Salt-tolerant molecular marker of maize and application thereof
By using molecular markers and primer pairs developed on maize chromosome 2 and employing PCR amplification technology, the problem of identification difficulties in maize salt-alkali tolerance breeding was solved, enabling early, rapid, and accurate identification of maize salt-alkali tolerance and promoting the progress of maize salt-alkali tolerance breeding.
Patent Information
- Application Number
- CN202411783284.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-06
- Publication Date
- 2025-10-21
- Estimated Expiration
- 2044-12-06
AI Technical Summary
In the current technology, there are few developments and applications of molecular markers for salt and alkali tolerance in maize, making it difficult to efficiently identify and utilize genetic variations in maize's salt and alkali tolerance, which leads to a slow progress in maize salt and alkali tolerance breeding.
A molecular marker for maize salt tolerance located on maize chromosome 2 was developed. ZmNC3-N-Marker-F1 and ZmNC3-N-Marker-R1 were amplified by PCR using specific primers. The difference between 100bp and 121bp fragments was used to determine whether maize is salt-tolerant. Corresponding kits and identification methods were designed to achieve early and accurate identification.
It enables rapid and accurate identification at the early stage of maize seeds or cotyledons, significantly accelerating the breeding process of salt-tolerant maize varieties and improving breeding efficiency.
Smart Images

Figure CN119351614B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering technology and agricultural breeding. Specifically, the present application relates to a molecular marker for corn salt-alkali tolerance and its application. Background Art
[0002] Salt-alkali stress is one of the most common abiotic stresses in nature. Due to its widespread distribution, it has a significant negative impact on agricultural production (Munns & Tester, 2008; Zhu, 2016). In-depth research on the molecular mechanisms of adaptation of major crops to salt-stress environments, identification of genes that can be used to improve crop salt-alkali tolerance, and breeding of salt-alkali-tolerant crop varieties are essential measures to ensure the sustainable development of agriculture and national food security in my country.
[0003] The salt-alkali tolerance response process mainly includes two aspects: deionization toxicity and osmotic regulation. When growing under salt stress conditions, plant roots will absorb excess Na + , while inhibiting K + Absorption, leading to K + / Na + The ratio is unbalanced, resulting in ion poisoning and osmotic stress. + , K + Homeostasis is crucial for the development of salt-alkali tolerance in plants (Munns and Tester, 2008; Yang and Guo, 2018). Maize, the most widely cultivated crop in my country, is sensitive to salt stress (Wang Liyan, 2005). Previous studies have shown that natural maize populations possess rich genetic diversity, with differences in salt-alkali tolerance among different maize inbred lines. This suggests that abundant genetic variation exists within natural maize populations and could be exploited for genetic improvement of salt-alkali tolerance (Zhang et al., 2019; Luo et al., 2019). The increasing application of genome-wide association studies (GWAS) and quantitative trait genomics (QTL) analysis to discover genes associated with salt-alkali tolerance in maize has uncovered a series of genetic loci associated with salt-alkali tolerance. However, to date, only a few QTL genes for salt-alkali tolerance have been cloned, and the development and application of molecular markers for salt-alkali tolerance in maize are relatively limited. Therefore, discovering and cloning salt-alkali tolerance QTL genes and analyzing their salt-alkali tolerance mechanisms, developing new salt-alkali tolerance molecular markers and applying them to salt-alkali tolerance breeding of corn, have important genetic resource support and application value for the breeding of salt-alkali tolerant corn. Summary of the Invention
[0004] On the one hand, the present application provides a molecular marker for salt-alkali tolerance of corn, the nucleotide sequence of which is SEQ ID NO.6.
[0005] Furthermore, the salt-alkali tolerance molecular marker for corn is located on chromosome 2 of corn.
[0006] Furthermore, the maize salt-alkali tolerance molecular marker is obtained by amplifying maize genomic DNA using the following primer pairs:
[0007] ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT;
[0008] ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC.
[0009] On the other hand, the present application provides a primer pair for detecting the above-mentioned corn salt-alkali tolerance molecular marker, the nucleotide sequence of the primer pair is:
[0010] ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT;
[0011] ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC.
[0012] On the other hand, the present application provides a kit for identifying whether corn is salt-alkali tolerant, the kit comprising the above-mentioned primer pair.
[0013] On the other hand, the present application provides a method for identifying whether corn is salt-alkali tolerant, the method comprising:
[0014] (1) Extracting genomic DNA from the corn to be tested;
[0015] (2) Amplify maize genomic DNA using the following primer pairs:
[0016] ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT;
[0017] ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC;
[0018] (3) Determine whether the corn to be tested is salt-alkali tolerant based on the amplification results: if a 100 bp fragment is obtained by amplification, the corn to be tested is salt-alkali tolerant; if a 121 bp fragment is obtained by amplification, the corn to be tested is salt-alkali sensitive.
[0019] The step (2) can be performed using the above-mentioned kit.
[0020] Furthermore, the PCR system used for amplification in step (2) was a 20 μl system, including 10 μl of 2×Super MultiplexPCR Mix, 1 μl of 10 μM Primer ZmNC3-N-Marker-F1, 1 μl of 10 μM Primer ZmNC3-N-Marker -R1, 1 μl of corn genomic DNA, and 7 μl of ddH2O.
[0021] Furthermore, the PCR program used for amplification in step (2) was as follows: first, pre-denaturation at 95°C for 5 min; then, 34 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s; and finally, extension at 72°C for 5 min.
[0022] Furthermore, in step (3), the amplification results are observed by electrophoresis.
[0023] Furthermore, in step (1), genomic DNA of the corn to be tested is extracted from the corn to be tested.
[0024] On the other hand, the present application provides the application of the above-mentioned molecular markers, kits, and methods in salt-alkali tolerant corn breeding.
[0025] Furthermore, in the application, salt- and alkali-tolerant corn plants or seeds are selected for breeding.
[0026] Maize genomic DNA can be extracted using methods such as the CTAB method, or using commercially available kits. The samples used can be seeds, stems at different growth stages, leaves, fruits, and other parts.
[0027] The present invention has discovered a nucleic acid sequence that can be used as a molecular marker to determine whether corn is salt- and alkali-tolerant. Since corn salt- and alkali-tolerant is a quantitative trait, phenotypic analysis is time-consuming and labor-intensive. The present invention's molecular marker, primer pairs, and kit for salt- and alkali-tolerant corn can be applied to salt- and alkali-tolerant corn breeding. Identification can be performed during the early stages of corn seed development or cotyledon emergence, saving time and ensuring accuracy. This approach can accelerate the selection of salt- and alkali-tolerant corn varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 This is the status of functional SNP sites and molecular marker sites in Yu 82, W966, Shen 137, LH38, Dan 598 and Su 75.
[0029] Figure 2 The results are shown in Figure 3. PCR amplification of genomic DNA from Yu 82, W966, Shen 137, LH38, Dan 598, and Su 75 using primers ZmNC3-N-Marker-F1 / ZmNC3-N-Marker-R1.
[0030] Figure 3 The Na of 100 maize inbred lines with PCR bands of 121 bp and 100 bp + Content difference diagram.
[0031] Figure 4 This is the linkage disequilibrium analysis between Del1213 and the ZmNC3 functional variation site SNP947. Part A shows the natural variation in the ZmNC3 gene region and the relationship between the aboveground Na + Part B is the results of content association analysis; Part B is a schematic diagram of the structure of the ZmNC3 gene; Part C is the results of linkage disequilibrium analysis of natural variations in the ZmNC3 gene interval. DETAILED DESCRIPTION
[0032] Example 1 Development of molecular markers linked to the salt-alkali tolerance QTL gene ZmNC3
[0033] ZmNC3 is a salt-tolerance QTL gene identified in maize. This gene encodes an HKT family transporter protein that positively regulates maize salt tolerance. Subsequent analysis showed that the superior allele of ZmNC3 is only present in 6% of modern maize inbred lines, and none of the parents of major maize varieties such as Zhengdan 958 contain this superior allele. Because its functional variant site SNP947 (A / G) is a single nucleotide variant, there is currently no suitable molecular marker that can be used for molecular selection breeding based on PCR product size. Therefore, the inventors identified an insertion / deletion molecular marker highly linked to the ZmNC3 functional variant site for molecular breeding of salt and alkali tolerance in maize.
[0034] Based on the functional variation site SNP947 (A / G) of ZmNC3, 116 maize inbred line materials were divided into haplotype G (salt-alkali tolerant) and haplotype A (salt-sensitive). Three materials were randomly selected from each haplotype, and it was found that there was a substitution at chr2: 11471394 from ATATCTTTCTCTCACTCACTCCGTCGCCTCTGTCTCTG (SEQ ID NO.1) to GTCTCTCTCTCTCTCAC (SEQ ID NO.2), resulting in a 21-bp insertion / deletion, which was named Del1213. The SNP947 site of the salt-alkali tolerant inbred lines Yu 82, LH38, and Su 75 is G, and contains Del1213; the SNP947 site of the salt-sensitive inbred lines W966, Shen 137, and Dan 598 is A, and does not contain Del1213. Figure 1 shown.
[0035] Using the Del1213 site as a molecular marker, the inventors designed a pair of primers:
[0036] ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT (SEQ ID NO.3);
[0037] ZmNC3-N-Marker-R1: CATAACGTGAACTGCGATGC (SEQ ID NO. 4).
[0038] PCR amplification was performed using this pair of primers with the genomic DNA of Yu 82, W966, Shen 137, LH38, Dan 598 and Su 75 as templates.
[0039] PCR system 20 μl: 2×Super Multiplex PCR Mix 10 μl, 10 μM Primer ZmNC3-N-Marker-F1 1 μl, 10 μM Primer ZmNC3-N-Marker-R1 1 μl, DNA 1 μl, ddH2O 7 μl.
[0040] PCR program: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 34 cycles from denaturation to extension, and final extension at 72°C for 5 min.
[0041] The results showed that the primer pair could obtain a 100 bp band when the total DNA of salt-tolerant maize inbred lines Yu 82, LH38, and Su 75 was used as template for PCR amplification; and a 121 bp band when the total DNA of salt-sensitive maize inbred lines W966, Shen 137, and Dan 598 was used as template for PCR amplification. Figure 2 shown.
[0042] 121bp band sequence (SEQ ID NO.5)
[0043] CCTCGACCTCTCCACACTGGCAGCGGCCATCCTCGTACTCTTCGTCCTCATGATGTGAGTATATCTTTCTCTCACTCACTCCGTCGCCTCTGTCTCTGTGTGCATCGCAGTTCACGTTATG;
[0044] 100bp band sequence (SEQ ID NO.6)
[0045] CCTCGACCTCTCCACACTGGCGACGGCCATCCTCGTGCTCTTCGTCCTCATGATGTGAGTGTCTCTCTCACTCACTGTGCATCGCAGTTCACGTTATG.
[0046] Example 2 Detection of salt-alkali tolerance in corn using salt-alkali tolerance molecular markers
[0047] We further selected 100 maize inbred lines (including some backbone maize inbred lines) and used the primer pair ZmNC3-N-Marker-F1 / ZmNC3-N-Marker-R1 to identify the Del1213 locus. The detection method was as described in Example 1, with PCR amplification performed using the maize genomic DNA to be tested as a template. The results showed that 89 of the inbred line PCR products were large fragments with a product length of 121 bp, of which 89 were from the salt-sensitive inbred line SNP947-A. The remaining 11 inbred line PCR products were small fragments with a product length of 100 bp, of which 10 were from the salt- and alkali-tolerant inbred line SNP947-G and 1 was from the salt-sensitive inbred line SNP947-A. The names of the inbred lines used and the identification results are shown in the following table:
[0048] Inbred line name Fragment size (bp) SNP947(A / G) <![CDATA[Na + Content (mg / g DM)]]> PHWG5 121 A 1.621662 W966 121 A 10.63558 C521 121 A 3.491612 S22 121 A 10.52001 Q1261 121 A 2.816145 3335 121 A 6.787425 xing230 121 A 3.874476 SC11-1 121 A 8.974777 DF24 121 A 6.661916 1313 121 A 10.33714 Shen 137 121 A 6.873964 D856 121 A 9.435375 Shen 977 121 A 7.0577 Max 121 A 11.65986 99122 121 A 5.683456 8982 121 A 9.780378 P138 121 A 6.894784 18-599 121 A 7.584607 98F1 121 A 6.516062 Jun 92-8 121 A 5.322693 6 121 A 5.330379 200B 121 A 5.816811 Zhonghuang 64 121 A 4.47258 DM07 121 A 3.671288 18 121 A 5.486873 SS99 121 A 3.625898 R25 121 A 7.132929 Maxa 121 A 4.375227 Jiutai 1 121 A 2.701834 Sea 9-21 121 A 10.3196 178 121 A 3.494556 Dan598 121 A 6.343634 7327 121 A 6.326763 W2H03 121 A 10.2976 S311 121 A 4.940879 CT109 121 A 5.657551 Guangyou 5 121 A 7.682174 Song Dynasty 1145 121 A 4.568216 White U8112 121 A 3.21029 Ning 45 121 A 8.906383 R150 121 A 5.057114 Zhang Jin6 121 A 2.871825 Va26 121 A 6.253945 Ay420 121 A 2.658997 E601 121 A 13.53678 E588 121 A 9.416017 MO113 121 A 6.064061 5032 121 A 4.677682 4936 121 A 4.791337 DF32 121 A 4.471492 P25 121 A 3.111876 20837 121 A 3.919038 D23 121 A 6.810556 1121 121 A 6.651002 Jun 971 121 A 3.615076 W182bn 121 A 4.398441 wood 4 121 A 7.985504 Boom 2 121 A 3.654626 451 121 A 6.078983 LH65 121 A 6.981855 Tang Huang 17 121 A 5.132503 Oh07B 121 A 12.37555 Oh43 121 A 4.049625 PHK05 121 A 3.882019 FR14 121 A 5.145394 IBC2 121 A 4.05722 PHW79 121 A 4.228384 PHW43 121 A 2.687707 680 121 A 13.49979 PHJ31 121 A 6.174125 FAPW 121 A 9.659253 HBA1 121 A 6.329896 LH132 121 A 6.242923 Rock 172 121 A 5.933655 L005 121 A 8.120964 D892 121 A 2.920465 7236 121 A 4.414401 Level 17-1 121 A 5.902099 DF20 121 A 6.684696 B102 121 A 4.495419 Cheng 435 121 A 4.438768 West 502 121 A 3.483697 68122 121 A 11.05129 85 White 64 121 A 5.715361 L105 121 A 3.567887 K14 121 A 2.610175 DH65232(DH9) 121 A 3.927306 Seagu1117 121 A 6.267872 PHW52 121 A 11.15726 K22 100 G 1.422959 Yd6 100 G 3.198719 Henan 374 100 G 1.169224 N68a 100 G 1.087041 L05-6 100 G 1.130404 Su-75 100 G 1.139964 Henan 82 100 G 1.079114 FC-13 100 G 2.537523 H84 100 G 2.824265 LH38 100 G 1.517829 CWU215B 100 A 3.552644
[0049] Under salt stress conditions, the Na in the leaves of the material with the PCR band of 121 bp + The content is significantly higher than that of the material with a band of 100bp, such as Figure 3 shown.
[0050] Example 3 Linkage Disequilibrium Analysis between Del1213 and ZmNC3 Functional Variation Site SNP947
[0051] The genomic DNA of ZmNC3 in 513 maize inbred lines was PCR amplified and resequenced. The resequencing regions included the promoter region, CDS region, and 3′-UTR region of ZmNC3 (sequencing was completed at Beijing Liuhe BGI Genomics Co., Ltd.). The sequencing results were aligned and differential sites were obtained using Codoncode Aligner software. All genotype data were analyzed for candidate gene association using Tassle5 software. At the same time, linkage disequilibrium analysis of natural variant sites was performed using HapView software. The results showed that Del1213 was linked to the ZmNC3 functional site SNP947 (r 2 = 0.8) and with the aboveground Na + The contents were significantly correlated, such as Figure 4 shown.
[0052] Therefore, the primer pair ZmNC3-N-Marker-F1 / ZmNC3-N-Marker-R1 can be used for molecular-assisted breeding of salt-alkali tolerance in maize, and the salt-alkali tolerance molecular marker based on this primer pair is named J-Del1213. The sequences of each primer are:
[0053] Primer ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT (SEQ ID NO. 3);
[0054] Primer ZmNC3-N-Marker-R1: CATAACGTGAACTGCGATGC (SEQ ID NO. 4).
Claims
1. A method for identifying whether corn is salt- and alkali-tolerant, characterized in that: The method comprises: (1) Extracting genomic DNA from the corn to be tested; (2) Amplify the genomic DNA of the corn to be tested using the following primer pairs: ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT; ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC; (3) Determine whether the corn to be tested is salt- and alkali-tolerant based on the amplification results: if a 100 bp fragment is obtained by amplification, the corn to be tested is salt- and alkali-tolerant; if a 121 bp fragment is obtained by amplification, the corn to be tested is salt- and alkali-sensitive.
2. The method according to claim 1, wherein the PCR system used for amplification in step (2) is a 20 μl system, comprising 10 μl of 2×Super Multiplex PCR Mix, 1 μl of 10 μM Primer ZmNC3-N-Marker-F1, 1 μl of 10 μM Primer ZmNC3-N-Marker -R1, 1 μl of corn genomic DNA, and 7 μl of ddH2O.
3. The method according to claim 1, wherein in step (3), the amplification results are observed by electrophoresis.
4. Application of the method according to any one of claims 1 to 3 in salt-alkali tolerant corn breeding.
5. The use according to claim 4, wherein salt- and alkali-tolerant corn plants or seeds are selected for breeding.
Citation Information
Patent Citations
Maize salt-resistant major QTL gene and application thereof
CN111676232A
Molecular marker closely linked with salt tolerance of corn, molecular marker primer and application of molecular marker primer
CN116970731A