A SNP molecular marker located on chromosome 2 and associated with abnormal farrowing traits in sows and its application

Abstract

The present invention belongs to the field of molecular biotechnology and molecular marker technology, and specifically relates to a SNP molecular marker located on chromosome 2 and related to abnormal delivery traits of sows and its application. The SNP site of the SNP molecular marker corresponds to the C>T mutation at 23330829bp on chromosome 2 of the international pig reference genome version 11.1, and the polymorphism of the base at this site affects the abnormal delivery traits of sows. The present invention solves the problem of genetic improvement of abnormal delivery in sows by means of molecular breeding. By optimizing the dominant alleles of the above-mentioned variant sites, the frequency of the dominant alleles can be increased from generation to generation, the incidence of abnormal delivery in sows can be reduced, the reproductive performance of sows can be improved, and the progress of pig genetic improvement can be accelerated, thereby effectively improving the economic benefits of breeding pigs.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biotechnology and molecular markers, and particularly relates to a SNP molecular marker located on chromosome 2 and associated with abnormal delivery traits of sows and an application thereof. Background Art

[0002] Abnormal sow delivery (dystocia) refers to the difficulty in delivering the fetus during the delivery of the sow, which usually requires artificial delivery. It is a common obstetric problem in pig farms. Abnormal sow delivery will lead to an increase in the number of stillbirths, a decrease in the number of live piglets, and a negative impact on the health and reproductive performance of the sow. The total number of piglets born is an important indicator to measure the reproductive efficiency of sows. Breeders have been committed to increasing the total number of piglets born by sows. After decades of improvement, the total number of piglets born by sows has increased significantly, and the delivery time has also been extended. Studies have shown that the delivery time of sows has increased from 2 hours (12 piglets) in the past to 6 hours and 40 minutes (19 piglets), the incidence of abnormal delivery in sows has increased from 0.25% to 5%, and the number of stillbirths has increased from 0.7 to 1.2. Therefore, understanding the genetic mechanism of sow delivery can help prevent abnormal delivery and reduce the number of stillbirths.

[0003] Genome-wide association study (GWAS) refers to the screening of genetic markers significantly associated with the target trait across the entire genome. GWAS has been widely used in the genetic improvement of important traits in livestock and poultry. However, the statistical power of GWAS is affected by sample size and marker density. Generally speaking, the larger the sample size and the higher the marker density, the stronger the statistical power of GWAS. The size of the sample is mainly affected by objective factors such as experimental cost and experimental cycle, while the marker density can be increased through genotype filling technology. Increasing the sample size and marker density is a common method to improve the statistical power of GWAS.

[0004] The "Du Changda" (Duroc pig × (Landrace pig × Large White pig)) three-way hybrid pig is the world's most popular commercial pig breed. Large White pig is one of the parents of Duroc Changda commercial pig. Genetic analysis of its delivery traits will help prevent abnormal delivery and reduce the number of stillbirths, improve the reproductive performance of sows, and thus improve the competitiveness of pig breeding companies, bringing huge economic benefits to the companies. Summary of the invention

[0005] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide a SNP molecular marker located on chromosome 2 and associated with abnormal farrowing traits in sows.

[0006] Another object of the present invention is to provide an application of the above-mentioned SNP molecular marker.

[0007] Another object of the present invention is to provide a primer pair and a kit for identifying the above-mentioned SNP molecular markers.

[0008] The fourth object of the present invention is to provide the application of the above primer pair and kit.

[0009] A fifth object of the present invention is to provide a method for genetic improvement of pigs.

[0010] The purpose of the present invention is achieved through the following technical solutions:

[0011] A SNP molecular marker located on chromosome 2 and associated with abnormal delivery traits in sows, wherein the SNP site of the SNP molecular marker corresponds to the C>T mutation at 23330829bp on chromosome 2 of the international pig reference genome version 11.1, and the polymorphism of the bases at this site affects the abnormal delivery traits in sows. The incidence of abnormal delivery of the CT genotype or TT genotype at the molecular marker is lower than that of the CC genotype.

[0012] The traits affecting abnormal delivery in sows specifically affect the incidence of abnormal delivery in sows.

[0013] The nucleotide sequence of the SNP molecular marker is preferably as shown in SEQ ID NO.1, wherein M in the sequence is C or T, and the molecular marker affects the incidence of abnormal delivery in sows.

[0014] The SNP site of the SNP molecular marker is a nucleic acid single base mutation C532-T532 at position 532 of the sequence annotation of SEQ ID NO:1, named g.532 C>T (corresponding to 23330829bp on chromosome 2 of the international pig reference genome version 11.1).

[0015] A primer pair for identifying the above-mentioned SNP molecular marker comprises primers primer-F and primer-R, and the nucleic acid sequences thereof are as follows:

[0016] Upstream primer primer-F: 5′-CCCACACTTTCGGTCTATCCA-3′;

[0017] Downstream primer primer-R: 5'-ATATGGAATGGGCCAGCGAAG-3'.

[0018] A kit for identifying the above-mentioned SNP molecular marker comprises the above-mentioned primer pair.

[0019] Application of the SNP molecular marker, primer pair or kit in identifying abnormal parturition traits of pigs, screening pig breeds with low incidence of abnormal parturition, or genetic breeding of abnormal parturition traits of pigs;

[0020] The pig is preferably an American Duroc pig, a synthetic American Duroc pig, an American Landrace sow, a synthetic American Landrace sow, a French Large White sow or a synthetic French Large White sow.

[0021] A method for detecting abnormal farrowing traits in sows, comprising the following steps:

[0022] The SNP site of the above SNP molecular marker on pig chromosome 2 is detected, and the abnormal delivery trait of the sow is determined according to whether the single nucleotide at the SNP site is C or T; the abnormal delivery incidence of the CT genotype or TT genotype at the molecular marker is lower than that of the CC genotype.

[0023] The pig is preferably an American Duroc pig, a synthetic American Duroc pig, an American Landrace sow, a synthetic American Landrace sow, a French Large White sow or a synthetic French Large White sow.

[0024] A method for screening a pig breed with a low incidence of abnormal delivery comprises the following steps:

[0025] The SNP site of the above SNP molecular marker on pig chromosome 2 is detected, and individuals with CT genotype or TT genotype at the site are selected as breeding pigs; the incidence of abnormal delivery of CT genotype or TT genotype at the molecular marker is lower than that of CC genotype.

[0026] The detection method comprises the following steps:

[0027] (1) Extracting genomic DNA from the pig to be tested;

[0028] (2) using the above primer pair or the primer pair in the above kit as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, to perform PCR amplification to obtain a PCR amplification product;

[0029] (3) Sequencing the PCR amplification product to obtain sequencing results;

[0030] (4) Determine the genotype based on the sequencing results.

[0031] The pig is preferably an American Duroc pig, a synthetic American Duroc pig, an American Landrace sow, a synthetic American Landrace sow, a French Large White sow or a synthetic French Large White sow.

[0032] A method for genetic improvement of pigs, comprising the following steps:

[0033] Determine the SNP molecular markers located on chromosome 2 of the breeding pigs in the breeding pig core group that are associated with abnormal sow delivery traits, and make corresponding selections based on the molecular markers: for the sub-breeding of breeding pigs, select individuals with CT genotype or TT genotype at 23330829bp on chromosome 2 of the international porcine reference genome version 11.1, and eliminate individuals with CC genotype at this site, so as to increase the frequency of allele T at this site from generation to generation, thereby reducing the incidence of abnormal sow delivery.

[0034] The pig is preferably an American Duroc pig, a synthetic American Duroc pig, an American Landrace sow, a synthetic American Landrace sow, a French Large White sow or a synthetic French Large White sow.

[0035] Compared with the prior art, the present invention has the following advantages and effects:

[0036] (1) Based on whole genome association analysis and genotype filling strategy, the present invention studies and determines that the SNP molecular marker associated with abnormal farrowing traits in sows is located at 23330829bp on chromosome 2 of the international pig reference genome version 11.1, which is a C>T mutation. The polymorphism of this variant site is significantly correlated with abnormal farrowing traits in sows.

[0037] (2) Based on the above-mentioned SNP molecular markers, the present invention provides a primer pair, a kit and a method for genetic improvement of pigs for identifying the above-mentioned SNP molecular markers, establishes an efficient and accurate molecular marker-assisted breeding technology, and applies it to the genetic improvement of abnormal delivery traits of sows, thereby reducing the incidence of abnormal delivery in sows, improving corporate profits and increasing core competitiveness.

[0038] (3) The present invention uses molecular breeding to solve the problem of genetic improvement of abnormal sow delivery. By optimizing the dominant alleles of the above mutations, the frequency of the dominant alleles can be increased from generation to generation, the incidence of abnormal sow delivery can be reduced, the progress of pig genetic improvement can be accelerated, and the economic benefits of pig breeding can be effectively improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is a genome-wide association study (GWAS) analysis of abnormal farrowing traits in sows on chromosome 2; the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log 10 ( P -value).

[0040] Figure 2 This is an analysis chart of the incidence of abnormal farrowing in sows with different genotypes (all experimental pig herds). DETAILED DESCRIPTION

[0041] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0042] Example 1 Detailed explanation of the determination process of the abnormal delivery characteristics in the present invention

[0043] (1) Experimental animals

[0044] Experimental pig herd: A total of 3379 sows were used in this experiment, including 116 American Duroc sows, 487 American Landrace sows and 2776 French Large White sows.

[0045] The experimental pig population used in the present invention is a core breeding pig population of a pig farm, and the population pedigree is recorded in detail. The pigs are free to eat and drink water, and the entire feeding method and feeding conditions are always consistent, which is a conventional method.

[0046] (2) Determination of abnormal delivery characteristics

[0047] This study recorded the status of sows during farrowing. Abnormal farrowing was defined as the need for artificial assistance during the entire farrowing process, and normal farrowing was defined as the need for artificial assistance during the entire farrowing process. At the same time, the farrowing status (normal farrowing, abnormal farrowing), total piglets born, number of live piglets born, and number of healthy piglets (piglet birth weight>0.80kg) of all sows were recorded.

[0048] (3) Sample collection

[0049] The sow ear sample tissues were collected and immersed in a 75% ethanol solution and stored in a -20°C refrigerator for future use.

[0050] Example 2 Detailed explanation of the invention process of obtaining the gene markers of the present invention

[0051] (1) Extraction of DNA from ear tissues of experimental pig groups: Whole genome DNA was extracted according to the standard phenol-chloroform method. The DNA of the above groups was tested for quality and concentration using a Nanodrop-ND1000 spectrophotometer. The A260 / 280 ratio was between 1.8 and 2.0, and the A260 / 230 ratio was between 1.7 and 1.9, which was considered qualified. Finally, the qualified DNA samples were uniformly diluted to 50 ng / μL.

[0052] (2) Pig whole genome 50K SNP genotyping: DNA samples were sent to Beijing Compson Biotechnology Co., Ltd., based on the SMIC-1 50K SNP typing platform, using the Illumina Infinium instructions and standard procedures for chip hybridization and result scanning (i.e. genotype determination). Finally, the genotype data were read using GenomeStudio software. PLINKv1.90 was used to perform quality control on the obtained genotype data, and the detection rate <95%, the allele frequency (MAF) <1% or the deviation from Hardy-Weinberg Equilibrium (HWE) were eliminated. P ≤10 -6 SNP markers with a detection rate of <95% were excluded.

[0053] (3) Filling missing genotypes in pigs: Using the public data of 947 individuals (https: / / doi.org / 10.1038 / s41467-023-40434-3) as the filling reference population, the 50K SNPs chip data of sows in the above population were filled into whole genome sequencing data based on the reference haplotype library using Beagle v5.1 software. The genotype filling data was then quality controlled, and the specific quality control method was the same as step (2).

[0054] (4) Genome-wide association (GWAS) analysis: A case-control-based genome-wide association analysis was used to detect the differences in allele and genotype frequencies between case individuals and control individuals at each variant site in the whole genome, so as to search for sites that are in linkage disequilibrium with the gene loci that control the target trait. In this study, the GEMMA software jointly developed by Xiang Zhou from the University of Michigan and Matthew Stephens from the University of Chicago was used to conduct GWAS analysis on sows. Sows with normal delivery during delivery are considered to be in the Control group; sows that require artificial delivery (abnormal delivery) during delivery are considered to be in the Case group. In this study, 467 sows were in the abnormal delivery group and 2912 sows were in the normal delivery group for subsequent analysis. The present invention uses a linear mixed model single-point regression analysis, and the first five principal components, year season, and batch are added to the model as covariates for GWAS analysis.

[0055] In addition, given the assumption that the number of independent haplotype boxes in pigs and humans is basically the same, the genomic significance threshold set for human GWAS analysis was 5.00×10 -8 The present invention refers to the significant threshold of the human genome, and the significant level threshold of the genome is 5.00×10 -8; The significant threshold at the chromosome level was 1.00×10 -6 .

[0056] GWAS analysis results Figure 1 As shown. Figure 1 It can be seen that in the experimental pig population, there is a SNP site on chromosome 2 that significantly affects abnormal delivery in sows. The strongest associated SNP is g.532 C>T (the 532nd C>T mutation in SEQ ID NO:1, corresponding to the C>T mutation at 23330829bp on chromosome 2 of the international pig reference genome version 11.1) ( P =6.42×10 -8 ).

[0057] (5) Analysis of the association between different genotypes and abnormal delivery phenotypes of sows: According to Table 1, the SNP site g.532 C>T of the molecular marker is extremely significantly correlated with abnormal delivery traits ( P =6.42×10 -8 ), indicating that this molecular marker significantly affects the abnormal delivery trait of sows. Through auxiliary selection of this variant site in pigs, the incidence of abnormal delivery in this group can be reduced, thereby accelerating the breeding process of abnormal delivery traits in sows. In addition, according to Table 1, Figure 2 It can also be seen that the CC type has a higher incidence of abnormal delivery than the CT and TT types, indicating that homozygous CC is the most unfavorable for sow delivery. Therefore, in the process of breeding, it is necessary to gradually eliminate CC type breeding pigs and retain breeding pigs with CT and TT genotypes to increase the frequency of allele T at this site generation by generation to reduce the incidence of abnormal delivery in sows.

[0058] Table 1 Correlation between molecular marker variant site g.532 C>T and abnormal farrowing traits in sows

[0059]

[0060] (6) Effect of abnormal delivery on sow reproductive performance: The statistical analysis software used in this study was R language. The anov() function was used to conduct a one-way between-group analysis of variance on the abnormal delivery characteristics of the first normal delivery of 3379 sows. P <0.05 indicates significant difference. P >0.05 indicates no significant difference. As shown in Table 2, the total number of piglets born, the number of live piglets born, and the number of healthy piglets in the normal delivery group were significantly higher than those in the abnormal delivery group ( P <0.001). Among them, the total number of piglets born, the number of live piglets born, and the number of healthy piglets of sows with normal farrowing were more than 2.5 piglets more than those of sows with abnormal farrowing. These results show that the reproductive performance of sows with normal farrowing is significantly higher than that of sows with abnormal farrowing.

[0061] Table 2 Effects of abnormal delivery on reproductive traits of sows

[0062]

[0063] Note: ns (Non-significant) is not significant. P >0.05;*: P <0.05,**: P <0.01,***: P <0.001

[0064] Example 3 Detailed explanation of the invention process of detecting molecular markers

[0065] (1) The target fragment containing a mutation site significantly associated with abnormal farrowing traits in sows is a 863 bp nucleotide sequence in chromosome 2 (SEQ ID NO: 1). The upstream and downstream primers for sequence amplification are primer-F and primer-R. The nucleic acid sequence is as follows:

[0066] Upstream primer primer-F: 5′-CCCACACTTTCGGTCTATCCA-3′;

[0067] Downstream primer primer-R: 5'-ATATGGAATGGGCCAGCGAAG-3'.

[0068] (2) PCR amplification system and condition settings

[0069] A 10 μL system was prepared, including 1.0 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O. The PCR reaction program was as follows: 95°C for 3 min; 94°C for 30 s, 60°C for 30 s, and 72°C for 60 s, 30 cycles; 72°C for 10 min.

[0070] (3) DNA sequencing identification: Sequencing was performed at Shenzhen BGI Genomics Co., Ltd., and the gene fragments were tested for both positive and negative reactions. The measured sequence was compared with the NCBI genome sequence to obtain the mutation at the corresponding variant site. The sequencing results are shown below:

[0071] CCCACACTTTCGGTCTATCCATCTATCTGTCTGTCTACCTACTTATCGACCTACCTACTTATGTATATGTGGTATTCCAACATTATAAAACTACCACACATATCAGAAGATCACTGCAAGCCAACTCCTGAG ACGTTAAGACATGAACTCAGAGACACTTGTAAATTTCCATATTCTAAATATTAAATCTAAAATTACCAAGGGTCCACAAAAGATTTATTTTTATTTGTTCCACTGAAATATTCAAAACTCAAATCAGTAGGG TATAACCTACTAGACTTAGTAGTCTTATAAATAACTGTCTCACCTTCCATTCAGTCCTGCCCCCGAAAAAGGGCACAAGTTCTGTACATATACAATTTTATATTACTCCTGAAGTTGGTTTTGTTACCTCCCAAAAACAGGTTTTATATCAACCTTCCCTAACAACAATAACAGCAATAACTGTAAAAACAGCACATACTTTTTATAAGATTTACCATGTTCTAGGTACTGAACTTACAAAAGTTGAACCCATAATCTA M(C / T) GTAAAACCCCTTTGAGGTAAAGTCTTTATTATTAGCCTTATTTCACAGATGAAGAAAATCAAGTACAGAACACTTGACCCCAGAATCACTCATCAAGACAGTAGTCAGGTCAGAAGTCACAGCCAGGGAGTCAGGGTCCAGATCTGAACCCTGACACACTAA GCAGACTTTAGTCCACACAGATTTGATTTCATTACATATCTTCCTAAGCTCAAGTGTTTAATAATATTTACATATTACTTAAATGTATTTTTTAGTTTTTTTTTCAATTTTTATGGTTAACCTTTTAAATCATCATCTAATTTATGCTTCGCTGGCCCATTCCATAT

[0072] Note: The M marked in the sequence is the mutation site, which is displayed with an underline (the mutated base in brackets is the allele mutation), and the bold at the beginning and end of the sequence is the primer sequence binding position.

[0073] Example 4 Analysis of the effect of SNP molecular marker variable site g.532 C>T

[0074] The present invention provides a SNP molecular marker that can significantly reduce the incidence of abnormal delivery in sows. Using the SNP molecular marker for marker-assisted selection can greatly reduce the incidence of abnormal delivery in sows. If the present invention selects all CC-type individuals of SNP molecular markers that affect the abnormal delivery trait of sows into TT-type individuals, the abnormal delivery rate of sows will be reduced from 18.33% to 7.06%, which will greatly improve the reproductive performance of sows. Assuming that 10,000 sows are selected from CC type to TT type, the number of sows with normal delivery increases from 8,167 to 9,294, an increase of 1,127. According to the normal delivery sows produce 2.5 more live piglets per litter, and the sows have 2.3 litters a year, 6,480.25 more pigs are provided to the pig farm each year. Each pig is sold at 2,000 yuan / 120kg, which can bring about 12.96 million yuan of income to the pig farm each year. It can be seen that the potential for reducing the abnormal delivery rate to provide benefits to the pig farming industry is huge. In this molecular marker individual, by optimizing the dominant allele (T) of this variant site in the sow population, it is ultimately possible to improve the reproductive performance of sows, thereby increasing the company's profits.

[0075] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principles of the present invention shall be equivalent replacement methods and shall be included in the protection scope of the present invention.

Claims

1. A reagent for detecting SNP molecular markers on chromosome 2 associated with abnormal farrowing traits in sows for use in identifying abnormal farrowing traits in pigs, screening pig breeds with low incidence of abnormal farrowing, or genetic breeding for abnormal farrowing traits in pigs, characterized in that The SNP site of the SNP molecular marker corresponds to the C>T mutation at 23330829bp on chromosome 2 of the international pig reference genome version 11.

1. The polymorphism of the base at this site affects the abnormal delivery trait of sows. The CT genotype or TT genotype at this molecular marker has a lower incidence of abnormal delivery than the CC genotype. The pigs are American Duroc pigs, American Duroc pigs of synthetic strain, American Landrace sows, American Landrace sows of synthetic strain, French Large White sows or French Large White sows of synthetic strain.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein M in the sequence is C or T.

3. A primer pair for detecting SNP molecular markers on chromosome 2 associated with abnormal farrowing traits in sows for use in identifying abnormal farrowing traits in pigs, screening pig breeds with low incidence of abnormal farrowing, or genetic breeding for abnormal farrowing traits in pigs, characterized in that The primer pair comprises primers primer-F and primer-R, and the nucleic acid sequences thereof are as follows: Upstream primer primer-F: 5′-CCCACACTTTCGGTCTATCCA-3′; Downstream primer primer-R: 5′-ATATGGAATGGGCCAGCGAAG-3′; The molecular marker is the molecular marker described in claim 1, and the CT genotype or TT genotype at the molecular marker has a lower incidence of abnormal delivery than the CC genotype; The pigs are American Duroc pigs, American Duroc pigs of synthetic strain, American Landrace sows, American Landrace sows of synthetic strain, French Large White sows or French Large White sows of synthetic strain.

4. A kit for detecting SNP molecular markers on chromosome 2 associated with abnormal farrowing traits in sows for use in identifying abnormal farrowing traits in pigs, screening pig breeds with low incidence of abnormal farrowing, or genetic breeding for abnormal farrowing traits in pigs, characterized in that The kit comprises the primer pair described in claim 3; The molecular marker is the molecular marker described in claim 1, and the CT genotype or TT genotype at the molecular marker has a lower incidence of abnormal delivery than the CC genotype; The pigs are American Duroc pigs, American Duroc pigs of synthetic strain, American Landrace sows, American Landrace sows of synthetic strain, French Large White sows or French Large White sows of synthetic strain.

5. A method for detecting abnormal farrowing traits in sows, comprising the following steps: Detecting the SNP site of the SNP molecular marker described in claim 1 on chromosome 2 of the pig, and judging the abnormal delivery trait of the sow according to whether the single nucleotide at the SNP site is C or T; the abnormal delivery incidence of the CT genotype or TT genotype at the molecular marker is lower than that of the CC genotype; The pigs are American Duroc pigs, American Duroc pigs of synthetic strain, American Landrace sows, American Landrace sows of synthetic strain, French Large White sows or French Large White sows of synthetic strain.

6. A method for screening pig breeds with low incidence of abnormal delivery, characterized in that The following steps are included: Detecting the SNP site of the SNP molecular marker of claim 1 on chromosome 2 of pigs, and selecting individuals with CT genotype or TT genotype at the site as breeding pigs; the incidence of abnormal delivery of CT genotype or TT genotype at the molecular marker is lower than that of CC genotype; The pigs are American Duroc pigs, American Duroc pigs of synthetic strain, American Landrace sows, American Landrace sows of synthetic strain, French Large White sows or French Large White sows of synthetic strain.

7. The method according to claim 6, characterized in that: The detection method comprises the following steps: (1) Extracting genomic DNA from the pig to be tested; (2) using the primer pair described in claim 3 or the primer pair in the kit described in claim 4 as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, to perform PCR amplification to obtain a PCR amplification product; (3) Sequencing the PCR amplification product to obtain sequencing results; (4) Determine the genotype based on the sequencing results.

8. A method for genetic improvement of pigs, characterized in that The following steps are included: Determine the SNP molecular markers on chromosome 2 of the breeding pigs in the breeding pig core group that are related to the abnormal delivery trait of sows, and make corresponding selections based on the molecular markers: select the CT genotype or TT genotype individuals at 23330829bp on chromosome 2 of the international pig reference genome version 11.1 for the succession breeding of breeding pigs, and eliminate the CC genotype individuals at this site, so as to increase the frequency of the allele T at this site from generation to generation, thereby reducing the incidence of abnormal delivery in sows; The pigs are American Duroc pigs, American Duroc pigs of synthetic strain, American Landrace sows, American Landrace sows of synthetic strain, French Large White sows or French Large White sows of synthetic strain.

Images