RPA-LFD primer probe and kit for detecting infectious spleen and kidney necrosis virus and subtype thereof and application of RPA-LFD primer probe and kit

Abstract

The invention relates to an RPA-LFD primer probe and a kit for detecting infectious spleen and kidney necrosis virus and subtypes thereof and application of the RPA-LFD primer probe and the kit, the RPA-LFD primer probe and the kit for detecting the infectious spleen and kidney necrosis virus and the subtypes thereof are characterized in that four subgenotypes of siniperca chuatsi susceptible ISKNV are subjected to multi-sequence comparison, and mutation optimization is carried out on nonconservative bases on target fragments of designed primers by utilizing the characteristic that a few bases between an RPA tolerable template and the primers are not matched; according to the primer and probe combination, the number of dimer structures formed between the primer and the probe is reduced, and the designed primer and probe combination not only increases the detection rate of various sub-genotypes of ISKNV, but also reduces false positive caused by primer dimers, so that the accuracy of a detection result is improved on the whole.

Description

Technical Field

[0001] The invention belongs to the technical field of virus detection, and specifically relates to an RPA-LFD primer probe, a kit and applications thereof for detecting infectious spleen and kidney necrosis virus and its subtypes. Background Art

[0002] Mandarin fish (Siniperca chuatsi) is a high-quality species of freshwater fish in my country. Its meat is delicious and nutritious, and it is deeply loved by consumers. However, with the continuous expansion of the scale of mandarin fish farming, the disease problem of mandarin fish has also become a major bottleneck restricting the development of the industry. In recent years, infectious spleen and kidney necrosis virus (ISKNV) has caused great harm to the mandarin fish farming industry. The virus belongs to the family Iridoviridae and the genus Megaocytoviurs. ISKNV has three genotypes, namely, red sea bream iridovirus (RSIV) type, infectious spleen and kidney necrosis virus (ISKNV) type, and turbot red body disease iridovirus (TRBIV) type, which are further subdivided into six subgenotypes (ISKNV-Ⅰ, ISKNV-Ⅱ, RSIV-Ⅰ, RSIV-Ⅱ, TRBIV-Ⅰ and TRBIV-Ⅱ). Existing studies have found that both RSIV and ISKNV can infect mandarin fish, while TRBIV only infects marine fish such as flatfish and rarely infects other fish. ISKNV is fast infective and has a high mortality rate, and there is currently a lack of specific drugs. Therefore, rapid and accurate detection of ISKNV is of great significance to the healthy breeding of mandarin fish.

[0003] At present, the detection and identification of ISKNV are mainly based on conventional PCR, nested PCR and fluorescent quantitative PCR. These detection methods require the use of complex instruments and equipment, and cannot be quickly detected at the breeding site. Recombinase polymerase amplification (RPA) is an isothermal DNA amplification technology. It can amplify specific oligonucleotide sequences by reacting at a constant temperature of 30-45°C for 10-30 minutes, and the amplified products can be combined with lateral flow dipsticks (LFD) for naked eye interpretation.

[0004] The existing detection methods for ISKNV basically target a single genotype of ISKNV, without taking other genotypes into consideration, which may lead to missed detection of ISKNV. Therefore, it is urgent to develop a rapid detection method that can simultaneously detect the four sub-genotypes (ISKNV-Ⅰ, ISKNV-Ⅱ, RSIV-Ⅰ, RSIV-Ⅱ) to which mandarin fish are susceptible on site. Summary of the invention

[0005] The invention provides an RPA-LFD primer and probe combination for detecting infectious spleen and kidney necrosis virus and its subtypes. The primers include: a forward primer ISKNV-F: CTCATCAGCCAGAGCAACCAGGCCGACA, a reverse primer ISKNV-R: CCTCAACCTCACGCTCCTCCCTTCTCAGTA; and the probe includes a probe ISKNV-P: TGGCCATATCGACCGTCACCATGGCTAACA / THF / TGGCAATGTAGCACCCG.

[0006] Furthermore, the 5' end of the reverse primer ISKNV-R is connected with Biotin, the 5' end of the probe is labeled with carboxyfluorescein FAM, the 3' end is added with an extension blocking group C3 Spacer, and the 31st position of the probe sequence is not a base but tetrahydrofuran (THF).

[0007] The present invention also provides a kit for detecting infectious spleen and kidney necrosis virus and its subtypes, comprising any of the above-mentioned primer and probe combinations.

[0008] Furthermore, the kit comprises a dual microsphere system, a disposable diluent and a nucleic acid detection test strip, wherein the dual microsphere system comprises microsphere 1 and microsphere 2, wherein microsphere 1 comprises an RPA-LFD primer and probe combination, a recombinase that binds to single-stranded nucleic acid, a single-stranded DNA binding protein and a strand displacement DNA polymerase, and microsphere 2 comprises a rehydration buffer and a magnesium acetate solution.

[0009] Furthermore, the primer concentration is 1-20 μmol / L, and the probe concentration is 0.625-5 μmol / L.

[0010] Furthermore, the primer concentration was 10 μmol / L, and the probe concentration was 2.5 μmol / L.

[0011] The present invention also provides the use of any of the above primer and probe combinations or kits in any of the following:

[0012] A1) Application in the detection of infectious spleen and kidney necrosis virus for non-disease diagnosis purposes;

[0013] A2) Application in the preparation of infectious spleen and kidney necrosis virus detection products.

[0014] The present invention also provides a method for detecting infectious spleen and kidney necrosis virus for non-disease diagnosis purposes, using any of the above-mentioned kits for detection, and the method comprises the following steps:

[0015] S1. Extracting nucleic acid from the sample to be tested;

[0016] S2, adding 25 μL of the nucleic acid extracted in step S1 to the double microsphere system, and starting the reaction immediately after mixing, and obtaining the amplified product after the reaction is completed;

[0017] S3. After diluting the amplified product with a disposable diluent, the amplified product obtained in step S2 is analyzed with a nucleic acid detection test strip.

[0018] Furthermore, the amplification product is judged using a nucleic acid detection test strip: if bands appear on both the quality control line (C) and the detection line (T) on the test strip, it is positive; if a band appears on the quality control line (C) of the test strip but there is no band on the detection line (T), it is negative; if there is no band on the quality control line (C), the reaction is invalid.

[0019] Furthermore, the reaction temperature of the kit is 25-45°C, preferably 39°C; the reaction time is more than 10 min, preferably 15 min.

[0020] Beneficial effects:

[0021] (1) Save time: RPA reaction has low requirements on the purity of template nucleic acid and can be used in combination with commercially available rapid nucleic acid release agents, which can save time for extracting and purifying nucleic acids. Conventional PCR takes at least 1 hour to complete a reaction, while RPA amplification takes up to 30 minutes. The present invention can even detect as low as 10 1 The virus has a low copy / μL, which greatly shortens the time of nucleic acid amplification.

[0022] (2) Lower the reaction temperature: RPA can complete the experiment at a constant temperature of 25-45°C, which is much lower than the 60-95°C of PCR.

[0023] (3) Simple operation: The enzymes, RPA-LFD primer probe combination and buffer required for amplification are all made into freeze-dried microspheres. During amplification, it is only necessary to add the extracted nucleic acid into the double microsphere system and start the reaction after mixing. The detection method of the present invention has low professional and technical requirements for operators, is suitable for on-site detection in fisheries, and can also be used for scientific research on infectious spleen and kidney necrosis virus.

[0024] (4) Strong specificity: The probe sequence is added to the kit of the present invention to increase the specificity of the detection.

[0025] (5) High sensitivity and easy to interpret results: The sensitivity is comparable to or even higher than that of conventional PCR widely used in molecular testing laboratories; and the results can be directly observed through the test strips. If both the test line and the quality control line are colored, it can be determined that ISKNV is positive.

[0026] (6) Increasing the accuracy of detection results: The present invention performs multiple sequence alignment on four subgenotypes of ISKNV to which mandarin fish are susceptible, and utilizes the feature that RPA can tolerate a small amount of base mismatches between template and primer to optimize mutations of non-conserved bases in the target fragment of designed primers, thereby reducing the dimer structure formed between primers and probes. The designed primer and probe combination not only increases the detection rate of multiple subgenotypes of ISKNV, but also reduces the false positives caused by primer dimers, thereby generally improving the accuracy of the detection results. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0028] Figure 1 Primers and probes are optimized for position and point mutation on target genes.

[0029] Figure 2 Optimize the reaction conditions of the RPA-LFD detection system, including: (A) the effect of different probe concentrations on the RPA-LFD amplification effect; (B) the effect of different reaction temperatures on the RPA-LFD amplification effect; (C) the effect of different reaction times on the RPA-LFD amplification effect.

[0030] Figure 3 Results of RPA-LFD specificity assay.

[0031] Figure 4 The sensitivity of PCR and RPA-LFD was tested using pMD18-MCP plasmid, where: (A) PCR detection results; (B) RPA-LFD detection results.

[0032] Figure 5 Target fragments of four subgenotypes of ISKNV were synthesized to test the compatibility of RPA-LFD. DETAILED DESCRIPTION

[0033] The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.

[0034] In certain embodiments, the products are analyzed by 2% agarose gel electrophoresis.

[0035] In certain embodiments, the product is analyzed using a nucleic acid test strip: if bands appear on both the control line and the test line of the test strip, it is positive; if a band appears on the control line of the test strip but no band appears on the test line, it is negative; if there is no band on the control line, the reaction is invalid.

[0036] It should be noted that the DNA constant temperature rapid detection kit (product number: WLN8203KIT) and nucleic acid detection test strips (product number: WLFS8204) in the following examples were purchased from Weifang Anpu Future Biotechnology Co., Ltd., China. The 25 μL double microsphere system was customized by Suzhou Jinnuo Biomedical Technology Co., Ltd.

[0037] Example 1 Design and optimization of ISKNV RPA-LFD primer pairs and probe sequences

[0038] (1) Design of primer pairs and probe sequences

[0039] The invention downloads the gene sequences of major capsid protein (MCP) of four subgenotypes of ISKNV published on GenBank (AB104413.1, AY779031.1, KC775382.1, AY894343.1, AF371960, HQ317460.1, AB666339.1, ON743043.1, AB669096.1, HM067835.1), performs multiple sequence alignment by DNAMAN to confirm the design fragment, and then designs primer pairs and probe sequences by Primer Premier 5.0 according to the design principles of RPA primers and probes, and then performs sequence alignment analysis by BLAST to determine the specificity of the primer pairs and probes.

[0040] (2) Optimization of reverse primer and probe sequences

[0041] Since the RPA reaction has the ability to tolerate mismatches, that is, it can tolerate a small amount of base mismatches between the template and the primer or probe, this characteristic leaves a certain amount of room for modifying the primer and probe sequences. The present invention uses Primer Premier 5.0 software to compare and analyze the reverse primer and probe sequences one by one, and optimizes the bases according to the following principles: If there are three or more bases paired continuously, it is considered to be easy to form primer dimers, and base optimization should be performed; mismatches at the 5' end of the primer or in the middle of the primer have little effect on the RPA reaction, while mismatches at the 3' end of the primer have a greater effect on the RPA reaction, therefore, only modify the bases at the 5' end or in the middle of the primer; avoid modifying two adjacent bases continuously; after confirming the mismatched bases on the primer, perform mutation optimization on non-conserved bases in the target fragment as much as possible. Figure 1 As shown, the red bases on the primers are the bases artificially optimized by the present inventor.

[0042] The following are the optimized primer pairs and probe combinations (primer pairs and probes were synthesized by Qingke Biotechnology Co., Ltd.):

[0043]

[0044] The 5' end of the reverse primer ISKNV-R is connected with Biotin; the 5' end of the probe is labeled with carboxyfluorescein FAM, and the extension blocking group C3 Spacer is added to the 3' end. The 31st position of the probe sequence is not a base, but tetrahydrofuran (THF).

[0045] Example 2 Reaction system and condition optimization of ISKNV RPA-LFD

[0046] (1) Extraction of viral genomic DNA

[0047] The genomic nucleic acid of mandarin fish tissues (liver, spleen and kidney mixed samples) infected with ISKNV was extracted according to the instructions of the viral DNA / RNA extraction kit (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.), and finally eluted with 30 μL of DNase- and RNase-free water. The extracted DNA was stored at -20°C for later use.

[0048] (2) RPA-LFD reaction system

[0049] The reaction system is: 2μL forward primer (10μM), 2μL reverse primer (10μM), 0.6μL probe (10μM), 2μL DNA template (the template of the no-template control group is DEPC water), 11.5μL DEPC water and 29.4μL Abuffer are added to the reaction tube containing freeze-dried enzyme powder, 2.5μL of starting solution B buffer is added to the reaction tube cap, the tube cap is closed, centrifuged together, and vortexed to mix, to ensure consistent starting reaction time.

[0050] Result interpretation: Take 10 μL of the amplified product and dilute it with ddH2O to a total volume of 200 μL, then add 80 μL of the diluted product to the nucleic acid detection test strip for color development. The color development time should be controlled within 10 minutes.

[0051] Use nucleic acid test strips to analyze the amplified products: if bands appear on both the control line (C) and the test line (T) on the test strip, it is positive; if a band appears on the control line (C) but not on the test line (T), it is negative; if there is no band on the control line (C), the reaction is invalid.

[0052] (3) Optimization of probe concentration

[0053] The optimal initial probe concentration of RPA-LFD was explored. The initial probe concentrations were set to 10 μM, 5 μM, 2.5 μM, 1.25 μM and 0.625 μM, respectively. A corresponding no-template control group (i.e., the template was DEPC water) was set up at the same time, and the reaction was carried out at 39°C for 15 min. The results are shown in Figure 2 As shown in A, when the initial probe concentration is 10 μM, the corresponding no-template control group has a false positive band. When the initial probe concentration drops to 5 μM and below, the corresponding no-template control group presents a normal negative result. When the initial probe concentration is 2.5 μM, the detection band of the positive control group is basically the same as that at 5 μM. In order to avoid false positive results caused by excessively high probe concentrations, 2.5 μM is selected as the optimal initial concentration of the RPA-LFD probe.

[0054] (4) Reaction temperature optimization

[0055] To determine the optimal reaction temperature of the RPA-LFD method, eight different reaction temperatures were tested: 25°C, 30°C, 35°C, 37°C, 39°C, 41°C, 45°C, and 50°C, and the incubation time was set to 15 min. Figure 2 As shown in B, positive samples can be detected in the reaction temperature range of 25-45°C, and the positive band on the test strip detection line is clearest when the reaction temperature is 39°C. Therefore, the optimal reaction temperature of this method is about 39°C.

[0056] (5) Optimization of response time

[0057] To determine the optimal reaction time of the RPA-LFD method, six different reaction times were set at 39°C, namely 1 min, 5 min, 10 min, 15 min, 20 min and 25 min. The test results are shown in Figure 2 As shown in Figure C, a faint positive band appeared on the test strip at 5 minutes of reaction. When the reaction time is 10 minutes or more, a positive sample can be detected. In order to make the test results more stable, we chose 15 minutes as the reaction time for subsequent experiments.

[0058] Example 3 ISKNV RPA-LFD specific detection

[0059] ISKNV RPA-LFD specificity detection: The genomic nucleic acids of ISKNV, Mandarin fish iris virus (MRV), neural necrosis virus (NNV), Mandarin fish rhabdovirus (SCRV) and Aeromonas hydrophila were extracted and preserved by our laboratory. The nucleic acids of ISKNV, MRV, NNV, SCRV and Aeromonas hydrophila were used as templates to detect the specificity of RPA-LFD, and a no-template control group (NTC) was set up. The results are shown in Figure 2. Figure 3 As shown, only the reaction with ISKNV as template showed a positive band on the test line of the test strip, and other pathogens showed negative results, indicating that this method is specific for detecting ISKNV.

[0060] Example 4 ISKNV RPA-LFD sensitivity detection

[0061] (1) Construction of ISKNV-MCP plasmid:

[0062] The PCR primers for amplifying the ISKNV MCP gene are as follows:

[0063] Forward primer: 5'-CCAGCGGGTTCATCGACATCTCC-3'

[0064] Reverse primer: 5'-CGCCGTCAGCAATCTTCATGATG-3'

[0065] The reaction system was: 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), 1 μL template, 10 μL 2× Taq Master Mix (Nanjing Novogene Biotech Co., Ltd.) and 7 μL ddH2O.

[0066] The amplification program was pre-denaturation at 94°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 30 cycles; and extension at 72°C for another 10 min.

[0067] The PCR product was identified by electrophoresis in a 2% agarose gel. The PCR product was recovered using an agarose gel DNA recovery kit (purchased from Guangzhou Meiji Biotechnology Co., Ltd.), connected to the pMD18-T cloning vector (TAKARA), transformed into Escherichia coli competent cells DH5α (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), and then spread on an LB medium plate containing 100 mg / L ampicillin and cultured at 37°C for 12 hours. The positive single colony was screened into a liquid culture medium containing ampicillin and cultured overnight at 37°C. Finally, the plasmid was extracted using a plasmid mini-extraction kit (purchased from Tiangen Biochemical Technology Co., Ltd.), and the pMD18-MCP concentration extracted was sent to Qingke Biotechnology Co., Ltd. for sequencing as positive, and the extracted pMD18-MCP plasmid concentration was measured using a Nanodrop-2000 spectrophotometer.

[0068] According to the copy number calculation formula: copies / μL = 6.02×10 23 ×Plasmid concentration (ng / μL)×10 -9 / (plasmid base number × 660), calculate the copy number of the extracted recombinant plasmid pMD18-MCP, and dilute it to 10 7 copies / μL. 7 The plasmid with 10 copies / μL was diluted tenfold, and the copy number was 10 7 ~10 0 The following reaction was performed using 1000 copies / μL of plasmid as a template.

[0069] (2) RPA-LFD reaction using plasmid as template

[0070] The reaction system is: 2μL forward primer (10μM), 2μL reverse primer (10μM), 0.6μL probe (2.5μM), 2μL plasmid template, 11.5μL DEPC water and 29.4μL Abuffer are added to the reaction tube containing freeze-dried enzyme powder, 2.5μL of starter B buffer is added to the reaction tube cap, the tube cap is closed, centrifuged together, and vortexed to mix to ensure consistent start reaction time. Amplification reaction is carried out at 39°C for 15min.

[0071] Result interpretation: Take 10 μL of the amplified product and dilute it with ddH2O to a total volume of 200 μL, then add 80 μL of the diluted product to the nucleic acid detection test strip for color development, and the color development time is controlled within 10 minutes.

[0072] Use nucleic acid test strips to analyze the amplified products: if bands appear on both the control line (C) and the test line (T) on the test strip, it is positive; if a band appears on the control line (C) but not on the test line (T), it is negative; if there is no band on the control line (C), the reaction is invalid.

[0073] (3) Conventional PCR detection using plasmid as template

[0074] The PCR primer pair used is the primer pair used in the industry standard "Infectious Spleen and Kidney Necrosis Virus Detection Method" (SC / T 7211-2011), and the nucleotide sequence is as follows:

[0075] ISKNV-F: 5'-CGTGAGACCGTGCGTAGT-3'

[0076] ISKNV-R: 5'-AGGGTGACGGTCGATATG-3'

[0077] The reaction system was: 1 μL forward primer, 1 μL reverse primer, 1 μL template, 10 μL 2× Taq Master Mix (Nanjing Novogene Biotech Co., Ltd.) and 7 μL ddH2O.

[0078] Amplification program: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 61°C for 45 s, extension at 72°C for 1 min, 30 cycles; and extension at 72°C for another 7 min.

[0079] Finally, the PCR products were identified by electrophoresis in 2% agarose gel.

[0080] Test results such as Figure 4 As shown, the detection limit of PCR is 10 3 copies / μL, while RPA-LFD can detect a concentration of 10 1 copies / μL of ISKNV, which is two orders of magnitude more sensitive than the PCR method.

[0081] In summary, the RPA-LFD detection method and primer probe for ISKNV established in the present invention have high sensitivity.

[0082] Example 5 ISKNV RPA-LFD compatibility test for four subgenotypes

[0083] In order to improve the convenience of using the detection kit in fisheries, the optimized detection reagents were integrated into freeze-dried double microspheres for testing. The double microsphere reaction system is: microsphere 1: contains 10μmol / L forward primer, 10μmol / L reverse primer, 2.5μmol / L probe, recombinase binding to single-stranded nucleic acid, single-stranded DNA binding protein and strand displacement DNA polymerase; microsphere 2: contains rehydration buffer and magnesium acetate solution. The reaction only needs to add 2μL of purified nucleic acid and 23μL of DEPC water, or directly add 25μL of the supernatant of the rapid nucleic acid release product, mix well and start the reaction at 39°C.

[0084] (1) Synthesis of four ISKNV subgenotype MCP target fragments and construction of plasmids

[0085] The pUC57 plasmids containing the four ISKNV subgenotype MCP target fragments (synthesized at Qingke Biotechnology Co., Ltd.) were diluted to 1 ng / μL as test samples, and DEPC water was used as a template for the no-template control group. The nucleotide sequence information of the four ISKNV subgenotype MCP target fragments is as follows:

[0086] AF371960 (ISKNV-Ⅰ):

[0087] AAGCTGCGGCGCTGGGAGGACCTGCTCATCAGCCAGAGCAACCAGGCCGACATGGCCATATCGACCGTCACCCTGGCTAACATTGGCAATGTAGCACCCGCACTGACCAATGTGTCTGTGATGGGCACTTACGCTGTACTGACAAGCGAGGAGCGTGAGGTGGTGGCCCAGTCTAGTCGTAGCATGCTCATTGAACAGTG

[0088] AB669096.1 (ISKNV-Ⅱ):

[0089] AAGCTGCGGCGCTGGGAGGACCTGCTCATCAGCCAGAGCAGCCAGGCCGACATGGCCATATCAACCGTCACCCTGGCTAACATTGGCAATGTAGCACCTGCACTAACCAATGTGTCTGTGATGGGCACTTACGCTGTGCTGACAAGCGAGGAGCGTGAGGTGGTGGCCCAGTCTAGTCGTAGCATGCTCATTGAACAGTG

[0090] AB104413.1(RSIV-Ⅰ):

[0091] AAGCTGCGGCGCTGGGAGGACCTGCTCATCAGCCAGAGCACCCAGGCTGACATGGCCATATCGACTGTCACCGTGGCTAACATTGGCAATGTAACACCCGCACTGACCAACGTGTCCGTGATGGGCACCTACGCCGTACTGACAAGTGAGGAGCGTGAGGTCGTGGCCCAGTCTAGCCGTAGCATGCTCATTGAACAGTG

[0092] AY894343.1(RSIV-Ⅱ):

[0093] AAGCTGCGGCGCTGGGAGGACCTGCTCATCAGCCAGAGCACCCAGGCCGACATGGCCATATCGACTGTCACCCTGGCTAACATTGGCAATGTAGCACCCGCACTGACCAACGTGTCCGTGATGGGCACCTACGCTGTACTGACAAGTGAGGAGCGTGAGGTTGTGGCCCAGTCTAGCCGTAGCATGCTCATTGAGCAGTG

[0094] (2) RPA-LFD reaction using four ISKNV subgenotype plasmids as templates

[0095] Add 2 μL of template plasmid to 23 μL of DEPC water, mix well, then add to 25 μL of double microsphere system, shake and mix well, and react at 39°C for 15 min.

[0096] Interpretation of results: Take 10μL of the amplified product and dilute it with ddH2O to a total volume of 200μL, then add 80μL of the diluted product to the nucleic acid test strip for color development, and the color development time is controlled within 10min. Use the nucleic acid test strip to analyze the amplified product: if the quality control line (C) and the test line (T) on the test strip appear at the same time, it is positive; if the quality control line (C) of the test strip appears a band, but the test line (T) has no band, it is negative; if there is no band on the quality control line (C), the reaction is invalid.

[0097] The results are as follows Figure 5 As shown, the four ISKNV subgenotypes can all produce positive bands, indicating that the primer and probe combination of the present invention is compatible with the detection of the four subgenotypes of ISKNV, which not only increases the detection rate of multiple subgenotypes of ISKNV, but also reduces the false positives caused by primer dimers, thereby generally improving the accuracy of the detection results.

[0098] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. An RPA-LFD primer and probe combination for detecting infectious spleen and kidney necrosis virus and its subtypes, characterized in that: The primers include: forward primer ISKNV-F: CTCATCAGCCAGAGCAACCAGG CCGACA, reverse primer ISKNV-R: CCTCAACCTCACGCTCCTCCCTTCTCAGTA; the probe includes probe ISKNV-P: TGGCCATATCGACCGTCACCATGGCTAACA / TH F / TGGCAATGTAGCACCCG.

2. The primer and probe combination according to claim 1, wherein the 5' end of the reverse primer ISKN VR is connected to Biotin, the 5' end of the probe is labeled with carboxyfluorescein FAM, the 3' end is added with an extension blocking group C3 Spacer, and the 31st position of the probe sequence is not a base but tetrahydrofuran (THF).

3. A kit for detecting infectious spleen and kidney necrosis virus and its subtypes, characterized in that: Comprising the primer and probe combination described in any one of claims 1-2.

4. The kit according to claim 3, characterized in that The kit comprises a double microsphere system, a disposable diluent and a nucleic acid detection test strip, wherein the double microsphere system comprises microsphere 1 and microsphere 2, wherein microsphere 1 comprises an RPA-LFD primer and probe combination, a recombinase binding to single-stranded nucleic acid, a single-stranded DNA binding protein and a strand displacement DNA polymerase, and microsphere 2 comprises a rehydration buffer and a magnesium acetate solution.

5. The kit according to any one of claims 3-4, characterized in that The primer concentration was 1-20 μmol / L, and the probe concentration was 0.625-5 μmol / L.

6. The kit according to claim 5, characterized in that The primer concentration was 10 μmol / L, and the probe concentration was 2.5 μmol / L.

7. Use of the primer and probe combination according to any one of claims 1 to 2 or the kit according to any one of claims 3 to 6 in any of the following: A1) Application in the detection of infectious spleen and kidney necrosis virus for non-disease diagnosis purposes; A2) Application in the preparation of infectious spleen and kidney necrosis virus detection products.

8. A method for detecting infectious spleen and kidney necrosis virus for non-disease diagnosis purposes, characterized in that: The method of detecting using the kit according to any one of claims 4 to 6 comprises the following steps: S1. Extracting nucleic acid from the sample to be tested; S2, adding 25 μL of the nucleic acid extracted in step S1 to the double microsphere system, and starting the reaction immediately after mixing, and obtaining the amplified product after the reaction is completed; S3. After diluting the amplified product with a disposable diluent, the amplified product obtained in step S2 is analyzed with a nucleic acid detection test strip.

9. The method according to claim 8, characterized in that Use nucleic acid test strips to determine the amplification product: if bands appear on both the control line (C) and the test line (T) on the test strip, it is positive; if a band appears on the control line (C) but no band appears on the test line (T), it is negative; if there is no band on the control line (C), the reaction is invalid.

10. The method according to any one of claims 8-9, characterized in that: The reaction temperature of the kit is 25-45°C, preferably 39°C; the reaction time is more than 10 minutes, preferably 15 minutes.

Images