate RD cells into a 24-well plate with a cover slip in advance and incubate at 37°C and 5% CO. 2 Under the same conditions, the cells were cultured overnight until the cell density reached about 80%.

[0090] 2. Add 1 μL Lipofectamine TM 3000 Reagent and 25 μL Opti-MEM TM The culture medium was gently mixed and allowed to stand at room temperature for 10 min before being mixed with 0.5 μg of recombinant plasmid and 1 μL of P3000. TM Reagent and 25 μL Opti-MEM TM The culture medium was gently mixed and allowed to stand at room temperature for 5 min.

[0091] 3. Add the mixture to one well of a 24-well plate and add 150 μL of Opti-MEM TM Culture medium, placed at 37°C, 5% CO 2 Remove the supernatant and add 1 mL of PBS buffer (10 mM K 2 HPO 4 , 2 mM KH 2 PO 4 , 135mMNaCl, 2.7mM KCl, pH7.4) were fully washed twice, and then 0.5mL of DMEM medium containing 2% FBS was added. The cell culture supernatant was collected at 24h, 48h and 72h after transfection, and stored at -80℃ for later use. The cells were fully washed twice with 1mL of PBS solution at 24h, 48h and 72h after transfection and dried, and 500μL of PBS buffer was added to each well and stored in a 4℃ refrigerator, which was the antigen piece.

[0092] (I) Detection of recombinant plasmid expression level

[0093] The EV71 virus VP1 protein in the transfected cells was detected by indirect immunofluorescence using EV71 virus monoclonal antibody (purchased from Fitzgerald) to determine the expression level of the recombinant plasmid.

[0094] Specific method: EV71 virus monoclonal antibody was diluted with PBS buffer at a volume ratio of 1:1000, and then incubated with the antigen piece prepared by the above method at 37°C for 2h. After incubation, it was washed with PBS buffer for 3 times, each time at 500rpm for 5min. AlexaFluor 488-labeled goat anti-mouse IgG antibody (purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.) diluted with PBS buffer at a volume ratio of 1:200 was added to the washed antigen piece, incubated at 37°C for 1h, and then the antigen piece was placed in PBS buffer and washed for 3 times, each time at 500rpm for 5min. DAPI was diluted to a final concentration of 100ng / mL, incubated with the antigen piece at room temperature for 4±1min, then discarded, washed with PBS buffer at 500rpm for 5min, and the results were observed under a fluorescence microscope. Cells not transfected with viral recombinant plasmids were used as negative controls.

[0095] The results are shown in Figure 3 As can be seen from the figure, the recombinant plasmids I and II obtained in Example 1 can initiate transcription normally after transfection into RD cells, and express EV71 virus VP1 protein, and its expression level increases with the extension of transfection time. After further experiments, it was found that at the same transfection time, when the initial transfection virus concentration increased, the expression level of EV71 virus VP1 protein also increased.

[0096] (II) Detection of recombinant plasmid transcription level

[0097] The cell culture supernatant was collected 24h, 48h and 72h after transfection and diluted in a gradient manner (10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 and 10 -7 Each dilution was inoculated at 400 μL / well on a monolayer of RD cells in a 12-well plate and then incubated at 37°C and 5% CO 2 The culture supernatant was discarded, and an agar cap (i.e., DMEM medium containing 2 wt% FBS and 1 wt% agar) was added to each well, and the culture was continued at 37°C and 5% CO. 2 The cells were cultured under the same conditions for 3-4 days and then fixed with 4% formaldehyde at room temperature for 1 hour. The agar cover was discarded and the cells were stained with crystal violet at room temperature for 10 minutes. The plaque morphology was observed and the plaque forming units (PFU) were calculated. The virus titer at each time point was measured and the growth curve was drawn.

[0098] The growth curve results are shown in Figure 4 For details on plaque morphology, see Figure 5 .from Figure 4 It can be seen that the replication (proliferation) ability of recombinant plasmid I in RD cells is slightly stronger than that of recombinant plasmid II. In RD cells, both recombinant plasmid I and recombinant plasmid II reached the peak of replication 72 hours after infection. The results show that the DNA-initiated EV71 virus recombinant plasmids I and II can normally initiate transcription and effectively replicate in RD cells, but the replication ability of these two recombinant plasmids using different promoters is slightly different. Figure 5 It can be seen that the EV71 virus plaques rescued by recombinant plasmid I and recombinant plasmid II in RD cells have similar morphology.

[0099] Example 3

[0100] This example is used to illustrate the safety of the recombinant plasmid provided by the present invention.

[0101] Recombinant plasmid I and recombinant plasmid II obtained in Example 1 were used to immunize 5-week-old A129 mice at a dose of 2 μg / mouse (see Xiao-Feng Li et al. Nature Communication, 2018), and the tibialis anterior muscle of the mice was injected intramuscularly and electrically stimulated. Five mice were immunized with each recombinant plasmid, and blood was collected by cutting the tails on days 2, 4, 6, 8, and 10 after immunization, and serum was collected to detect the viral load in the mouse serum; the weight of the mice was tested every day from day 0 to day 14 after immunization to observe the changes in the weight of the mice.

[0102] The schematic diagram of the above-mentioned recombinant plasmids I and II for immunizing mice and related detection is shown in Figure 6 The results of serum viral load of mice after immunization are shown in Figure 7 The results of the weight changes of mice after immunization are shown in Figure 8 .

[0103] from Figure 7 As can be seen from the figure, after immunizing 129 mice with 2 μg of recombinant plasmid I and recombinant plasmid II, no viral nucleic acid was detected in the serum; Figure 8 It can be seen that after immunizing 129 mice with 2 μg of recombinant plasmid I and recombinant plasmid II, there was no significant change in body weight. It can be seen that the recombinant plasmid provided by the present invention has high safety.

[0104] Example 4

[0105] This example is used to evaluate the in vivo expression efficiency of the DNA-promoting recombinant plasmid provided by the present invention.

[0106] 1. According to the method in Example 3, the recombinant plasmid I obtained in Example 1 was used to immunize 5-week-old A129 mice at a dose of 10 μg / mouse, and the tibialis anterior muscle of the mice was injected intramuscularly and electrically stimulated. On the second day after immunization, the injected muscle was taken, 1 mL of high-glucose DMEM medium containing 2% FBS was added for grinding, and the supernatant was taken after centrifugation.

[0107] 2. Inoculate the supernatant obtained in step 1 into a monolayer of RD cells in a 24-well plate at a volume of 100 μL / well at 37°C and 5% CO. 2 Incubate for 1 h under the same conditions, discard the culture supernatant, wash the cells twice with 1 mL of PBS buffer per well, and add 500 μL of Opti-MEM TM Culture medium, 37°C, 5% CO 2 The cell culture supernatant was collected at 24h, 48h and 72h after infection and stored at -80℃ for later use.

[0108] 3. Place the cells at 24h, 48h and 72h after infection in a fixative (a mixed solution of acetone and methanol in a volume ratio of 3:7) at room temperature for 30min, wash the cells twice with 1mL / well PBS solution and dry them, add 500μL PBS solution to each well, and store them in a refrigerator at 4℃ to obtain antigen slices. EV71 virus VP1 protein in infected cells was detected by indirect immunofluorescence using EV71 virus monoclonal antibody (purchased from Fitzgerald Company). The specific method is the same as experiment (I) in Example 2.

[0109] The results of indirect immunofluorescence are detailed in Fig. 9 As can be seen from the figure, after 5-week-old A129 mice were immunized with recombinant plasmid I and the supernatant of the muscle grinded from the inoculation site was used to infect RD cells, the expression of EV71 virus VP1 protein was observed in RD cells, and its expression level increased with the extension of infection time.

[0110] 4. Detect the virus titer in the culture supernatant collected in step 2 48 hours after infection (the method is the same as that of experiment (II) in Example 2, using RD cells for plaque assay). The results are detailed in Fig.10 As can be seen from the figure, after 5-week-old A129 mice were immunized with recombinant plasmid I and the supernatant of the muscle ground from the inoculation site was used to infect RD cells, obvious plaques were formed, indicating that after A129 mice were inoculated with recombinant plasmid I, live virus particles could be isolated from the mouse muscle tissue.

[0111] The same method was used to test the in vivo expression of recombinant plasmid II, and similar results were obtained as those of recombinant plasmid I.

[0112] Example 5

[0113] This example is used to illustrate the immunogenicity and immune protection effect of the recombinant plasmid provided by the present invention.

[0114] according to Fig.11 The experimental process in the experiment was to immunize 5-week-old BALB / c female mice with recombinant plasmid I at a dose of 2μg / mouse and 10μg / mouse, and then inject the mouse tibialis anterior muscle intramuscularly and give electrical stimulation. 5-6 mice were immunized with each dose, and the tails were cut to collect blood on the 14th and 28th days after immunization, and the serum was collected to detect IgG antibodies and neutralizing antibodies in the mouse serum; on the 30th day after immunization, the immunized BALB / c female mice were mated with non-immunized BALB / c male mice, and the suckling mice were born on the 21st day after pregnancy. One-day-old suckling mice were taken for the challenge experiment. The specific detection methods during the experiment are as follows:

[0115] 1. Cut the tails of BALB / c female mice inoculated with recombinant plasmid I and collect blood on the 14th and 28th days after immunization. Collect serum, let it stand at room temperature for 3 hours, then centrifuge to collect serum, inactivate at 56℃ for 30 minutes, and freeze at -20℃ for use.

[0116] The collected mouse sera were tested as follows:

[0117] (A) Detect the total IgG titer of immune serum against EV71 virus using ELISA.

[0118] Specific method: Coat 96-well plates with heat-inactivated EV71 virus at 4°C overnight. Shake dry the plates and wash once with 300 μL / well PBST (purchased from Beijing Jinpulai Biotechnology Co., Ltd.). Add 2% BSA blocking solution for blocking, 200 μL / well, incubate at 37°C for 1 hour. Dilute the immune serum 2-fold (1:100-1:6400), add the diluted immune serum or PBS to the 96-well enzyme-linked plate, 100 μL / well, use PBS as the negative control, and incubate at 37°C for 2 hours. Wash the plate 5 times with 300 μL / well PBST. Finally, add 100 μL / well HRP-labeled goat anti-mouse IgG antibody (purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., 1:10000 dilution), incubate at 37°C for 30 minutes. Repeat the plate washing 5 times with 300 μL / well PBST. Add 100 μL / well of TMB colorimetric solution, incubate at 37°C in the dark for 15 min, and add stop solution (5% H 2 SO 4 ), 100 μL / well, measure OD within 5 min 450 value.

[0119] The results of IgG antibody detection in the serum of mice 14 and 28 days after immunization are shown in Fig.12 When the OD of serum from EV71 virus immune group 450Value / OD of immune serum in PBS group 450 The value was considered positive when it was ≥2.1. The results showed that the recombinant plasmid 1 at a dose of 2 μg / mouse and 10 μg / mouse could effectively induce the production of IgG antibodies against EV71 in 5-week-old BALB / c female mice 14 and 28 days after immunization.

[0120] (II) Plaque reduction neutralization test (PRNT) was used to measure the neutralizing antibody titer in mouse serum. 50 ).

[0121] Specific method: serum was prepared into dilutions of 1:20, 1:40, 1:80, 1:160 and 1:320 times using DMEM medium containing 2% FBS; the dilutions were mixed with HEV71 virus strain (purchased from ATCC) in equal volumes (the mixed solution contained about 100 PFU of HEV71 virus), incubated at 37°C for 1.5 hours, and then the virus titer in the supernatant was detected (the method was the same as that of experiment (II) in Example 2, using RD cells for plaque assay), and the 50% neutralizing antibody titer was calculated according to the Karber method. That is, the neutralizing antibody titer of the immune mouse serum against the HEV71 virus strain.

[0122] Results Fig.13 As can be seen from the figure, the recombinant plasmid I was used to immunize 5-week-old BALB / c female mice, and it could effectively induce the mice to produce neutralizing antibodies against EV71 14 and 28 days after immunization.

[0123] 2. One-day-old suckling mice born after mating with immunized BALB / c female mice were used for the challenge experiment. One-day-old suckling mice were inoculated with a lethal dose of HEV71 virus strain (purchased from ATCC) by intracranial injection, 20 μL (containing 10 7 PFU of HEV71 virus) and the survival of suckling mice was observed within 14 days after inoculation. Fig.14 The results show that immunization of BALB / c female mice with recombinant plasmid I at a dose of 2 μg / mouse can partially protect suckling mice from attack by a lethal dose of EV71 virus, and immunization of BALB / c female mice with recombinant plasmid I at a dose of 10 μg / mouse can 100% protect suckling mice from attack by a lethal dose of EV71 virus.

[0124] The immunogenicity and immune protection effect of recombinant plasmid II were tested using the same method, and similar results were obtained as those of recombinant plasmid I.

[0125] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

[0126] Sequence Listing

[0127] SEQ ID NO: 1—Enterovirus 71 genomic sequence (cDNA)

[0128]

[0129] SEQ ID NO: 2 - Eukaryotic promoter SV40

[0130] TGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTC

[0131] SEQ ID NO: 3 - Eukaryotic promoter CMV

[0132] GTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTC

[0133] SEQ ID NO: 4 - HDVr

[0134] GGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCTGGGCTACTTCGGTAGGCTAAGGGAGAAG

[0135] SEQ ID NO: 5 - SV40 polyA tail

[0136] AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTG

[0137] SEQ ID NO: 6 - BGH polyA tail

[0138] CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG。

Claims

1. A recombinant plasmid for vaccine preparation, characterized in that: The recombinant plasmid includes an expression vector, an insertion element and a viral genome sequence; Wherein, the expression vector is selected from a eukaryotic expression vector; The insertion element is selected from a eukaryotic promoter and an optional element capable of increasing the expression of the recombinant plasmid; The viral genome sequence is selected from the enterovirus 71 genome sequence.

2. The recombinant plasmid according to claim 1, wherein The eukaryotic expression vector is selected from pBR322 and / or pVax1; And / or, the eukaryotic promoter is selected from SV40 and / or CMV; And / or, the element capable of improving the expression of the recombinant plasmid is selected from at least one of HDVr, SV40 polyA tail and BGH polyA tail; And / or, the enterovirus 71 genome sequence is derived from the enterovirus 71 strain AH / 08 / 06.

3. The recombinant plasmid according to claim 1 or 2, wherein The enterovirus 71 genome sequence is shown in SEQ ID NO: 1; and / or, the sequence of the eukaryotic promoter SV40 is shown in SEQ ID NO: 2; And / or, the sequence of the eukaryotic promoter CMV is shown in SEQ ID NO: 3; and / or, the sequence of the HDVr is shown in SEQ ID NO: 4; and / or, the SV40 polyA tail is a sequence containing 120-250 nucleotides; and / or, the BGH polyA tail is a sequence containing 200-250 nucleotides; Preferably, the sequence of the SV40 polyA tail is as shown in SEQ ID NO: 5; Preferably, the sequence of the BGH polyA tail is as shown in SEQ ID NO:

6.

4. The recombinant plasmid according to any one of claims 1 to 3, wherein According to the direction from the 5' end to the 3' end, in the recombinant plasmid, the eukaryotic promoter is located at the front end of the viral genome sequence, and the element capable of improving the expression of the recombinant plasmid is located at the rear end of the chimeric viral genome sequence; Preferably, in the recombinant plasmid, from the 5' end to the 3' end, when the elements capable of improving the expression of the recombinant plasmid are HDVr and SV40 polyA tail and / or BGH polyA tail, the SV40 polyA tail and / or BGH polyA tail are located at the rear end of HDVr.

5. A method for preparing a recombinant plasmid, characterized in that: The method comprises inserting an insertion element and a viral genomic sequence into an expression vector; Wherein, the expression vector is selected from a eukaryotic expression vector; The insertion element is selected from a eukaryotic promoter and an optional element capable of increasing the expression of the recombinant plasmid; The viral genome sequence is selected from the enterovirus 71 genome sequence.

6. The method according to claim 5, wherein: The expression vector is selected from pBR322 and / or pVax1; And / or, the eukaryotic promoter is selected from SV40 and / or CMV; And / or, the element capable of improving the expression of the recombinant plasmid is selected from at least one of HDVr, SV40 polyA tail and BGH polyA tail; Preferably, the enterovirus 71 genome sequence is shown in SEQ ID NO: 1; Preferably, the sequence of the eukaryotic promoter SV40 is shown in SEQ ID NO: 2; Preferably, the sequence of the eukaryotic promoter CMV is shown in SEQ ID NO: 3; Preferably, the sequence of HDVr is as shown in SEQ ID NO: 4; Preferably, the SV40 polyA tail is a sequence containing 120-250 nucleotides; Preferably, the BGH polyA tail is a sequence containing 200-250 nucleotides; More preferably, the sequence of the SV40 polyA tail is as shown in SEQ ID NO: 5; More preferably, the sequence of the BGH polyA tail is as shown in SEQ ID NO:

6.

7. The method according to claim 5 or 6, wherein: The method of inserting the insertion element and the viral genome sequence into the expression vector comprises: after enzymatically cutting the expression vector, connecting the insertion element and the viral genome sequence to the expression vector after enzymatic cutting by using a ligase; Preferably, in the recombinant plasmid, the eukaryotic promoter is inserted at the front end of the chimeric viral genome sequence, and the element capable of improving the expression of the recombinant plasmid is inserted at the rear end of the chimeric viral genome sequence in the direction from the 5' end to the 3' end; More preferably, in the recombinant plasmid, from the 5' end to the 3' end, when the elements capable of improving the expression of the recombinant plasmid are HDVr and SV40 polyA tail and / or BGH polyA tail, the SV40 polyA tail and / or BGH polyA tail are located at the rear end of HDVr.

8. The recombinant plasmid prepared according to the method according to any one of claims 5 to 7.

9. A DNA-activated live attenuated hand, foot and mouth disease vaccine, characterized in that: The vaccine contains the recombinant plasmid according to any one of claims 1-4 and 8.

10. The vaccine according to claim 9, wherein The vaccine also contains a pharmaceutically acceptable excipient; Preferably, the auxiliary materials include at least one of a buffer, an excipient, a stabilizer and a preservative.

Images