Cationic lipid nanoparticle with high transfection efficiency and preparation method thereof

Abstract

The invention relates to a nucleic acid-loaded calcium-containing cationic lipid nanoparticle, which comprises a cationic lipid, a neutral lipid, a PEGylated lipid and cholesterol and / or cholesteryl ester. The cationic lipid nanoparticles can be used for preparing gene drugs for local injection into the body or nucleic acid vaccines for local or whole-body injection into the body.

Description

Cationic lipid nanoparticles with high transfection efficiency and preparation method thereof Technical Field

[0001] The present invention relates to calcium-containing cationic lipid nanoparticles and a preparation method thereof, particularly calcium-containing cationic lipid nanoparticles containing calcium ions in their inner core for nucleic acid loading. The calcium-containing cationic lipid nanoparticles disclosed in the present invention for nucleic acid loading have the characteristics of high transfection efficiency and specific targeting to the liver organ. Background Art

[0002] Gene therapy refers to the introduction of exogenous genes (DNA or RNA) into target cells to correct or compensate for diseases caused by defective and abnormal genes in order to achieve therapeutic purposes. Gene therapy is divided into in vivo and in vitro treatments. In vivo treatment refers to the direct application of genes in vivo to deliver genes to target cells in vivo, while in vitro treatment refers to the transfer of modified genes into cells in vitro to give the cells new characteristics, and then the modified cells are introduced into the body. Different from chemical drugs and protein drugs, gene therapy has clear and controllable targets and a single dose is effective for a long time. In the past few decades, gene therapy has made significant progress in the treatment of previously untreatable genetic diseases, including tumor cell therapy, gene therapy for genetic diseases, and infectious disease prevention and control, among other major disease treatment areas.

[0003] However, due to the ubiquitous nucleases in the body, the in vivo stability of the gene itself is extremely poor, and because the gene is a negatively charged macromolecule, it is difficult to enter the cell and escape from the inclusion body, thus limiting the widespread application of gene therapy drugs. The development of suitable gene delivery methods plays a key role in the successful application of gene therapy. At present, the delivery of genes mainly includes physical methods, chemical methods and viral vector delivery. Among them, physical methods mainly include tools such as electrofection and gene guns, which are suitable for in vitro transfection or gene delivery of small amounts and specific parts in the body, and large-scale application is limited. Viral delivery vectors are one of the most commonly used tools for gene delivery in vitro and in vivo. Several viral vector gene therapy drugs have been marketed or used in clinical research, including adeno-associated viruses and lentiviruses. However, due to the risk of random insertion of viral vector-delivered genes into the genome in vivo, leading to carcinogenesis, the size limit of the delivered genes (adeno-associated viruses generally do not exceed 5kb, lentiviruses 8kb), immunogenicity and the high cost of production quality control, it is difficult to be widely used in gene therapy. Chemical delivery methods for gene therapy mainly use non-viral vectors or chemical modification of nucleic acids. siRNA is usually modified with GalNac-ESC to achieve liver-targeted delivery of siRNA. However, for long-chain mRNA and DNA, it is difficult to achieve targeted and stable delivery simply through chemical modification. Therefore, the development of non-viral vectors for gene therapy is a current key research area.

[0004] Non-viral vectors used for gene delivery primarily include lipid nanocarriers, polymer carriers, peptide delivery carriers, and inorganic nanoparticle carriers. Due to their immunogenicity, poor delivery efficiency, or toxicity, no marketed gene therapy products have successfully used these carriers. Currently, all marketed gene therapy products utilize non-viral vectors based on lipid nanoparticle (LNP) technology, including the siRNA drug approved by the FDA in 2018 for the treatment of polyneuropathy (trade name Onpattro) and the COVID-19 mRNA vaccines launched in the past two years (trade names COMIRNATY and Spikevax, respectively). Their gene delivery efficiency and safety have been fully validated in clinical trials. Marketed LNPs are composed of four components: ionizable cationic lipids, neutral phospholipids, cholesterol, and PEGylated lipids. Ionizable cationic lipids are used to interact with negatively charged genes under acidic conditions to achieve high gene encapsulation. In a neutral environment, they primarily exist in the LNP core in a non-ionized form, giving the LNP a near-neutral surface, thereby avoiding positive charge-mediated toxicity and ensuring rapid clearance. They also interact with the endosomal membrane during endosomal acidification to mediate endosomal escape. Neutral lipids and cholesterol are primarily present in the LNP outer layer, and PEGylated lipids prevent LNP aggregation. However, current research indicates that after LNP entry into cells, less than 5% of the total genes achieve endosomal escape, resulting in very low gene transfection efficiency and hindering the application of LNPs as gene therapy vectors.

[0005] Ca 2+ It has been reported to have the effect of destabilizing endosomal membranes. When a large amount of Ca is added to the cell culture environment, 2+ Calcium phosphate precipitation has been reported to increase the gene transfection efficiency of lipid nanoparticles. Calcium phosphate precipitation is a classic in vitro gene transfection method, first proposed in 1973 and still one of the most commonly used methods for in vitro gene transfection. However, calcium phosphate precipitation cannot control the size and extent of the precipitate formed, resulting in a high tendency to aggregate. Transfection efficacy is greatly affected by experimental conditions, resulting in poor reproducibility and inability to be applied to in vivo gene delivery. Developing various calcium-containing nanoparticles based on this method is an important development direction for inorganic nanoparticles. Polymers or lipids are modified on the surface of the resulting calcium phosphate or calcium carbonate gene co-precipitate to stabilize the precipitate and prevent aggregation, but these carriers still have significant stability and safety issues. Other studies have used negatively charged phospholipids such as phosphatidylserine, phosphatidylglycerol, or phosphatidic acid as phosphate precipitates, but these calcium precipitates also face challenges in controlling particle size and stability, and have not yet achieved stable gene transfection.

[0006] In this study, lipid nanocarriers were used to encapsulate Ca 2+It can achieve stable and efficient encapsulation of genes, with controllable particle size, and its in vivo and in vitro transfection efficiency is significantly higher than that of LNP for gene delivery, without obvious toxic effects.

[0007] Summary of the Invention

[0008] The present invention relates to calcium-containing cationic lipid nanoparticles and methods for preparing the same, particularly calcium-containing cationic lipid nanoparticles containing calcium ions in their inner cores for nucleic acid loading. The calcium-containing cationic lipid nanoparticles disclosed herein for nucleic acid loading have high transfection efficiency and specific targeting to the liver. The present invention is achieved through the following technical solutions:

[0009] Aspect 1. A calcium-containing cationic lipid nanoparticle for loading nucleic acids, characterized in that the inner core of the cationic lipid nanoparticle contains non-precipitated calcium ions.

[0010] Aspect 2. The calcium-containing cationic lipid nanoparticles as described in Aspect 1 are characterized in that the concentration of calcium in the entire preparation is 0.1-150 mmol / L; preferably 1-10 mmol / L, 10-100 mmol / L or 100-150 mmol / L; more preferably 1-10 mmol / L, 10-30 mmol / L, 30-50 mmol / L, 50-70 mmol / L, 70-90 mmol / L, 90-110 mmol / L, 110-130 mmol / L or 130-150 mmol / L.

[0011] Aspect 3. The calcium-containing cationic lipid nanoparticles according to Aspect 1, characterized in that the local concentration of calcium in the inner core is 50 to 800 mmol / L;

[0012] Preferably, it is 50-100 mmol / L, 100-200 mmol / L, 200-400 mmol / L, 400-800 mmol / L;

[0013] More preferably, it is 50-100mmol / L, 100-150mmol / L, 150-200mmol / L, 200-250mmol / L, 250-300mmol / L, 350-400mmol / L, 400-450mmol / L, 450-500mmol / L, 500-550mmol / L, 550-600mmol / L, 600-650mmol / L, 650-700mmol / L, 700-750mmol / L, or 750-800mmol / L.

[0014] Aspect 4. The calcium-containing cationic lipid nanoparticles as described in Aspect 1 or 2 are characterized in that the molar ratio of non-precipitated calcium ions to lipids in the inner core of the lipid particles is 1:(0.01~20), preferably 1:(0.1~10), preferably 1:(1~10), or preferably 1:(0.1~1).

[0015] Aspect 5. The calcium-containing cationic lipid nanoparticles according to any of the preceding aspects are characterized in that the calcium ions come from calcium salts, preferably soluble calcium salts, further preferably calcium acetate, calcium chloride, calcium sodium EDTA, calcium gluconate, calcium dihydrogen phosphate, calcium nitrate, calcium bicarbonate, calcium bisulfate, calcium bisulfite, calcium bromide, calcium iodide, calcium citrate, calcium lactate, calcium gluconate, further preferably calcium acetate, calcium sodium EDTA, calcium gluconate, calcium citrate, calcium lactate, calcium gluconate, further preferably calcium acetate.

[0016] Aspect 6. The calcium-containing cationic lipid nanoparticle according to any of the preceding aspects, characterized in that the calcium ions are derived from a calcium salt solution having a concentration of 50 mmol / L to 1000 mmol / L; preferably, the calcium ions are derived from a calcium salt solution having a concentration of 50 to 150 mmol / L, a calcium salt solution having a concentration of 150 to 300 mmol / L, a calcium salt solution having a concentration of 300 to 500 mmol / L, or a calcium salt solution having a concentration of 500 to 800 mmol / L;

[0017] More preferably, the calcium ions come from a calcium salt solution having a concentration of 100±50mmol / L, a calcium salt solution of 200±50mmol / L, a calcium salt solution of 300±50mmol / L, a calcium salt solution of 400±50mmol / L, a calcium salt solution of 500±50mmol / L, a calcium salt solution of 600±50mmol / L, a calcium salt solution of 700±50mmol / L, a calcium salt solution of 800±50mmol / L or a calcium salt solution of 900±50mmol / L.

[0018] Aspect 7. The calcium-containing cationic lipid nanoparticles according to any of the preceding aspects are characterized in that the calcium ions exist in the form of calcium ions in the aqueous solution of the inner core.

[0019] Aspect 8. The calcium-containing cationic lipid nanoparticles as described in any of the preceding aspects are characterized in that the substance delivered by the calcium-containing cationic lipid nanoparticles is nucleic acid, preferably plasmid DNA, single-stranded DNA, double-stranded DNA, siRNA, shRNA, aiRNA, miRNA, mRNA, circular RNA, tRNA, rRNA, vRNA, gRNA, aptamer, ribozyme, oligonucleotide or any combination thereof.

[0020] Aspect 9. The calcium-containing cationic lipid nanoparticles as described in any of the preceding aspects are characterized in that the molar number of phosphate groups of nucleic acid: the molar number of positive charge of cationic lipid is 1:(0.5~20), preferably 1:(1~10), more preferably 1:(1.5~6), and more preferably 1:(1.5~3) or 1:(3~6).

[0021] Aspect 10. The calcium-containing cationic lipid nanoparticles according to any of the preceding aspects, characterized in that the nucleic acid:lipid mass ratio is 1:(1-100), preferably 1:(5-90), more preferably 1:(10-70), and further preferably 1:(10-30).

[0022] Aspect 11. The calcium-containing cationic lipid nanoparticles according to any of the preceding aspects, characterized in that the length of the substance delivered by the calcium-containing cationic lipid nanoparticles is about 15 to 30,000 base pairs; preferably 15 to 60, 60 to 120, 120 to 250, 250 to 500, 500 to 1000, 1000 to 2000, 2000 to 4000, 4000 to 8000, 8000 to 15000, 15000 to 20000, 20000 to 25000, 25000 to 30000 base pairs; more preferably 15 to 60, 15 to 50, 15 to 40, 15 to 30 0, 15-25, 19-25, 20-30, 20-50, 20-80, 30-50, 30-80, 30-120, 50-100, 50-150, 50-250, 100-200, 100-300, 100-500, 200-500, 200-1000, 300-800, 300-1500, 1000-3000, 1000-5000, 1000-8000, 5000-10000, 5000-15000, 5000-20000, 10000-25000, 10000-30000 base pairs.

[0023] Aspect 12. The calcium-containing cationic lipid nanoparticles according to any of the preceding aspects, characterized in that the amount of loaded nucleic acid is 5 μg / ml to 10 mg / ml;

[0024] Preferably, the amount of the loaded nucleic acid is 5 μg / ml to 10 μg / ml, 10 μg / ml to 20 μg / ml, 20 μg / ml to 40 μg / ml, 40 μg / ml to 80 μg / ml, 80 μg / ml to 150 μg / ml, 150 μg / ml to 300 μg / ml, 300 μg / ml to 400 μg / ml, 400 μg / ml to 800 μg / ml, 800 μg / ml to 1 mg / ml, 1 mg / ml to 1.5 mg / ml, 1.5 mg / ml to 2 mg / ml, 2 mg / ml to 4 mg / ml, 4 mg / ml to 6 mg / ml, 6 mg / ml to 8 mg / ml or 8 mg / ml to 10 mg / ml;

[0025] More preferably, the amount of nucleic acid loaded is 50±50 μg / ml, 100±50 μg / ml, 200±50 μg / ml, 300±50 μg / ml, 400±50 μg / ml, 500±50 μg / ml, 600±50 μg / ml, 700±50 μg / ml, 800±50 μg / ml, 900±50 μg / ml, 1000±50 μg / ml, 1 500±50μg / ml, 2000±50μg / ml, 2500±50μg / ml, 3000±50μg / ml, 4000±50μg / ml, 5000±50 μg / ml, 6000±50μg / ml, 7000±50μg / ml, 8000±50μg / ml, 9000±50μg / ml, 10000±50μg / ml.

[0026] Aspect 13. The calcium-containing cationic lipid nanoparticles according to any one of the preceding aspects, characterized in that the lipids constituting the cationic lipid nanoparticles include a combination of one or more of the following groups: ionizable cationic lipids, cholesterol and / or cholesterol esters, neutral lipids, and PEGylated lipids;

[0027] Preferably, the lipids constituting the cationic lipid nanoparticles include the following lipids:

[0028] (1) Cationic lipids: The cationic lipids are selected from ionizable cationic lipids;

[0029] (2) Cholesterol lipids: the cholesterol lipids are selected from cholesterol and / or cholesterol esters;

[0030] (3) neutral lipids: the neutral lipids are selected from phospholipids, fatty acid glycerides or glycolipids or any combination thereof; and

[0031] Optional (4) PEGylated lipids;

[0032] More preferably, the lipids constituting the cationic lipid nanoparticles include:

[0033] (1) Cationic lipids: The cationic lipids are selected from ionizable cationic lipids;

[0034] (2) Cholesterol lipid: the cholesterol lipid is selected from cholesterol;

[0035] (3) neutral lipids: the neutral lipids are selected from phospholipids; and

[0036] Optional (4) PEGylated lipid.

[0037] Aspect 14. The calcium-containing cationic lipid nanoparticles according to any one of the preceding aspects, characterized in that the lipids constituting the cationic lipid nanoparticles include a combination of the following groups in a molar ratio:

[0038] (1) Cationic lipids: 1%-90%,

[0039] (2) Cholesterol lipids: 1%-90%,

[0040] (3) Neutral lipids: 1%-90%,

[0041] (4) PEGylated lipids: 0.1%-20%.

[0042] Aspect 15. The calcium-containing cationic lipid nanoparticles according to any of the preceding aspects, characterized in that the cationic lipid nanoparticles do not contain negatively charged lipids modified with non-PEG groups.

[0043] Aspect 16. The calcium-containing cationic lipid nanoparticles according to any one of the preceding aspects, characterized in that the cationic lipid is selected from ionizable cationic lipids; preferably, the ionizable cationic lipid is selected from DSDMA, DLinDMA, DLenDMA, DODMA, A6, OF-02, A18-Iso5-2DC18, 98N 12 -5, 9A1P9, C12-200, cKK-E12, 7C1, G0-C14, L319, 304O 13 , OF-Deg-Lin, 306-O12B, 306O i10 , FTT5, SM102, ALC-0315, A9, Lipid 2, 2(8,8)4CCH3, CL1, LP01, DLin-MC3-DMA or an analog of any of the foregoing cationic lipids.

[0044] Aspect 17. The calcium-containing cationic lipid nanoparticles according to any of the preceding aspects are characterized in that the neutral phospholipids are selected from one or more of egg yolk lecithin, soybean lecithin, hydrogenated soybean lecithin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, distearoylphosphatidylcholine, dimyristoylphosphatidylcholine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylethanolamine, dimyristoylphosphatidylethanolamine, dipalmitoylphosphatidylethanolamine, dioleoylphosphatidylethanolamine, distearoylphosphatidylinositol, dimyristoylphosphatidylinositol, dipalmitoylphosphatidylinositol, dioleoylphosphatidylethanolamine, 9A1P9, 10A1P10; preferably one or more of phosphatidylcholine, egg yolk lecithin, soybean lecithin, hydrogenated soybean lecithin and phosphatidylethanolamine.

[0045] Aspect 18. The calcium-containing cationic lipid nanoparticles according to any of the preceding aspects, characterized in that the PEGylated lipid is selected from methoxy polyethylene glycol-distearoylphosphatidylethanolamine (mPEG-DSPE), methoxy polyethylene glycol-dioleoylphosphatidylethanolamine (mPEG-DOPE), methoxy polyethylene glycol-dipalmitoylphosphatidylethanolamine (mPEG-DPPE), polyethylene glycol-dilauroylglycerol (PEG-DAG), polyethylene glycol-dimyristoylglycerol (PEG-DMG), polyethylene glycol-dipalmitoylglycerol (PEG-DPG), polyethylene glycol-distearoylglycerol (PEG-D SG), polyethylene glycol-dioleoylglycerol (PEG-DOG), polyethylene glycol-dilinoleoylglycerol (PEG-DLinG), polyethylene glycol-bislauroylpropylamide (PEG-DAA), polyethylene glycol-bismyristoylpropylamide (PEG-DMA), polyethylene glycol-bispalmitoylpropylamide (PEG-DPA), polyethylene glycol-bisoleoylpropylamide (PEG-DOA), polyethylene glycol-bislinoleoylpropylamide (PEG-DLinA), polyethylene glycol-ceramide (PEG-ceramide), stearoyl polyethylene glycol ester, vitamin E polyethylene glycol succinate (TPGS) and any combination thereof;

[0046] wherein PEG is a PEG group having a degree of polymerization selected from 3 to 100; preferably, PEG is a PEG group having a degree of polymerization selected from 3 to 50 or 50 to 100; more preferably, PEG is a PEG group having a degree of polymerization selected from 3 to 10, 10 to 20, 20 to 30, 30 to 40, 40 to 50, 50 to 60, 60 to 70, 70 to 80, 80 to 90 or 90 to 100; more preferably, PEG is a PEG group having a degree of polymerization selected from about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95 or about 100.

[0047] Aspect 19. The calcium-containing cationic lipid nanoparticles according to any of the preceding aspects, characterized in that: the particle size of the calcium-containing cationic lipid nanoparticles is 25-1000 nm; preferably, the particle size of the lipid nanoparticles is 25-500 nm or 500-1000 nm; more preferably, the particle size of the lipid nanoparticles is 25-75 nm, 75-125 nm, 125-175 nm, 175-225 nm, 225-275 nm, 275-350 nm, 350 nm-500 nm, 500-800 nm or 800-1000 nm; more preferably, Preferably, the particle size of the liposome nanoparticles is 40±10 nm, 50±10 nm, 60±10 nm, 70±10 nm, 80±10 nm, 90±10 nm, 100±10 nm, 110±10 nm, 120±10 nm, 125±10 nm, 130±10 nm, 140±10 nm, 150±10 nm, 160±10 nm, 170±10 nm, 180±10 nm, 190±10 nm, 200±10 nm, 210±10 nm, 220±10 nm or 250±10 nm.

[0048] Aspect 20. The calcium-containing cationic lipid nanoparticles according to any of the preceding aspects are characterized in that the nucleic acid encapsulation efficiency of the calcium-containing cationic lipid nanoparticles is >30%; preferably >40%; preferably >50%; preferably >60%; preferably >70%; preferably >80%; preferably >90%; more preferably >95%; more preferably >97%; more preferably >98%.

[0049] Aspect 21. The calcium-containing cationic lipid nanoparticles according to any one of the preceding aspects, characterized in that the calcium-containing cationic lipid nanoparticles are selected from the following nanoparticle preparations:

[0050] siRNA-loaded cationic lipid nanoparticles using cationic lipids (preferably DLin-MC3-DMA), cholesterol, neutral phospholipids (preferably DSPC), PEGylated lipids (preferably PEG2000-DMG) as lipids and calcium acetate as a calcium ion source;

[0051] Calcium-containing cationic lipid nanoparticles loaded with mRNA using cationic lipids (preferably DLin-MC3-DMA), cholesterol, neutral phospholipids (preferably DSPC), PEGylated lipids (preferably PEG2000-DMG) as lipids and calcium acetate as a calcium ion source;

[0052] DNA-loaded calcium-containing cationic lipid nanoparticles are prepared using cationic lipids (preferably DLin-MC3-DMA), cholesterol, neutral phospholipids (preferably DSPC), and PEGylated lipids (preferably PEG2000-DMG) as lipids and calcium acetate as a calcium ion source.

[0053] Aspect 22. The calcium-containing cationic lipid nanoparticles according to any of the preceding aspects, characterized in that the calcium-containing cationic lipid nanoparticles can enhance the transfection efficiency of the loaded nucleic acid.

[0054] Aspect 23. The calcium-containing cationic lipid nanoparticles according to any of the preceding aspects, characterized in that the calcium-containing cationic lipid nanoparticles have a targeting effect on the liver, lungs or spleen.

[0055] Aspect 24. A calcium-containing cationic lipid nanoparticle composition, characterized in that it comprises lipid nanoparticles containing non-precipitated calcium ions in the inner core, cationic lipid nanoparticles loaded with nucleic acids, and / or cationic lipid nanoparticles optionally loaded with nucleic acids and containing non-precipitated calcium ions in the inner core.

[0056] Aspect 25. The calcium-containing cationic lipid nanoparticle composition as described in Aspect 24 is characterized in that the concentration of calcium in the entire preparation is 0.1-150 mmol / L; preferably 1-10 mmol / L, 10-100 mmol / L or 100-150 mmol / L; more preferably 1-10 mmol / L, 10-30 mmol / L, 30-50 mmol / L, 50-70 mmol / L, 70-90 mmol / L, 90-110 mmol / L, 110-130 mmol / L or 130-150 mmol / L.

[0057] Aspect 26. The calcium-containing cationic lipid nanoparticle composition according to any one of aspects 24-25, characterized in that the local concentration of calcium in the inner core is 50 to 800 mmol / L;

[0058] Preferably, it is 50-100 mmol / L, 100-200 mmol / L, 200-400 mmol / L, 400-800 mmol / L;

[0059] More preferably, it is 50-100mmol / L, 100-150mmol / L, 150-200mmol / L, 200-250mmol / L, 250-300mmol / L, 350-400mmol / L, 400-450mmol / L, 450-500mmol / L, 500-550mmol / L, 550-600mmol / L, 600-650mmol / L, 650-700mmol / L, 700-750mmol / L, or 750-800mmol / L.

[0060] Aspect 27. The calcium-containing cationic lipid nanoparticle composition as described in any one of Aspects 24-26 is characterized in that the molar ratio of non-precipitated calcium ions in the inner core of the lipid particles to all lipids contained in the composition is 1:(0.01~20), preferably 1:(0.1~10), preferably 1:(1~10), or preferably 1:(0.1~1).

[0061] Aspect 28. The calcium-containing cationic lipid nanoparticle composition as described in any one of Aspects 24-27 is characterized in that the calcium ions come from calcium salts, preferably soluble calcium salts, more preferably calcium acetate, calcium chloride, calcium sodium EDTA, calcium gluconate, calcium dihydrogen phosphate, calcium nitrate, calcium bicarbonate, calcium bisulfate, calcium bisulfite, calcium bromide, calcium iodide, calcium citrate, calcium lactate, calcium gluconate, further preferably calcium acetate, calcium sodium EDTA, calcium gluconate, calcium citrate, calcium lactate, calcium gluconate, further preferably calcium acetate.

[0062] Aspect 29. The calcium-containing cationic lipid nanoparticle composition according to any one of aspects 24 to 28, characterized in that the calcium ions are derived from a calcium salt solution having a concentration of 50 mmol / L to 1000 mmol / L; preferably, the calcium ions are derived from a calcium salt solution having a concentration of 50 to 150 mmol / L, a calcium salt solution having a concentration of 150 to 300 mmol / L, a calcium salt solution having a concentration of 300 to 500 mmol / L, or a calcium salt solution having a concentration of 500 to 800 mmol / L;

[0063] More preferably, the calcium ions come from a calcium salt solution having a concentration of 100±50mmol / L, a calcium salt solution of 200±50mmol / L, a calcium salt solution of 300±50mmol / L, a calcium salt solution of 400±50mmol / L, a calcium salt solution of 500±50mmol / L, a calcium salt solution of 600±50mmol / L, a calcium salt solution of 700±50mmol / L, a calcium salt solution of 800±50mmol / L or a calcium salt solution of 900±50mmol / L.

[0064] Aspect 30. The calcium-containing cationic lipid nanoparticle composition according to any one of aspects 24 to 29, characterized in that the substance delivered by the calcium-containing cationic lipid nanoparticle composition is a nucleic acid, preferably plasmid DNA, single-stranded DNA, double-stranded DNA, siRNA, shRNA, aiRNA, miRNA, mRNA, circular RNA, tRNA, rRNA, vRNA, gRNA, aptamer, ribozyme, oligonucleotide or any combination thereof;

[0065] Preferably, the molar number of phosphate groups of nucleic acids: the molar number of positive charges of all cationic lipids contained in the composition is 1: (0.5-20), preferably 1: (1-10), more preferably 1: (1.5-6), more preferably 1: (1.5-3) or 1: (3-6); more preferably, the nucleic acid: lipid mass ratio is 1: (1-100), preferably 1: (5-90), more preferably 1: (10-70), and further preferably 1: (10-30).

[0066] Aspect 31. The calcium-containing cationic lipid nanoparticle composition according to any one of aspects 24-30, characterized in that the length of the substance delivered by the calcium-containing cationic lipid nanoparticles is about 15 to 30,000 base pairs; preferably 15 to 60, 60 to 120, 120 to 250, 250 to 500, 500 to 1000, 1000 to 2000, 2000 to 4000, 4000 to 8000, 8000 to 15000, 15000 to 20000, 20000 to 25000, 25000 to 30000 base pairs; more preferably 15 to 60, 15 to 50, 15 to 40, 1 5-30, 15-25, 19-25, 20-30, 20-50, 20-80, 30-50, 30-80, 30-120, 50-100, 50-150, 50-250, 100-200, 100-300, 100-500, 200-500, 200-1000, 300-800, 300-1500, 1000-3000, 1000-5000, 1000-8000, 5000-10000, 5000-15000, 5000-20000, 10000-25000, 10000-30000 base pairs;

[0067] Preferably, the amount of the loaded nucleic acid is 5 μg / ml to 10 mg / ml; preferably, the amount of the loaded nucleic acid is 5 μg / ml to 10 μg / ml, 10 μg / ml to 20 μg / ml, 20 μg / ml to 40 μg / ml, 40 μg / ml to 80 μg / ml, 80 μg / ml to 150 μg / ml, 150 μg / ml to 300 μg / ml, 300 μg / ml to 400 μg / ml, 400 μg / ml to 800 μg / ml, 800 μg / ml to 1 mg / ml, 1 mg / ml to 1.5 mg / ml, 1.5 mg / ml to 2 mg / ml, 2 mg / ml to 4 mg / ml, 4 mg / ml~6mg / ml, 6mg / ml~8mg / ml or 8mg / ml~10mg / ml; more preferably, the amount of the loaded nucleic acid is 50±50μg / ml, 100±50μg / ml, 200±50μg / ml, 300±50μg / ml, 400±50μg / ml, 500±50μg / ml, 600±50μg / ml, 700±50μg / ml, 800±50μg / ml, 900±50μg / ml, 1000±50μg / ml, 1500±50μg / ml, 2000±50μg / ml, 2500±50μg / ml, 3000±50μg / ml, 4000±50μg / ml, 5000±50μg / ml, 6000±50μg / ml, 7000±50μg / ml, 8000±50μg / ml, 9000±50μg / ml, 10000±50μg / ml.

[0068] Aspect 32. The calcium-containing cationic lipid nanoparticle composition according to any one of aspects 24 to 31, characterized in that the lipids constituting the nucleic acid-loaded cationic lipid nanoparticles, and / or the optional nucleic acid-loaded cationic lipid nanoparticles containing non-precipitated calcium ions in the inner core, comprise a combination of one or more of the following groups: ionizable cationic lipids, cholesterol and / or cholesterol esters, neutral lipids, and PEGylated lipids;

[0069] Preferably, the lipids constituting the nucleic acid-loaded cationic lipid nanoparticles, and / or the optional nucleic acid-loaded cationic lipid nanoparticles containing non-precipitated calcium ions in the inner core include the following lipids:

[0070] (1) Cationic lipids: The cationic lipids are selected from ionizable cationic lipids;

[0071] (2) Cholesterol lipids: the cholesterol lipids are selected from cholesterol and / or cholesterol esters;

[0072] (3) neutral lipids: the neutral lipids are selected from phospholipids, fatty acid glycerides or glycolipids or any combination thereof; and

[0073] Optional (4) PEGylated lipids;

[0074] More preferably, the lipids constituting the nucleic acid-loaded cationic lipid nanoparticles, and / or the optional nucleic acid-loaded cationic lipid nanoparticles containing non-precipitated calcium ions in the inner core, include:

[0075] (1) Cationic lipids: The cationic lipids are selected from ionizable cationic lipids;

[0076] (2) Cholesterol lipid: the cholesterol lipid is selected from cholesterol;

[0077] (3) neutral lipids: the neutral lipids are selected from phospholipids; and

[0078] Optional (4) PEGylated lipids;

[0079] The lipids constituting the lipid nanoparticles containing calcium ions in a non-precipitated state include one or more combinations of the following groups: ionizable cationic lipids, cholesterol and / or cholesterol esters, neutral lipids, and PEGylated lipids;

[0080] Preferably, the lipids of the lipid nanoparticles containing calcium ions in a non-precipitated state include the following lipids:

[0081] (1) Cholesterol lipids: the cholesterol lipids are selected from cholesterol and / or cholesterol esters;

[0082] (2) neutral lipids: the neutral lipids are selected from phospholipids, fatty acid glycerides or glycolipids or any combination thereof; and

[0083] Optional (3) PEGylated lipid and (4) cationic lipid: The cationic lipid is selected from ionizable cationic lipids.

[0084] Aspect 33. The calcium-containing cationic lipid nanoparticle composition according to any one of aspects 24 to 32, characterized in that the lipids constituting the entire composition include a combination of the following groups in a molar ratio:

[0085] (1) Cationic lipids: 1%-90%,

[0086] (2) Cholesterol lipids: 1%-90%,

[0087] (3) Neutral lipids: 1%-90%,

[0088] (4) PEGylated lipids: 0.1%-20%.

[0089] In some embodiments, (1) the molar ratio of the cationic lipid is 1% to 20%, 20% to 40%, 40% to 60%, 60% to 75% or 75% to 90%;

[0090] In some embodiments, (2) the cholesterol lipid molar ratio is 1% to 20%, 20% to 40%, 40% to 60%, 60% to 75% or 75% to 90%;

[0091] In some embodiments, (3) the molar ratio of neutral lipids is 1% to 20%, 20% to 40%, 40% to 60%, 60% to 75% or 75% to 90%;

[0092] In some embodiments, (4) the molar ratio of PEGylated lipid is 1% to 5%, 5% to 10%, 10% to 15% or 15% to 20%.

[0093] The premise is that the sum of the percentages of the various substances making up the combination equals 100%.

[0094] Aspect 34. A calcium-containing cationic lipid nanoparticle composition according to any one of aspects 24-33, characterized in that the cationic lipid is selected from ionizable cationic lipids; preferably, the ionizable cationic lipid is selected from DSDMA, DLinDMA, DLenDMA, DODMA, A6, OF-02, A18-Iso5-2DC18, 98N 12 -5, 9A1P9, C12-200, cKK-E12, 7C1, G0-C14, L319, 304O 13 , OF-Deg-Lin, 306-O12B, 306O i10 , FTT5, SM102, ALC-0315, A9, Lipid 2, 2(8,8)4CCH3, CL1, LP01, DLin-MC3-DMA or an analog of any of the foregoing cationic lipids;

[0095] Neutral phospholipids are selected from one or more of egg yolk lecithin, soybean lecithin, hydrogenated soybean lecithin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, distearoylphosphatidylcholine, dimyristoylphosphatidylcholine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylethanolamine, dimyristoylphosphatidylethanolamine, dipalmitoylphosphatidylethanolamine, dioleoylphosphatidylethanolamine, distearoylphosphatidylinositol, dimyristoylphosphatidylinositol, dipalmitoylphosphatidylinositol, dioleoylphosphatidylethanolamine, 9A1P9, and 10A1P10; preferably one or more of phosphatidylcholine, egg yolk lecithin, soybean lecithin, hydrogenated soybean lecithin, and phosphatidylethanolamine;

[0096] The PEGylated lipid is selected from methoxy polyethylene glycol-distearoylphosphatidylethanolamine (mPEG-DSPE), methoxy polyethylene glycol-dioleoylphosphatidylethanolamine (mPEG-DOPE), methoxy polyethylene glycol-dipalmitoylphosphatidylethanolamine (mPEG-DPPE), polyethylene glycol-dilauroylglycerol (PEG-DAG), polyethylene glycol-dimyristoylglycerol (PEG-DMG), polyethylene glycol-dipalmitoylglycerol (PEG-DPG), polyethylene glycol-distearoylglycerol (PEG-DSG), polyethylene glycol-dioleoylglycerol (PEG-DOG), polyethylene glycol-dilinoleoylglycerol (PEG-DLinG), polyethylene glycol-bislauroylpropylamide (PEG-DAA), polyethylene glycol-bismyristoylpropylamide (PEG-DMA), polyethylene glycol-bispalmitoylpropylamide (PEG-DPA), polyethylene glycol-bisoleoylpropylamide (PEG-DOA), polyethylene glycol- Bis-linoleyl propylamine (PEG-DLinA), polyethylene glycol-ceramide (PEG-ceramide), stearoyl polyethylene glycol ester, vitamin E polyethylene glycol succinate (TPGS) and any combination thereof;

[0097] wherein PEG is a PEG group having a degree of polymerization selected from 3 to 100; preferably, PEG is a PEG group having a degree of polymerization selected from 3 to 50 or 50 to 100; more preferably, PEG is a PEG group having a degree of polymerization selected from 3 to 10, 10 to 20, 20 to 30, 30 to 40, 40 to 50, 50 to 60, 60 to 70, 70 to 80, 80 to 90 or 90 to 100; more preferably, PEG is a PEG group having a degree of polymerization selected from about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95 or about 100.

[0098] Aspect 35. The calcium-containing cationic lipid nanoparticle composition according to any one of aspects 24-34, characterized in that: the particle size of the lipid nanoparticles is 25 to 1000 nm; preferably, the particle size of the lipid nanoparticles is 25 to 500 nm or 500 to 1000 nm; more preferably, the particle size of the lipid nanoparticles is 25 to 75 nm, 75 to 125 nm, 125 to 175 nm, 175 to 225 nm, 225 to 275 nm, 275 to 350 nm, 350 nm to 500 nm, 500 to 800 nm or 800 to 1000 nm; more preferably, the particle size of the lipid nanoparticles is 25 to 75 nm, 75 to 125 nm, 125 to 175 nm, 175 to 225 nm, 225 to 275 nm, 275 to 350 nm, 350 nm to 500 nm, 500 to 800 nm or 800 to 1000 nm; Preferably, the particle size of the liposome nanoparticles is 40±10 nm, 50±10 nm, 60±10 nm, 70±10 nm, 80±10 nm, 90±10 nm, 100±10 nm, 110±10 nm, 120±10 nm, 125±10 nm, 130±10 nm, 140±10 nm, 150±10 nm, 160±10 nm, 170±10 nm, 180±10 nm, 190±10 nm, 200±10 nm, 210±10 nm, 220±10 nm or 250±10 nm.

[0099] Aspect 36. The calcium-containing cationic lipid nanoparticle composition as described in any one of Aspects 24-35 is characterized in that the nucleic acid encapsulation efficiency of the lipid nanoparticles is >30%; preferably >40%; preferably >50%; preferably >60%; preferably >70%; preferably >80%; preferably >90%; more preferably >95%; more preferably >97%; more preferably >98%.

[0100] Aspect 37. A method for preparing the nucleic acid-loaded calcium-containing cationic lipid nanoparticles according to aspects 1-23 or the calcium-containing cationic lipid nanoparticle composition according to any one of aspects 24-35, characterized in that it comprises the following steps:

[0101] mixing an aqueous phase containing a water-soluble calcium salt with an organic phase containing lipids to produce the calcium-containing lipid nanoparticles;

[0102] Preferably, the organic phase solvent is selected from solvents miscible with water; more preferably, the organic phase solvent is selected from methanol, ethanol, n-propanol, isopropanol, n-butanol, isobutanol, tert-butanol, sec-butanol, DMSO, DMF, acetic acid and any combination thereof.

[0103] Aspect 38. In the preparation method described in Aspect 37, the aqueous phase and the organic phase are mixed in the following manner:

[0104] (A1) The organic phase and the aqueous phase are directly mixed into the same container;

[0105] (A2) the organic phase and the aqueous phase are mixed by flowing through the same pipeline; preferably, the mixer in the same pipeline is a tee, a microfluidic chip, or any variant thereof; more preferably, the mixer in the same pipeline is a Y-shaped tube, a T-shaped tube, a microfluidic chip, or any variant thereof; or

[0106] A combination of the above two mixing methods A1 and A2.

[0107] Aspect 39. The preparation method of Aspect 37 or 38, characterized by comprising the following steps: the aqueous phase also contains the desired loaded nucleic acid. Aspect 40. The preparation method of the nucleic acid-loaded calcium-containing cationic lipid nanoparticles of Aspects 1-23 or the calcium-containing cationic lipid nanoparticle composition of any one of Aspects 24-35, characterized by comprising the following steps:

[0108] (1) A lipid organic solution ① containing a cationic lipid is mixed with an aqueous phase ① to form an intermediate a1;

[0109] (2) The intermediate a1 is mixed with the aqueous phase ② containing soluble calcium ions to form calcium-containing cationic lipid nanoparticles.

[0110] Aspect 41. In the preparation method described in Aspect 40, the mixing method in step (1) or step (2) is:

[0111] (B1) The two liquids are directly mixed into the same container;

[0112] (B2) two liquids are mixed by flowing through the same pipeline; preferably, the mixer in the same pipeline is a tee, a microfluidic chip, or any variant thereof; more preferably, the mixer in the same pipeline is a Y-shaped tube, a T-shaped tube, a microfluidic chip, or any variant thereof; or

[0113] A combination of the two hybrid methods B1 and B2 mentioned above;

[0114] Preferably, step (2) is mixed in the B2 manner.

[0115] Aspect 42. The preparation method described in Aspect 40 or 41 is characterized in that it includes the following steps: the aqueous phase ① or the aqueous phase ② contains the nucleic acid to be loaded.

[0116] Aspect 43. A method for preparing the nucleic acid-loaded calcium-containing cationic lipid nanoparticles according to aspects 1-23 or the calcium-containing cationic lipid nanoparticle composition according to any one of aspects 24-35, characterized in that it comprises the following steps:

[0117] (1) A lipid organic solution ① containing a cationic lipid is mixed with an aqueous phase ① to form an intermediate b1;

[0118] (2) forming a liposome intermediate b2 containing calcium ions in the inner aqueous phase by active encapsulation or passive encapsulation;

[0119] (3) Intermediate b1 and intermediate b2 are mixed to form calcium-containing cationic lipid nanoparticles.

[0120] Aspect 44. In the preparation method described in Aspect 43, the mixing method of step (1), step (2) or step (3) is:

[0121] (C1) The two liquids are directly mixed into the same container;

[0122] (C2) two liquids are mixed by flowing through the same pipeline; preferably, the mixer in the same pipeline is a tee, a microfluidic chip, or any variant thereof; more preferably, the mixer in the same pipeline is a Y-shaped tube, a T-shaped tube, a microfluidic chip, or any variant thereof; or

[0123] A combination of C1 and C2 hybrid methods.

[0124] Aspect 45. The preparation method described in Aspect 43 or 44 is characterized in that it includes the following steps: the aqueous phase ① or the aqueous phase ② contains the required loaded nucleic acid.

[0125] Aspect 46. The preparation method described in any one of Aspects 37-45 is characterized in that it also includes the following step: dialyzing the obtained calcium-containing cationic lipid nanoparticles in a buffer solution to remove part or all of the calcium ions outside the cationic lipid nanoparticles.

[0126] Aspect 47. The preparation method described in any one of Aspects 37-45 is characterized in that the calcium ions come from calcium salts, preferably soluble calcium salts, further preferably calcium acetate, calcium chloride, calcium sodium EDTA, calcium gluconate, calcium dihydrogen phosphate, calcium nitrate, calcium bicarbonate, calcium hydrogen sulfate, calcium bisulfite, calcium bromide, calcium iodide, calcium citrate, calcium lactate, calcium gluconate, further preferably calcium acetate, calcium sodium EDTA, calcium gluconate, calcium citrate, calcium lactate, calcium gluconate, further preferably calcium acetate.

[0127] Aspect 48. The preparation method according to any one of Aspects 37 to 45, characterized in that the calcium ions are derived from a calcium salt solution having a concentration of 50 mmol / L to 1000 mmol / L; preferably, the calcium ions are derived from a calcium salt solution having a concentration of 50 to 150 mmol / L, a calcium salt solution having a concentration of 150 to 300 mmol / L, a calcium salt solution having a concentration of 300 to 500 mmol / L, or a calcium salt solution having a concentration of 500 to 800 mmol / L;

[0128] More preferably, the calcium ions come from a calcium salt solution having a concentration of 100±50mmol / L, a calcium salt solution of 200±50mmol / L, a calcium salt solution of 300±50mmol / L, a calcium salt solution of 400±50mmol / L, a calcium salt solution of 500±50mmol / L, a calcium salt solution of 600±50mmol / L, a calcium salt solution of 700±50mmol / L, a calcium salt solution of 800±50mmol / L or a calcium salt solution of 900±50mmol / L.

[0129] Aspect 49. A transfection kit, characterized by comprising the nucleic acid-loaded calcium-containing cationic lipid nanoparticles according to Aspects 1-23 or the calcium-containing cationic lipid nanoparticle composition according to any one of Aspects 24-35.

[0130] Aspect 50. Use of the nucleic acid-loaded calcium-containing cationic lipid nanoparticles of Aspects 1-23 or the calcium-containing cationic lipid nanoparticle composition of any one of Aspects 24-35 for gene transfection into in vitro cultured cells.

[0131] Aspect 51. The use described in Aspect 37 is characterized in that the use is for non-therapeutic purposes, preferably, the use is for in vitro cell modification.

[0132] Aspect 52. Use of the nucleic acid-loaded calcium-containing cationic lipid nanoparticles of Aspects 1-23 or the calcium-containing cationic lipid nanoparticle composition of any one of Aspects 24-35 for local injection into the body to achieve gene transfection.

[0133] Aspect 53. Use of the nucleic acid-loaded calcium-containing cationic lipid nanoparticles of Aspects 1-23 or the calcium-containing cationic lipid nanoparticle composition of any one of Aspects 24-35 for the preparation of a gene drug for local injection into the body.

[0134] Aspect 54. The use of the nucleic acid-loaded calcium-containing cationic lipid nanoparticles of Aspects 1-23 or the calcium-containing cationic lipid nanoparticle composition of any one of Aspects 24-35 for local or systemic injection into the body to achieve vaccine immunity.

[0135] Aspect 55. Use of the nucleic acid-loaded calcium-containing cationic lipid nanoparticles of Aspects 1-23 or the calcium-containing cationic lipid nanoparticle composition of any one of Aspects 24-35 for preparing a nucleic acid vaccine for local or systemic injection into the body.

[0136] In one embodiment, the present invention relates to a calcium-containing cationic lipid nanoparticle for loading nucleic acid, characterized in that

[0137] The cationic lipid nanoparticles comprise cationic lipids, neutral lipids, PEGylated lipids and cholesterol and / or cholesterol esters;

[0138] The cationic lipid nanoparticles contain calcium ions, and the anions corresponding to the calcium ions are not phosphate, hydrogen phosphate and dihydrogen phosphate; and the cationic lipid nanoparticles do not contain negatively charged lipids modified with non-PEG groups.

[0139] In one embodiment, the calcium-containing cationic lipid nanoparticles for loading nucleic acids of the present invention contain calcium ions in a non-precipitated state.

[0140] For the calcium-containing cationic lipid nanoparticles as described in any of the aforementioned embodiments, the concentration of calcium in the entire preparation is 0.01-150 mmol / L; preferably 0.01-0.1 mmol / L or 0.1-150 mmol / L; preferably 0.01-0.1 mmol / L, 0.1-1 mmol / L, 1-10 mmol / L, 10-100 mmol / L or 100-150 mmol / L; more preferably 0.01-0.1 mmol / L, 0.1-1 mmol / L, 10-100 mmol / L or 100-150 mmol / L. ol / L, 1-10mmol / L, 10-30mmol / L, 30-50mmol / L, 50-70mmol / L, 70-90mmol / L, 90-110mmol / L, 110-130mmol / L or 130-150mmol / L; more preferably 0.01-1mmol / L; more preferably 0.02-0.8mmol / L; more preferably 0.03-0.5mmol / L; more preferably 0.1-0.5mmol / L.

[0141] For the calcium-containing cationic lipid nanoparticles as described in any of the aforementioned embodiments, the local concentration of calcium in the inner core of the cationic lipid nanoparticles relative to the total volume is 10-300 μM, preferably 15-250 μM, more preferably 20-180 μM, more preferably 20-180 μM, and more preferably 60-150 μM.

[0142] Preferably, "calcium in cationic lipid nanoparticles" refers to the calcium contained in the entire preparation minus the calcium encapsulated by the non-cationic lipid nanoparticles in the preparation.

[0143] The calcium-containing cationic lipid nanoparticles as described in any of the preceding embodiments, wherein the molar ratio of calcium to lipid in the cationic lipid nanoparticles is 1:(0.01-20), preferably 1:(0.1-10), preferably 1:(1-10), preferably 1:(0.1-1);

[0144] More preferably, it is 1:(2 to 18), more preferably, it is 1:(5 to 15), and more preferably, it is 1:(7 to 13).

[0145] The calcium-containing cationic lipid nanoparticles according to claim 1 or 2, characterized in that the molar ratio of calcium in the cationic lipid nanoparticles to the total amount of cholesterol and cholesterol esters in the preparation is: (0.01:1) to (0.8:1); preferably (0.02:1) to (0.6:1); more preferably (0.03:1) to (0.4:1); more preferably (0.08:1) to (0.3:1).

[0146] The calcium-containing cationic lipid nanoparticles according to any of the aforementioned embodiments are characterized in that the calcium ions are derived from calcium salts, preferably soluble calcium salts, more preferably calcium acetate, calcium chloride, calcium sodium EDTA, calcium gluconate, calcium dihydrogen phosphate, calcium nitrate, calcium bicarbonate, calcium bisulfate, calcium bisulfite, calcium bromide, calcium iodide, calcium citrate, calcium lactate, calcium gluconate, further preferably calcium acetate, calcium sodium EDTA, calcium gluconate, calcium citrate, calcium lactate, calcium gluconate, and further preferably calcium acetate;

[0147] Preferably, the calcium ions come from a calcium salt solution with a concentration of 50 mmol / L to 1000 mmol / L; preferably, the calcium ions come from a calcium salt solution with a concentration of 50 to 150 mmol / L, a calcium salt solution with a concentration of 150 to 300 mmol / L, a calcium salt solution with a concentration of 300 to 500 mmol / L, or a calcium salt solution with a concentration of 500 to 800 mmol / L;

[0148] More preferably, the calcium ions come from a calcium salt solution having a concentration of 100±50mmol / L, a calcium salt solution of 200±50mmol / L, a calcium salt solution of 300±50mmol / L, a calcium salt solution of 400±50mmol / L, a calcium salt solution of 500±50mmol / L, a calcium salt solution of 600±50mmol / L, a calcium salt solution of 700±50mmol / L, a calcium salt solution of 800±50mmol / L or a calcium salt solution of 900±50mmol / L.

[0149] The calcium-containing cationic lipid nanoparticles as described in any of the aforementioned embodiments are characterized in that the substance delivered by the calcium-containing cationic lipid nanoparticles is a nucleic acid, preferably plasmid DNA, single-stranded DNA, double-stranded DNA, siRNA, shRNA, aiRNA, miRNA, mRNA, circular RNA, tRNA, rRNA, vRNA, gRNA, aptamer, ribozyme, oligonucleotide or any combination thereof.

[0150] The calcium-containing cationic lipid nanoparticles as described in any of the aforementioned embodiments are characterized in that the molar number of phosphate groups of the nucleic acid: the molar number of positive charges of the cationic lipid is 1:(0.5~20), preferably 1:(1~10), more preferably 1:(1.5~6), and more preferably 1:(1.5~3) or 1:(3~6).

[0151] The calcium-containing cationic lipid nanoparticles as described in any of the aforementioned embodiments are characterized in that the nucleic acid:lipid mass ratio is 1:(1-100), preferably 1:(5-90), more preferably 1:(10-70), and further preferably 1:(10-30).

[0152] The calcium-containing cationic lipid nanoparticles according to any of the preceding embodiments are characterized in that the length of the substance delivered by the calcium-containing cationic lipid nanoparticles is about 15 to 30,000 base pairs; preferably 15 to 60, 60 to 120, 120 to 250, 250 to 500, 500 to 1000, 1000 to 2000, 2000 to 4000, 4000 to 8000, 8000 to 15000, 15000 to 20000, 20000 to 25000, 25000 to 30000 base pairs; more preferably 15 to 60, 15 to 50, 15 to 40, 15 to 30, 15~25,19~25,20~30,20~50,20~80,30~50,30~80,30~120,50~100,50~150,50~250,100~200,100~300,100~500,200~500,200~1000,300~800,300~1500,1000~3000,1000~5000,1000~8000,5000~10000,5000~15000,5000~20000,10000~25000,10000~30000 bases (pairs).

[0153] The calcium-containing cationic lipid nanoparticles according to any of the aforementioned embodiments are characterized in that: the amount of nucleic acid loaded is 5 μg / ml to 10 mg / ml;

[0154] Preferably, the amount of the loaded nucleic acid is 5 μg / ml to 10 μg / ml, 10 μg / ml to 20 μg / ml, 20 μg / ml to 40 μg / ml, 40 μg / ml to 80 μg / ml, 80 μg / ml to 150 μg / ml, 150 μg / ml to 300 μg / ml, 300 μg / ml to 400 μg / ml, 400 μg / ml to 800 μg / ml, 800 μg / ml to 1 mg / ml, 1 mg / ml to 1.5 mg / ml, 1.5 mg / ml to 2 mg / ml, 2 mg / ml to 4 mg / ml, 4 mg / ml to 6 mg / ml, 6 mg / ml to 8 mg / ml or 8 mg / ml to 10 mg / ml;

[0155] More preferably, the amount of nucleic acid loaded is 50±50 μg / ml, 100±50 μg / ml, 200±50 μg / ml, 300±50 μg / ml, 400±50 μg / ml, 500±50 μg / ml, 600±50 μg / ml, 700±50 μg / ml, 800±50 μg / ml, 900±50 μg / ml, 1000±50 μg / ml, 1 500±50μg / ml, 2000±50μg / ml, 2500±50μg / ml, 3000±50μg / ml, 4000±50μg / ml, 5000±50 μg / ml, 6000±50μg / ml, 7000±50μg / ml, 8000±50μg / ml, 9000±50μg / ml, 10000±50μg / ml.

[0156] The calcium-containing cationic lipid nanoparticles according to any of the aforementioned embodiments are characterized in that the lipids constituting the cationic lipid nanoparticles include a combination of one or more of the following groups: cationic lipids, cholesterol and / or cholesterol esters, neutral lipids, and PEGylated lipids;

[0157] Preferably, the lipids constituting the cationic lipid nanoparticles include the following lipids:

[0158] (1) Cationic lipids: The cationic lipids are selected from ionizable cationic lipids;

[0159] (2) Cholesterol lipids: the cholesterol lipids are selected from cholesterol and / or cholesterol esters;

[0160] (3) neutral lipids: the neutral lipids are selected from phospholipids, fatty acid glycerides or glycolipids or any combination thereof; and

[0161] Optional (4) PEGylated lipids;

[0162] More preferably, the lipids constituting the cationic lipid nanoparticles include:

[0163] (1) Cationic lipids: The cationic lipids are selected from ionizable cationic lipids;

[0164] (2) Cholesterol lipid: the cholesterol lipid is selected from cholesterol;

[0165] (3) neutral lipids: the neutral lipids are selected from phospholipids; and

[0166] Optional (4) PEGylated lipid.

[0167] The calcium-containing cationic lipid nanoparticles according to any one of the aforementioned embodiments are characterized in that

[0168] The lipids constituting the cationic lipid nanoparticles include cationic lipids and / or cholesterol lipids in a molar ratio of 1%-90%; preferably, the cationic lipid nanoparticles include cationic lipids and / or cholesterol lipids in a molar ratio of 10%-60%; more preferably, the cationic lipid nanoparticles include cationic lipids and / or cholesterol lipids in a molar ratio of 20%-40%;

[0169] The calcium-containing cationic lipid nanoparticles according to any one of the aforementioned embodiments are characterized in that

[0170] The lipids constituting the cationic lipid nanoparticles include a combination of the following groups in molar ratios:

[0171] (1) Cationic lipids: 1%-90%,

[0172] (2) Cholesterol lipids: 1%-90%,

[0173] (3) Neutral lipids: 1%-90%,

[0174] (4) PEGylated lipids: 0.1%-20%;

[0175] Preferably, the lipids constituting the cationic lipid nanoparticles include a combination of the following groups in molar ratios:

[0176] (1) Cationic lipids: 10%-50%,

[0177] (2) Cholesterol lipids: 25%-75%,

[0178] (3) Neutral lipids: 1%-30%,

[0179] (4) PEGylated lipids: 0.5%-10%;

[0180] More preferably, the lipids constituting the cationic lipid nanoparticles include a combination of the following groups in molar ratios:

[0181] (1) Cationic lipids: 20%-40%,

[0182] (2) Cholesterol lipids: 40%-60%,

[0183] (3) Neutral lipids: 5%-25%,

[0184] (4) PEGylated lipids: 1%-3%.

[0185] The calcium-containing cationic lipid nanoparticles as described in any of the aforementioned embodiments are characterized in that the cationic lipid nanoparticles do not contain negatively charged lipids modified with non-PEG groups.

[0186] The calcium-containing cationic lipid nanoparticles as described in any of the above embodiments are characterized in that the cationic lipid is selected from ionizable cationic lipids; preferably, the ionizable cationic lipid is selected from DSDMA, DLinDMA, DLenDMA, DODMA, A6, OF-02, A18-Iso5-2DC18, 98N 12 -5, 9A1P9, C12-200, cKK-E12, 7C1, G0-C14, L319, 304O 13 , OF-Deg-Lin, 306-O12B, 306O i10 , FTT5, SM102, ALC-0315, A9, Lipid 2, 2(8,8)4CCH3, CL1, LP01, DLin-MC3-DMA or analogs and combinations of any of the foregoing cationic lipids; and / or

[0187] Neutral phospholipids are selected from one or more of egg yolk lecithin, soybean lecithin, hydrogenated soybean lecithin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, distearoylphosphatidylcholine, dimyristoylphosphatidylcholine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylethanolamine, dimyristoylphosphatidylethanolamine, dipalmitoylphosphatidylethanolamine, dioleoylphosphatidylethanolamine, distearoylphosphatidylinositol, dimyristoylphosphatidylinositol, dipalmitoylphosphatidylinositol, dioleoylphosphatidylethanolamine, 9A1P9, 10A1P10; preferably one or more of phosphatidylcholine, egg yolk lecithin, soybean lecithin, hydrogenated soybean lecithin and phosphatidylethanolamine; and / or

[0188] The PEGylated lipids are selected from methoxy polyethylene glycol-distearylphosphatidylethanolamine (mPEG-DSPE), methoxy polyethylene glycol-dioleylphosphatidylethanolamine (mPEG-DOPE), methoxy polyethylene glycol-dipalmitoylphosphatidylethanolamine (mPEG-DPPE), polyethylene glycol-dilauroylglycerol (PEG-DAG), polyethylene glycol-dimyristoylglycerol (PEG-DMG), polyethylene glycol-dipalmitoylglycerol (PEG-DPG), polyethylene glycol-distearoylglycerol (PEG-DSG), polyethylene glycol-dioleoylglycerol (PEG-DAG), polyethylene glycol-dilauroylglycerol (PEG-DMG), polyethylene glycol-dipalmitoylglycerol (PEG-DPG), polyethylene glycol-distearoylglycerol (PEG-DSG), polyethylene glycol-dioleoylglycerol (PEG-DAG), polyethylene glycol-dilauroylglycerol (PEG-DMG), polyethylene glycol-dipalmitoylglycerol (PEG-DPG), polyethylene glycol-distearoylglycerol (PEG-DSG), polyethylene glycol-dioleoylglycerol (PEG-DAG), polyethylene glycol-dilauroylglycerol (PEG-DMG), polyethylene glycol-dipalmitoylglycerol (PEG-DPG), polyethylene glycol-dilauroylglycerol (PEG-DAG), polyethylene glycol-dimyristoylglycerol (PEG-DMG), polyethylene glycol-dipalmitoylglycerol (PEG-DPG), polyethylene glycol-distearoylglycerol (PEG-DSG), polyethylene glycol-dioleoylglycerol (PEG-DAG), polyethylene glycol-dilauroylglycerol (PEG-DAG), polyethylene glycol-dimyristoylglycerol (PEG-DMG), polyethylene glycol-dipalmitoylglycerol (PEG-DP ...stearoylglycerol (PEG-DS G-DOG), polyethylene glycol-dilinoleylglycerol (PEG-DLinG), polyethylene glycol-bislauroylpropylamide (PEG-DAA), polyethylene glycol-bismyristoylpropylamide (PEG-DMA), polyethylene glycol-bispalmitoylpropylamide (PEG-DPA), polyethylene glycol-bisoleoylpropylamide (PEG-DOA), polyethylene glycol-bislinoleoylpropylamide (PEG-DLinA), polyethylene glycol-ceramide (PEG-ceramide), stearoyl polyethylene glycol ester, vitamin E polyethylene glycol succinate (TPGS) and any combination thereof;

[0189] wherein PEG is a PEG group having a degree of polymerization selected from 3 to 100; preferably, PEG is a PEG group having a degree of polymerization selected from 3 to 50 or 50 to 100; more preferably, PEG is a PEG group having a degree of polymerization selected from 3 to 10, 10 to 20, 20 to 30, 30 to 40, 40 to 50, 50 to 60, 60 to 70, 70 to 80, 80 to 90 or 90 to 100; more preferably, PEG is a PEG group having a degree of polymerization selected from about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95 or about 100.

[0190] The calcium-containing cationic lipid nanoparticles according to any of the aforementioned embodiments are characterized in that: the particle size of the calcium-containing cationic lipid nanoparticles is 25-1000 nm; preferably, the particle size of the lipid nanoparticles is 25-500 nm or 500-1000 nm; more preferably, the particle size of the lipid nanoparticles is 25-75 nm, 75-125 nm, 125-175 nm, 175-225 nm, 225-275 nm, 275-350 nm, 350 nm-500 nm, 500-800 nm or 800-1000 nm; more preferably Preferably, the particle size of the liposome nanoparticles is 40±10 nm, 50±10 nm, 60±10 nm, 70±10 nm, 80±10 nm, 90±10 nm, 100±10 nm, 110±10 nm, 120±10 nm, 125±10 nm, 130±10 nm, 140±10 nm, 150±10 nm, 160±10 nm, 170±10 nm, 180±10 nm, 190±10 nm, 200±10 nm, 210±10 nm, 220±10 nm or 250±10 nm.

[0191] The calcium-containing cationic lipid nanoparticles according to any of the aforementioned embodiments are characterized in that the calcium-containing cationic lipid nanoparticles are selected from the following nanoparticle preparations:

[0192] siRNA-loaded cationic lipid nanoparticles using cationic lipids (preferably DLin-MC3-DMA), cholesterol, neutral phospholipids (preferably DSPC), PEGylated lipids (preferably PEG2000-DMG) as lipids and calcium acetate as a calcium ion source;

[0193] Calcium-containing cationic lipid nanoparticles loaded with mRNA using cationic lipids (preferably DLin-MC3-DMA), cholesterol, neutral phospholipids (preferably DSPC), PEGylated lipids (preferably PEG2000-DMG) as lipids and calcium acetate as a calcium ion source;

[0194] DNA-loaded calcium-containing cationic lipid nanoparticles are prepared using cationic lipids (preferably DLin-MC3-DMA), cholesterol, neutral phospholipids (preferably DSPC), PEGylated lipids (preferably PEG2000-DMG) as lipids and calcium acetate as a calcium ion source.

[0195] The calcium-containing cationic lipid nanoparticles as described in any of the aforementioned embodiments are characterized in that the calcium-containing cationic lipid nanoparticles have a targeting effect on the liver, lungs or spleen.

[0196] In one embodiment, the present invention relates to a calcium-containing cationic lipid nanoparticle composition, characterized in that the composition is prepared by mixing calcium-containing cationic lipid nanoparticles with cationic lipid nanoparticles loaded with nucleic acids.

[0197] The pH is preferably adjusted to neutral after mixing.

[0198] In one embodiment, the present invention relates to the use of calcium-containing cationic lipid nanoparticles loaded with nucleic acids and calcium-containing cationic lipid nanoparticle compositions for gene transfection into in vitro cultured cells. In one embodiment, the use is for non-therapeutic purposes, preferably, the use is for in vitro cell modification.

[0199] In one embodiment, the present invention relates to the use of calcium-containing cationic lipid nanoparticles loaded with nucleic acids or calcium-containing cationic lipid nanoparticle compositions for local injection into the body to achieve gene transfection.

[0200] In one embodiment, the present invention relates to the use of calcium-containing cationic lipid nanoparticles loaded with nucleic acids or calcium-containing cationic lipid nanoparticle compositions for preparing gene drugs for local injection into the body.

[0201] In one embodiment, the present invention relates to the use of calcium-containing cationic lipid nanoparticles loaded with nucleic acids or calcium-containing cationic lipid nanoparticle compositions for local or systemic injection into the body to achieve vaccine immunization.

[0202] In one embodiment, the present invention relates to the use of calcium-containing cationic lipid nanoparticles loaded with nucleic acid or calcium-containing cationic lipid nanoparticle compositions for preparing nucleic acid vaccines for local or systemic injection into the body.

[0203] The method for preparing the calcium-containing cationic lipid nanoparticle composition of any of the aforementioned embodiments is characterized by comprising the steps of: mixing an aqueous phase containing a water-soluble calcium salt with an organic phase containing lipids to produce the calcium-containing lipid nanoparticles;

[0204] Preferably, the organic phase solvent is selected from solvents miscible with water; more preferably, the organic phase solvent is selected from methanol, ethanol, n-propanol, isopropanol, n-butanol, isobutanol, tert-butanol, sec-butanol, DMSO, DMF, acetic acid and any combination thereof.

[0205] Preferably, in the preparation method, the aqueous phase and the organic phase are mixed in the following manner:

[0206] (A1) The organic phase and the aqueous phase are directly mixed into the same container;

[0207] (A2) the organic phase and the aqueous phase are mixed by flowing through the same pipeline; preferably, the mixer in the same pipeline is a tee, a microfluidic chip, or any variant thereof; more preferably, the mixer in the same pipeline is a Y-shaped tube, a T-shaped tube, a microfluidic chip, or any variant thereof; or

[0208] A combination of the above two mixing methods A1 and A2.

[0209] Preferably, the method comprises the following steps: the aqueous phase also contains the nucleic acid to be loaded.

[0210] The preparation method of any of the aforementioned embodiments is characterized by comprising the following steps:

[0211] (1) A lipid organic solution ① containing a cationic lipid is mixed with an aqueous phase ① to form an intermediate a1;

[0212] (2) The intermediate a1 is mixed with the aqueous phase ② containing soluble calcium ions to form calcium-containing cationic lipid nanoparticles.

[0213] Preferably, in the preparation method, the mixing method of step (1) or step (2) is:

[0214] (B1) The two liquids are directly mixed into the same container;

[0215] (B2) two liquids are mixed by flowing through the same pipeline; preferably, the mixer in the same pipeline is a tee, a microfluidic chip, or any variant thereof; more preferably, the mixer in the same pipeline is a Y-shaped tube, a T-shaped tube, a microfluidic chip, or any variant thereof; or

[0216] A combination of the two hybrid methods B1 and B2 mentioned above;

[0217] Preferably, step (2) is mixed in the B2 manner.

[0218] The preparation method of any of the aforementioned embodiments is characterized by comprising the following steps: the aqueous phase ① or the aqueous phase ② contains the nucleic acid to be loaded.

[0219] The method for preparing the calcium-containing cationic lipid nanoparticle composition described in any of the aforementioned embodiments is characterized by comprising the following steps:

[0220] (1) A lipid organic solution ① containing a cationic lipid is mixed with an aqueous phase ① to form an intermediate b1;

[0221] (2) forming a liposome intermediate b2 containing calcium ions in the inner aqueous phase by active encapsulation or passive encapsulation;

[0222] (3) Intermediate b1 and intermediate b2 are mixed to form calcium-containing cationic lipid nanoparticles.

[0223] Preferably, in the preparation method, the mixing method of step (1), step (2) or step (3) is:

[0224] (C1) The two liquids are directly mixed into the same container;

[0225] (C2) two liquids are mixed by flowing through the same pipeline; preferably, the mixer in the same pipeline is a tee, a microfluidic chip, or any variant thereof; more preferably, the mixer in the same pipeline is a Y-shaped tube, a T-shaped tube, a microfluidic chip, or any variant thereof; or

[0226] A combination of C1 and C2 hybrid methods.

[0227] Preferably, the preparation method is characterized by comprising the following steps: the aqueous phase ① or the aqueous phase ② contains the nucleic acid to be loaded.

[0228] The preparation method described in any of the aforementioned embodiments is characterized by further comprising the step of dialyzing the obtained calcium-containing cationic lipid nanoparticles in a buffer solution to remove part or all of the calcium ions outside the cationic lipid nanoparticles.

[0229] The preparation method described in any of the aforementioned embodiments is characterized in that the calcium ions come from calcium salts, preferably soluble calcium salts, more preferably calcium acetate, calcium chloride, calcium sodium EDTA, calcium gluconate, calcium dihydrogen phosphate, calcium nitrate, calcium bicarbonate, calcium bisulfate, calcium bisulfite, calcium bromide, calcium iodide, calcium citrate, calcium lactate, calcium gluconate, further preferably calcium acetate, calcium sodium EDTA, calcium gluconate, calcium citrate, calcium lactate, calcium gluconate, and further preferably calcium acetate.

[0230] The preparation method according to any one of the preceding embodiments is characterized in that the calcium ions are derived from a calcium salt solution having a concentration of 50 mmol / L to 1000 mmol / L; preferably, the calcium ions are derived from a calcium salt solution having a concentration of 50 to 150 mmol / L, a calcium salt solution having a concentration of 150 to 300 mmol / L, a calcium salt solution having a concentration of 300 to 500 mmol / L, or a calcium salt solution having a concentration of 500 to 800 mmol / L;

[0231] More preferably, the calcium ions come from a calcium salt solution having a concentration of 100±50mmol / L, a calcium salt solution of 200±50mmol / L, a calcium salt solution of 300±50mmol / L, a calcium salt solution of 400±50mmol / L, a calcium salt solution of 500±50mmol / L, a calcium salt solution of 600±50mmol / L, a calcium salt solution of 700±50mmol / L, a calcium salt solution of 800±50mmol / L or a calcium salt solution of 900±50mmol / L.

[0232] A transfection kit, characterized by comprising the calcium-containing cationic lipid nanoparticles or the calcium-containing cationic lipid nanoparticle composition loaded with nucleic acid as described in any one of the aforementioned embodiments.

[0233] The organic phase dissolved with lipids and the calcium-containing aqueous phase are mixed to form calcium-containing cationic lipid nanoparticles. Based on research, the inventors surprisingly discovered that when the core of the cationic lipid nanoparticles contains a soluble calcium salt, the use of lipid nanoparticles to load nucleic acid drugs has the characteristics of high transfection efficiency, stable encapsulation, uniform and controllable particle size, and specific targeting to the liver organ. Experiments through the detection of the effect of nucleic acid onset have found that the interfering RNA loaded by the calcium-containing cationic lipid nanoparticles of the present invention can significantly knock down the content of related mRNA, and the loaded mRNA can significantly increase the amount of expression of related proteins. And for DNA, which is the most difficult in the field of gene transfection, it can also be transfected into the nucleus to achieve large-scale expression of related proteins.

[0234] Unless otherwise indicated, the following terms have the meanings ascribed to them.

[0235] Unless the context requires otherwise, the word "comprise" and variations such as "include" and "comprising" in this specification and claims are to be interpreted in an open and inclusive sense to mean "including, but not limited to," unless the context requires otherwise.

[0236] The term "precipitated calcium ions" refers to calcium salts whose pure substances are insoluble under normal conditions, such as calcium phosphate, calcium carbonate, calcium fluoride, etc. The term "non-precipitated calcium ions" refers to calcium salts whose pure substances are not insoluble under normal conditions, i.e., calcium ions in soluble, easily soluble, or slightly soluble states, including but not limited to calcium acetate, calcium chloride, calcium sodium EDTA, calcium gluconate, calcium dihydrogen phosphate, calcium nitrate, calcium bicarbonate, calcium bisulfate, calcium bisulfite, calcium bromide, calcium iodide, calcium citrate, calcium lactate, calcium gluconate, etc.

[0237] The term "DNA" refers to a non-replicating gene or a replicating gene vector used as an expression vector.

[0238] The term "interfering RNA" or "RNAi" or "interfering RNA sequence" refers to a single-stranded RNA (e.g., a mature miRNA) or double-stranded RNA (i.e., a duplex RNA such as siRNA, aiRNA, or pre-miRNA) that, when the interfering RNA and the target gene or sequence are in the same cell, can reduce or inhibit the expression of the target gene or sequence (e.g., by mediating degradation and inhibiting translation of an mRNA that is complementary to the interfering RNA sequence). Interfering RNA therefore refers to a single-stranded RNA that is complementary to the target mRNA sequence or a double-stranded RNA formed by two complementary chains or by a single self-complementary chain. The interfering RNA can have substantial or complete identity to the target gene or sequence, or can include mismatch regions (i.e., mismatch motifs). The sequence of the interfering RNA can correspond to the full-length target gene or a subsequence thereof.

[0239] Interfering RNAs include "small interfering RNAs" or "siRNAs," e.g., interfering RNAs of about 15-60, 15-50, or 15-40 (duplex) nucleotides in length, more typically about 15-30, 15-25, or 19-25 (duplex) nucleotides in length, and preferably about 20-24, 21-22, or 21-23 (duplex) nucleotides in length (e.g., each complementary strand of a double-stranded siRNA is about 100 nucleotides in length). In some embodiments, the siRNA is about 15-60, 15-50, 15-40, 15-30, 15-25, or 19-25 nucleotides in length, preferably about 20-24, 21-22, or 21-23 nucleotides in length, and the double-stranded siRNA is about 15-60, 15-50, 15-40, 15-30, 15-25, or 19-25 base pairs in length, preferably about 18-22, 19-20, or 19-21 base pairs in length. The siRNA duplex can include a 3' overhang of about 1 to about 4 nucleotides or about 2 to about 3 nucleotides and a 5' phosphate terminus. Examples of siRNA include, but are not limited to, double-stranded polynucleotide molecules assembled from two separate stranded molecules, one of which is a sense strand and the other is a complementary antisense strand; double-stranded polynucleotide molecules assembled from single-stranded molecules, wherein the sense region and the antisense region are connected by a nucleic acid-based or non-nucleic acid-based linker; double-stranded polynucleotide molecules containing a hairpin secondary structure having self-complementary sense and antisense regions; and circular single-stranded polynucleotide molecules containing two or more loop structures and a stem having self-complementary sense and antisense regions, wherein the circular polynucleotide can be processed in vivo or in vitro to generate an active double-stranded siRNA molecule.

[0240] Preferably, the siRNA is chemically synthesized. siRNA can also be produced by cleaving longer dsRNAs (eg, dsRNAs greater than about 25 nucleotides in length) using E. coli RNase III or Dicer. These enzymes process dsRNA into biologically active siRNA (see, e.g., Yang et al., Proc. Natl. Acad. Sci. USA, 99:9942-9947 (2002); Calegari et al., Proc. Natl. Acad. Sci. USA, 99:14236 (2002); Byrom et al., Ambion Tech Notes, 10(1):4-6 (2003); Kawasaki et al., Nucleic Acids Res., 31:981-987 (2003); Knight et al., Science, 293:2269-2271 (2001); and Robertson et al., J. Biol. Chem., 243:82 (1968)). Preferably, the dsRNA is at least 50 nucleotides in length - about 100, 200, 300, 400, or 500 nucleotides. The dsRNA may be up to 1000, 1500, 2000, 5000 nucleotides in length or longer. The dsRNA may encode a complete gene transcript or a partial gene transcript. In some instances, the siRNA may be encoded by a plasmid (e.g., a sequence that is transcribed to automatically fold into a duplex having a hairpin loop).

[0241] As used herein, the term "effector cell" refers to a cell, preferably a mammalian cell, that produces a detectable immune response when contacted with an immunostimulatory interfering RNA, such as an unmodified siRNA. Exemplary effector cells include, for example, dendritic cells, macrophages, peripheral blood mononuclear cells (PBMCs), splenocytes, and the like.

[0242] The term "substantially identical" or "substantial identity" in the context of two or more nucleic acids refers to two or more sequences or subsequences that are identical or have a specified percentage of identical nucleotides (i.e., at least about 60%, preferably at least about 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity over a specified region) when compared and aligned for maximum correspondence over a comparison window, or specified region, using one of the following sequence comparison algorithms or by manual alignment and visual measurement. This definition, where the context indicates, also similarly refers to the complement of a sequence. Preferably, substantial identity exists over a region that is at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in length.

[0243] The term "nucleic acid," as used herein, refers to a polymer containing at least two deoxyribonucleotides or ribonucleotides in single-stranded or double-stranded form and includes DNA and RNA. DNA can take the form of, for example, antisense molecules, plasmid DNA, pre-condensed DNA, PCR products, vectors (P1, PAC, BAC, YAC, artificial chromosomes), expression cassettes, chimeric sequences, chromosomal DNA, or derivatives and combinations thereof. RNA can take the form of siRNA, asymmetric interfering RNA (aiRNA), microRNA (miRNA), mRNA, tRNA, rRNA, tRNA, viral RNA (vRNA), and combinations thereof. Nucleic acids include those containing known nucleotide analogs or modified backbone residues or bonds, which are synthetic, naturally occurring, and non-naturally occurring, and which have binding properties similar to a reference nucleic acid. Examples of such analogs include, but are not limited to, phosphorothioates, phosphoramidates, methylphosphonates, chiral-methylphosphonates, 2'-O-methyl ribonucleotides, and peptide-nucleic acids (PNAs). Unless otherwise specified, the term includes nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid. Unless otherwise specified, a particular nucleic acid sequence also inherently includes conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. In particular, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is replaced by mixed basic and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res., 19:5081 (1991); Ohtsuka et al., J. Biol. Chem., 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes, 8:91-98 (1994)). "Nucleotides" comprise the sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. The nucleotides are linked together by the phosphate groups. "Bases" include purines and pyrimidines, which further include the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs, as well as synthetic derivatives of purines and pyrimidines, including, but not limited to, modifications that place new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates, and alkyl halides.

[0244] The term "gene" refers to a nucleic acid (eg, DNA or RNA) sequence that contains a partial or full-length coding sequence necessary for producing a polypeptide or precursor polypeptide.

[0245] The term "lipid" refers to a group of organic compounds that include, but are not limited to, esters of fatty acids and are characterized by being insoluble in water but soluble in many organic solvents. They are generally divided into at least three categories: (1) "simple lipids," which include fats and oils as well as waxes; (2) "compound lipids," which include phospholipids and glycolipids; and (3) "derivative lipids" such as steroids.

[0246] When " lipid granule " is used herein, refer to can be used for delivering activating agent or therapeutic agent, such as nucleic acid (for example, interfering RNA), to the lipid preparation of target site.In the lipid granule that typical embodiment of the present invention is formed by cationic lipid, non-cationic lipid and the combination lipid that prevents particle aggregation, described activating agent or therapeutic agent can be encapsulated in lipid, thus protecting reagent from enzymatic degradation.

[0247] The term "amphiphilic lipid" refers, in part, to any suitable material in which the hydrophobic portion of the lipid material is oriented into the hydrophobic phase, while the hydrophilic portion is oriented into the aqueous phase. The hydrophilic nature results from the presence of polar or charged groups such as carbohydrates, phosphates, carboxyls, sulfates, aminos, sulfhydryls, nitros, hydroxyls, and other similar groups. Hydrophobicity can be imparted by the inclusion of non-polar groups, including, but not limited to, long-chain saturated and unsaturated aliphatic hydrocarbon groups and such groups substituted with one or more aromatic, alicyclic, or heterocyclic groups. Examples of amphiphilic compounds include, but are not limited to, phospholipids, amino lipids, and sphingolipids.

[0248] The representative examples of phospholipids include, but are not limited to, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylcholine and dilinoleoylphosphatidylcholine. Other compounds lacking phosphorus, such as sphingolipids, sphingolipid family, diacylglycerol and β-acyloxy acid are also included in the group that is called as amphipathic lipid. In addition, above-mentioned amphipathic lipid can be mixed with other lipids, and described other lipids include triglycerides and sterols.

[0249] The term "neutral lipid" when present in lipid particles can be any of the many lipid species present in the form of uncharged or neutral zwitterionic forms at physiological pH. Such lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, dihydrosphingomyelin, cholesterol, cephalin and cerebrosides. The selection of neutral lipids for the granule described herein is usually by consideration, such as liposome size and the stability of liposomes in the bloodstream are guided. Preferably, the neutral lipid component is a lipid with two acyl groups (that is, diacylphosphatidylcholine and diacylphosphatidylethanolamine). Liposomes with the acyl chain groups of multiple different chain lengths and saturation are obtainable or can be separated or synthesized by known technology. In one group of embodiments, it is preferred to contain a lipid with a saturated fatty acid with a carbon chain length within the scope of C10 to C20. In another group of embodiments, a lipid with a mono- or di-unsaturated fatty acid with a carbon chain length within the scope of C10 to C20 is used. In addition, the lipid of the mixture with saturated and unsaturated fatty acid chain can be used.Preferably, the neutral lipid that is used for the present invention is DOPE, DSPC, POPC, DPPC or any relevant phosphatidylcholine.Neutral lipid that is used for the present invention can also be by sphingomyelin, dihydrosphingomyelin or have other head groups, for example the phospholipid class of serine and inositol forms.

[0250] The term "negatively charged lipids" refers to lipids containing free phosphate groups in their molecules. Due to the presence of phosphate groups, these lipids can ionize positively charged hydrogen ions in solution and become negatively charged, including but not limited to acidic phospholipids such as phosphatidylserine.

[0251] The term "negatively charged lipids with a PEG group" refers to negatively charged lipids modified with PEG, including but not limited to distearoylphosphatidylethanolamine-methoxypolyethylene glycol 2000 (DSPE-MPEG2000).

[0252] The term "non-PEG group-modified negatively charged lipid" refers to a negatively charged lipid that is not modified with PEG, such as phosphatidylserine, phosphatidic acid, and phosphatidylglycerol.

[0253] The term "non-cationic lipid" refers to any amphipathic lipid as well as any other neutral lipid or anionic lipid.

[0254] The term "anionic lipid" refers to any lipid that is negatively charged at physiological pH. These lipids include, but are not limited to, phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoylphosphatidylethanolamine, N-succinylphosphatidylethanolamine, N-glutarylphosphatidylethanolamine, lysylphosphatidylglycerol, palmitoyloleoylphosphatidylglycerol (POPG), and other anionic modifying groups attached to neutral lipids.

[0255] The term "cationic lipid" refers to any of the many lipid species carrying a net positive charge at a selected pH value, such as physiological pH (e.g., pH is about 7). It has been unexpectedly found that the cationic lipid comprising an alkyl chain with a plurality of unsaturated sites, e.g., at least 2 or 3 unsaturated sites, is particularly effective for forming lipid particles with increased membrane fluidity. Many cationic lipids and related analogs that are also effective for the present invention have been described in U.S. Patent Publication Nos. 20060083780 and 20060240554; U.S. Patent No. 5,208,036; 5,264,618; 5,279,833; 5,283,185; 5,753,613; and 5,785,992; and PCT Publication No. WO96 / 10390, the disclosure of which is incorporated herein by reference for all purposes. The limiting examples of cationic lipids are described in detail in this article. In some cases, the cationic lipid comprises a protonatable tertiary amine (e.g., pH titratable) head group, a C18 alkyl chain, an ether bond between the head group and the alkyl chain, and 0 to 3 double bonds. Such lipids include, for example, DSDMA, DLinDMA, DLenDMA, DODMA, A6, OF-02, A18-Iso5-2DC18,98N 12 -5, 9A1P9, C12-200, cKK-E12, 7C1, G0-C14, L319, 304O 13 , OF-Deg-Lin, 306-O12B, 306O i10 , FTT5, SM102, ALC-0315, A9, Lipid 2, 2(8,8)4CCH3, CL1, LP01, MC3 or an analog of any of the foregoing cationic lipids.

[0256] The term "analogs of cationic lipids" refers to cationic lipids with similar structures produced by changing the number of carbon atoms in the optional carbon chain of the cationic lipid.

[0257] In some examples, the cationic lipid is selected from the cationic lipid of formula (Ia):

[0258] where R 1a and R 2a Each occurrence is independently C 10 -C 30 Alkyl, C 10 -C 30 Alkenyl or C 10 -C 30 Alkynyl; preferably, wherein R 1a and R 2a include at least one unsaturated site; more preferably, wherein R 1a and R2a include at least two unsaturated sites; more preferably, wherein R 1a and R 2a All contain at least two double bonds;

[0259] R 3a NH2-C 1-8 Alkyl-, NH(C 1-8 alkyl)-C 1-8 Alkyl- or NH(C 1-8 alkyl)2-C 1-8 Alkyl-; preferably, R 3a is NH2-(CH2)-, NH2-(CH2)2-, NH2-(CH2)3-, NH2-(CH2)4-, NH2-(CH2)5-, NH2-(CH2)6-, NH2-(CH2)7-, NH2 -(CH2)8-, NH(CH3)-(CH2)-, NH(CH3)-(CH2)2-, NH(CH3)-(CH2)3-, NH(CH3)-(CH2)4-, NH(CH3)-(CH2)5-, NH(CH3)-(CH2)6-, NH(CH3)-(CH2)7-, NH(CH3)-(CH2)8-, N(CH3)2-(CH2)-, N(CH3)2-(CH2)2-, N(CH3)2- (CH2)3-, N(CH3)2-(CH2)4-, N(CH3)2-(CH2)5-, N(CH3)2-(CH2)6-, N(CH3)2-(CH2)7- or N(CH3)2-(CH2)8-;

[0260] E is O, N(Q)C(O), C(O)N(Q), (Q)NC(O)O, OC(O)N(Q), SS or O=N, and Q is hydrogen or methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl; preferably, E is O, NHC(O), N(CH3)C(O), C(O)NH, C(O)N(CH3), NHC(O)O, N(CH3)C(O)O, C(O)ONH or C(O)ON(CH3).

[0261] In some examples, the cationic lipid is selected from the cationic lipid of formula (Ib):

[0262] R 1b Choose from C 5-30 Alkyl, C 5-20 Alkenyl, -R b* Y c R b ”、-Y b R b ” and -Rb ”M b 'R b 'Composition of groups;

[0263] R 2b and R 3b Independently selected from H, C 1-14 Alkyl, C 2-14 Alkenyl, -R b* Y b R b ”、-Y b R b ” and -R b *OR b ", or R 2b and R 3b together with the atoms to which they are attached, form a heterocyclic or carbocyclic ring;

[0264] R 4b Choose from C 3-6 Carbocyclic ring, -(CH2) 1-5 Q, -(CH2) 1-5 CHQ b R b 、-CHQ b R b 、-CQ b (R b )2 and unsubstituted C 1-6 A group consisting of alkyl groups, wherein Q b Selected from carbocyclic, heterocyclic, -OR b 、-O(CH2) 1-5 N(R b )2、-C(O)OR b 、-OC(O)R b , -CX3, -CX2H, -CXH2, -CN, -N(R b )2、-C(O)N(R b )2、-N(R b )C(O)R b 、-N(R b )S(O)2R b 、-N(R b )C(O)N(R b )2、-N(R b )C(S)N(R b )2、-N(R b )R 8b 、-O(CH2) 1-5 OR b 、-N(R b )C(=NR 9b )N(R b)2、-N(R b )C(=CHR 9b )N(R b )2、-OC(O)N(R b )2、-N(R b )C(O)OR b 、-N(OR b )C(O)R b 、-N(OR b )S(O)2R b 、-N(OR b )C(O)OR b 、-N(OR b )C(O)N(R b )2、-N(OR b )C(S)N(R b )2、-N(OR b )C(=NR 9b )N(R b )2、-N(OR b )C(=CHR 9b )N(R b )2、-C(=NR 9b )N(R b )2、-C(=NR 9b )R b 、-C(O)N(R b )OR b and -C(R b )N(R b )2C(O)OR b ; Each R 5b Independently selected from C 1-3 Alkyl, C 2-3 A group consisting of an alkenyl group and H; each R 6b Independently selected from C 1-3 Alkyl, C 2-3 A group consisting of an alkenyl group and H; M and M b 'Independently selected from -C(O)O-, -OC(O)-, -C(O)N(R b ')-、-N(R b ')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR b ')O-, -S(O)2-, -SS-, aryl groups and heteroaryl groups; R 7b Choose from C 1-3 Alkyl, C 2-3 A group consisting of an alkenyl group and H; R 8b Choose from C 3-6A group consisting of carbocyclic and heterocyclic rings; R 9b Selected from H, CN, NO2, C 1-6 Alkyl, -OR b 、-S(O)2R b 、-S(O)2N(R b )2、C 2-6 Alkenyl, C 3-6 A group consisting of carbocyclic and heterocyclic rings; each R b Independently selected from C 1-3 Alkyl, C 2-3 A group consisting of an alkenyl group and H; each R b 'Independently selected from C 1-18 Alkyl, C 2-18 Alkenyl, -R b *YR b ”、-YR b " and H; each R b "Independently selected by C 3-14 Alkyl and C 3-14 A group consisting of alkenyl; each R b *Independently selected from C 1-12 Alkyl and C 2-12 A group consisting of alkenyl; each Y b Independently C 3-6 Carbon ring; each X b Independently selected from the group consisting of F, Cl, Br and I.

[0265] In some examples, the cationic lipid is selected from the cationic lipid of formula (Ic):

[0266] Among them, G 1c and G 2c Each independently represents unsubstituted -(CH2)6-, -(CH2)7-, -(CH2)8-, -(CH2)9- or -(CH2) 10 -;

[0267] G 3c Unsubstituted -(CH2)-, -(CH2)2-, -(CH2)3-, -(CH2)4-, -(CH2)5-, -(CH2)6-, -(CH2)7-, -(CH2)8-, -(CH2)9-, (CH2) 10 -,-(CH2) 11 -or-(CH2) 12 -;

[0268] R 1c and R 2c Each independently is C6- 24 Alkyl or C 6-24 alkenyl;

[0269] R 3c OR 5c 、CN、-C(=O)OR 4c 、-OC(=O)R 4c or –NR 5c C(=O)R 4c ;

[0270] R 4c C 1-12 a hydrocarbon group; and

[0271] R 5c is H, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl.

[0272] In some examples, the cationic lipid is selected from a cationic lipid of Formula (Ida) or Formula (Idb):

[0273] L 1d and L 2d Each independently represents -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -NR ad C(=O)-, -C(=O)NR ad -、-NR ad C(=O)NR ad -、-OC(=O)NR ad -、-NR ad C(=O)O- or bond;

[0274] G 3d is -(CH2)-, -(CH2)2-, -(CH2)3-, -(CH2)4-, -(CH2)5- or -(CH2)6-;

[0275] R ad H or C 1-12 hydrocarbon group;

[0276] R 1ad and R 1bd is independently at each occurrence: (a) H or C 1-12 hydrocarbon group; or (b) R 1ad H or C 1-12 Hydrocarbyl, and R 1bd Together with the carbon atom to which it is connected and the adjacent R 1bd Together with the carbon atom to which it is attached, it forms a carbon-carbon double bond;

[0277] R 2ad and R 2bd is independently at each occurrence: (a) H or C 1-12hydrocarbon group; or (b) R 2ad H or C 1-12 Hydrocarbyl, and R 2bd Together with the carbon atom to which it is connected and the adjacent R 2bd Together with the carbon atom to which it is attached, it forms a carbon-carbon double bond;

[0278] R 3ad and R 3bd independently at each occurrence: (a) is H or C 1-12 hydrocarbon group; or (b) R 3ad H or C 1-12 Hydrocarbyl, and R 3bd Together with the carbon atom to which it is connected and the adjacent R 3bd Together with the carbon atom to which it is attached, it forms a carbon-carbon double bond;

[0279] R 4ad and R 4bd independently at each occurrence: (a) is H or C 1-12 hydrocarbon group; or (b) R 4ad H or C 1-12 Hydrocarbyl, and R 4bd Together with the carbon atom to which it is connected and the adjacent R 4bd Together with the carbon atom to which it is attached, it forms a carbon-carbon double bond;

[0280] R 5d and R 6d are each independently H or methyl;

[0281] R 7d -(C=O)OR bd 、-O(C=O)R bd 、-C(=O)R bd 、-OR bd 、-C(=O)SR bd 、-NR ad R bd 、-NR ad C(=O)R bd 、-C(=O)NR ad R bd 、-NR ad C(=O)NR ad R bd 、-OC(=O)NR ad R bd 、-NR ad C(=O)OR bd Optionally substituted C 6-16 Hydrocarbyl, where R ad H or C 1-12 Hydrocarbon; R bd C1-15 hydrocarbon group;

[0282] R 8d and R 9d Each independently is C 1-12 Hydrocarbyl; or R 8d and R 9d , together with the nitrogen atom to which they are attached, form a 5-membered, 6-membered or 7-membered heterocyclic ring.

[0283] The term "DLin-MC3-DMA" refers to the substance with CAS number 1224606-06-7. The structure of this substance is

[0284] The term "DSDMA" refers to the substance with CAS number 871258-14-9, which has the structure

[0285] The term "DLenDMA" refers to the substance with CAS number 874291-25-5, which has the structure

[0286] The term "DODMA" refers to the substance with CAS number 104162-47-2, which has the structure

[0287] The term "A6" refers to a structure of substance.

[0288] The term "OF-02" refers to a of substance.

[0289] The term "A18-Iso5-2DC18" refers to a of substance.

[0290] The term "98N 12 -5" means the structure is of substance.

[0291] The term "9A1P9" refers to a of substance.

[0292] The term "C12-200" refers to a of substance.

[0293] The term "cKK-E12" refers to a of substance.

[0294] The term "G0-C14" refers to a structure of substance.

[0295] The term "L319" refers to a of substance.

[0296] The term "SM-102" refers to CAS No. 2089251-47-6, structure of substance.

[0297] The term "ALC-0315" refers to the CAS number 2036272-55-4, the structure of of substance.

[0298] The term "A9" refers to a structure of substance.

[0299] The term "Lipid 2,2(8,8)4CCH3" refers to a of substance.

[0300] The term "CL1" refers to a of substance.

[0301] The term "LP01" refers to a of substance.

[0302] The term "MC3" or "DLin-MC3-DMA" refers to a of substance.

[0303] The term "PEG2000-DMG" refers to 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000, whose Chinese name is dimyristoylglycerol-polyethylene glycol 2000. Its molecular formula is C 122 H 242 O 50 , molecular weight 2509.2, structural formula: n=45.

[0304] In addition to the cationic lipids specifically described above, other cationic lipids that carry a net positive charge at approximately physiological pH can also be included in the lipid particles of the present invention. Such cationic lipids include, but are not limited to, N,N-dioleyl-N,N-dimethylammonium chloride ("DODAC"); N-(2,3-dioleyloxy)propyl-N,N-triethylammonium chloride ("DOTMA"); N,N-distearoyl-N,N-diethylammonium bromide ("DDAB"); N-(2,3-dioleyloxy)propyl)-N,N,N-triethylammonium chloride ("DOTAP"); 1,2-dioleyloxy-3-trimethylaminopropane hydrochloride ("DOTAP.Cl"); 3-(N-(N',N'-dimethylaminoethane)-carbamoyl)cholesterol ("DC-C N-(1-(2,3-dioleyloxy)propyl)-N-2-(sperminecarboxamido)ethyl)-N,N-dimethylammonium trifluoroacetate ("DOSPA"), dioctadecylaminoglycylcarboxyspermine ("DOGS"), 1,2-dioleyl-sn-3-phosphoethanolamine ("DOPE"), 1,2-dioleoyl-3-dimethylpropylamine ("DODAP"), N,N-dimethyl-2,3-dioleyloxy)propylamine ("DODMA"), and N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide ("DMRIE"). In addition, a number of commercial preparations of cationic lipids can be used, such as, for example, LIPOFECTIN (including DOTMA and DOPE, available from GIBCO / BRL) and LIPOFECTAMINE (including DOSPA and DOPE, available from GIBCO / BRL). In particular embodiments, the cationic lipid is an amino lipid.

[0305] The abbreviation "Chol" refers to cholesterol.

[0306] The ratio "N / P" refers to the number of moles of positive charge of the total cationic lipids contained in the composition: the number of moles of phosphate.

[0307] The term "CaLNP" refers to the calcium-containing cationic lipid nanoparticles described in any one of the aforementioned aspects.

[0308] The term "mammal" refers to any mammalian species such as humans, mice, rats, dogs, cats, hamsters, guinea pigs, rabbits, livestock, and the like. BRIEF DESCRIPTION OF THE DRAWINGS

[0309] Figure 1. Study on the knockdown efficiency of siRNA gene by CaLNP preparations with different calcium acetate concentrations

[0310] Figure 2. Evaluation of siRNA gene knockdown efficiency of CaLNP preparations prepared by different calcium acetate addition methods

[0311] Figure 3. CaLNPs prepared from different ionizable cationic materials enhance the siRNA gene knockdown efficiency relative to LNPs.

[0312] Figure 4. CaLNPs prepared from different neutral lipid materials enhance the siRNA gene knockdown efficiency relative to LNPs.

[0313] Figure 5. Comparison of siRNA transfection efficiency between LNP mixed with calcium acetate or EPC liposome-encapsulated calcium acetate and CaLNP

[0314] Figure 6. Comparison of mRNA transfection efficiency

[0315] Figure 7. Comparison of mRNA transfection efficiency

[0316] Figure 8. Comparison of DNA transfection efficiency

[0317] Figure 9. Comparison of in vivo imaging of mice administered CaLNP (left, Example 3-1, DNA dose 0.1 mg / kg) and LNP (right, Example 8-1, DNA dose 0.1 mg / kg) encapsulating pGL3-control plasmid

[0318] Figure 10. Comparison of in vivo imaging of mice administered with LNPs encapsulating Fluc-mRNA (left, Example 7-1, mRNA dose 0.3 mg / kg; right, Example 7-1, mRNA dose 0.1 mg / kg) and CaLNPs (center, Example 4-2, mRNA dose 0.06 mg / kg)

[0319] Figure 11 Different Ca 2+ Concentration of CaLNP in vitro silencing efficiency

[0320] Figure 12 In vitro silencing efficiency of different cationic lipids CaLNP and LNP in Experimental Example 8

[0321] Figure 13 FVII gene silencing efficiency of the preparation of Experimental Example 9 when administered intravenously to mice

[0322] Figure 14 TTR gene silencing efficiency of the preparation in Experimental Example 9 when administered intravenously to mice DETAILED DESCRIPTION

[0323] Specific embodiments of the present invention will be described in detail below. It should be noted that the embodiments described herein are for illustration only and are not intended to limit the present invention. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. However, it will be apparent to those skilled in the art that these specific details need not be employed to practice the present invention.

[0324] The detection methods used in this invention are all conventional or commonly used detection methods in the art. For detection methods involving the use of kits, the procedures are performed according to the instructions provided with the commercial kits. Where detection requires the use of instrumentation, the general operating procedures are to be followed in accordance with conventional procedures in the art. Unless otherwise specified, the following detection methods are performed according to the descriptions of this invention.

[0325] List of abbreviations

[0326] (1) siRNA content determination method:

[0327] Method 1: The Qubit microRNA detection kit uses the Qubit3 fluorometer to quantify microRNA. First, dilute the sample 20-fold with 1% Triton-100, then use the Qubit microRNA detection kit and detect it on the Qubit3 fluorometer.

[0328] Method 2: RiboGreen is an ultrasensitive fluorescent nucleic acid dye used to quantitatively detect RNA content in solution. Use the RiboGreen kit and detect on a fluorescence microplate reader. Dilute the sample with 0.5% Triton-100 to the appropriate concentration for detection.

[0329] (2) mRNA content determination method:

[0330] Method 1: Dilute the sample 20-fold with 1% Triton-100 and quantify mRNA using the Qubit3 Fluorometer according to the instructions of the Qubit mRNA HS Assay Kit.

[0331] Method 2: RiboGreen is an ultrasensitive fluorescent nucleic acid dye used to quantitatively detect RNA content in solution. Use the RiboGreen kit and detect on a fluorescence microplate reader. Dilute the sample with 0.5% Triton-100 to the appropriate concentration for detection.

[0332] (3) DNA content determination method:

[0333] The samples were diluted 20-fold with 1% Triton-100, and DNA was quantified using a Qubit3 fluorometer according to the instructions of the Qubit DNA HS Assay Kit.

[0334] (3) Determination of hydrated particle size:

[0335] The average particle size of the CaLNPs prepared in the present invention was measured using a Malvern particle size analyzer, model Nano-ZS. The test solution was diluted 10-fold with a pH 7.4 Tris buffer or water for measurement.

[0336] (4) Determination of nucleic acid content and encapsulation efficiency

[0337] The encapsulation efficiency is a critical indicator for CaLNP-RNA, representing the proportion of RNA encapsulated within the lipid nanoparticles to the total RNA content. First, the CaLNP-RNA is directly mixed with a fluorescent dye working solution to detect the amount of RNA free outside the CaLNP in the CaLNP-RNA solution. Next, Triton-100 is used to disrupt the CaLNP structure, releasing the RNA into the external solution. This is then mixed with the fluorescent dye working solution to detect the total amount of RNA in the solution. The difference between the two values ​​is the amount of RNA encapsulated within the LNP particles, which is then used to calculate the encapsulation efficiency. The method is the same as the content detection method.

[0338] Specifically, using Qubit TM The microRNA quantification kit (thermofisher,) was used for detection.

[0339] Nucleic acid content:

[0340] The preparation was first diluted with 1% Triton-100 to an appropriate multiple, and then detected using the Qubit microRNA detection kit on a Qubit3 fluorometer.

[0341] Encapsulation efficiency: The encapsulation efficiency is a critical indicator of CaLNP-RNA, representing the proportion of RNA encapsulated within the lipid nanoparticle to the total RNA content. First, the CaLNP-RNA is directly mixed with a fluorescent dye working solution to measure the amount of RNA free outside the CaLNP. Next, Triton-100 is used to disrupt the CaLNP structure, releasing RNA into the external solution. This is then mixed with a fluorescent dye working solution to measure the total RNA content in the solution. The difference between the two values ​​is the amount of RNA encapsulated within the LNP particle, which is then used to calculate the encapsulation efficiency.

[0342] (5) Detection methods of cholesterol and DSPC content in different process formulations

[0343] Determined by high performance liquid chromatography (Chinese Pharmacopoeia 2020 Edition, Part IV, General Chapter 0512).

[0344] Chromatographic conditions:

[0345] (1) Preparation of mobile phase

[0346] Weigh approximately 0.65518 g of ammonium acetate, add 50 mL of water, mix well, and filter to prepare a 0.17 mol / L ammonium acetate solution; prepare the mobile phase according to the proportion, mix well, and sonicate for 10 minutes.

[0347] (2) Preparation of reference solution

[0348] Weigh 19.36 mg of cholesterol and 12.36 mg of DSPC into a 10 mL volumetric flask, dissolve with an appropriate amount of diluent, make up to volume with diluent, and mix thoroughly. This is Std-1. Dilute Std-1 100-fold to prepare the control solution.

[0349] (3) Preparation of test solution

[0350] Take 0.1 mL of the preparation, add 0.6 mL of diluent, mix well, and use as the test sample. Enter the liquid phase detection.

[0351] (6) Cholesterol concentration detection method

[0352] The free cholesterol (FC) content was determined using the free cholesterol (FC) assay kit (Beijing Box Biotechnology Co., Ltd., catalog number: AKFA001C).

[0353] Blank solution: anhydrous ethanol

[0354] Reference solution: Dissolve cholesterol in anhydrous ethanol to 1 μmol / ml.

[0355] Test solution: Take 100 μl of the preparation and add 20 μl of 1% triton and mix well.

[0356] Determination method: Take 50 μl of blank solution, reference solution and test solution respectively, add 950 μl of FC working solution (from the detection kit), mix well, develop color at 37℃ for 15 minutes, and then place in UV-visible spectrophotometer for detection at a detection wavelength of 500 nm and an optical path of 1 cm. Record the absorbance value as A 空白 、A 对照 、A 供试 . C 供试 =1.2*(A 供试 -A 空白 ) / (A 对照 -A 空白 )*C 对照

[0357] (7)Ca 2+ Concentration detection method

[0358] Calcium ion (Ca) was determined using the Calcium Ion (Ca) Assay Kit (Arsenic Azo III Method) (Beijing Leadman Biochemical Co., Ltd.)

[0359] Blank solution: water

[0360] Reference solution: Take the Ca 2+ Add 900 μl of water to 100 μl of ion standard solution (2.46 mmol / L) and mix well.

[0361] Free Ca 2+ The test solution is directly taken from the preparation sample

[0362] Total Ca 2+ Test solution: Take 100 μl of the preparation sample and add 20 μl of 1% Triton.

[0363] Determination method: Take blank solution, reference solution, free Ca 2+ Test solution, total Ca 2+ Add 900 μl of calcium ion (Ca) determination reagent to 100 μl of the test solution, mix well, and place in a UV-visible spectrophotometer for detection at a wavelength of 600 nm and an optical path of 1 cm. Record the absorbance values ​​as A 空白 、A 对照 、A 游离Ca供试 、A 总Ca供试 ΔC represents the concentration of calcium ions inside lipid nanoparticles relative to the total volume of the test sample. 游离Ca供试 =(A 游离Ca供试 -A 空白 ) / (A 对照 -A 空白 )*C 对照 C 总Ca供试 =1.2*(A 总Ca供试 -A 空白 ) / (A 对照 -A 空白 )*C 对照 ΔC=C 总Ca供试 -C 游离Ca供试

[0364] Example 1. Preparation of calcium acetate siRNA-CaLNP preparations with different concentrations.

[0365] 65.0 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG2000-DMG were weighed and dissolved in 10 ml of ethanol to form the organic phase. 1 mg of siRNA (targeting human GAPDH mRNA, Seq. No. 1) was added to 0.9 ml of water and mixed thoroughly to form the siRNA stock solution. 90 μl of the siRNA stock solution was diluted with 810 μl of calcium acetate solution of varying concentrations to form the aqueous phase. The pH of the various calcium acetate concentrations was adjusted to 5 using acetic acid. 0.9 ml of the aqueous phase was manually mixed with 0.2 ml of the organic phase to obtain intermediate ①. This was dialyzed against Tris buffer at pH 7.4 using an 8000 molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to obtain siRNA-CaLNPs. The calcium acetate solutions of different concentrations in Table 1 are 25 mmol / l, 50 mmol / l, 100 mmol / l, 200 mmol / l, and 400 mmol / l.

[0366] Seq.No.1:sense:GUAUG ACAAC AGCCU CAAGT T

[0367] Anti-sense:CUUGA GGCUG UUGUC AUACT T

[0368] Table 1 siRNA-LNP feeding scheme with different calcium acetate concentrations

[0369] Table 2 Measurement data of each preparation in Example 1

[0370] Table 3 Cholesterol and DSPC test data of each preparation in Example 1

[0371] Example 2. Preparation of 200 mmol / l calcium acetate mRNA-CaLNP preparation.

[0372] Weigh 65.0 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG2000-DMG and dissolve them in 10 ml of ethanol to form the organic phase; take 1 mg of Firefly Luciferase mRNA (N 1 -Me-Pseudo UTP) was added with 8 ml of 200 mmol / l calcium acetate solution at pH 5 and mixed well as the aqueous phase; the organic phase was 4 ml / min and the aqueous phase was 18 ml / min, mixed using a Y-tube, and the intermediate ① was collected.

[0373] Intermediate ① was adjusted to pH 7 and dialyzed on ice against a Tris buffer at pH 7.4 using an 8000D molecular weight cutoff dialysis tubing. The internal solution was collected and sterilized by filtration to obtain mRNA-CaLNPs, designated 2-1. The measured content was 39 μg / ml, the encapsulation efficiency was 95.12%, and the average particle size was 79.0 nm.

[0374] The content after ultrafiltration and concentration is 400μg / ml.

[0375] Firefly Luciferase mRNA(N 1 -Me-Pseudo UTP) is a commercial mRNA purchased from Nanjing Vazyme (Product No.: DD4511-01). Firefly Luciferase mRNA (N 1-Me-Pseudo UTP) enters the cell and expresses firefly luciferase protein, which catalyzes the oxidation of D-luciferin in an ATP-dependent manner, generating fluorescence at a wavelength of 560 nm.

[0376] Example 3. Preparation of 200 mmol / l calcium acetate DNA-CaLNP preparation.

[0377] Weigh 65.0 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG2000-DMG and dissolve them in 10 ml of ethanol to form the organic phase;

[0378] Take 0.5 mg / 0.5 ml of pGL3-control plasmid and add 4 ml of 200 mmol / l calcium acetate solution at pH 5 and mix well as the aqueous phase; the organic phase is 4 ml / min, and the aqueous phase is 18 ml / min. The mixture is mixed in a Y-type tube and the intermediate is collected.

[0379] The intermediate was mixed with 0.2M Tris buffer (pH 8.5) at 10.5 ml / min using a Y-tube. The product was collected and dialyzed against Tris buffer (pH 7.4) using an 8000D molecular weight cutoff dialysis tubing. The resulting liquid was sterilized by filtration to yield pGL3-control-CaLNP, designated 3-1. The content was measured to be 35 μg / ml, the encapsulation efficiency was 91.01%, and the average particle size was 125.9 nm.

[0380] A 0.5 mg / 0.5 ml EGFP plasmid was added to 4 ml of 200 mmol / l calcium acetate solution at pH 5 and mixed thoroughly to form the aqueous phase. The organic phase was mixed at 4 ml / min and the aqueous phase at 18 ml / min using a T-tube to collect the intermediate. The intermediate was adjusted to pH 7 and dialyzed against Tris buffer at pH 7.4 using an 8000D molecular weight cutoff dialysis bag. The inner solution was collected and sterilized by filtration to obtain EGFP-CaLNPs, designated 3-2. The measured content was 31 μg / ml, the encapsulation efficiency was 95.70%, and the average particle size was 117.4 nm.

[0381] After ultrafiltration and concentration, the content is 1mg / ml.

[0382] The pGL3-control plasmid was commercially purchased from Promega.

[0383] The sequence is:

[0384] Seq No 2:

[0385] Example 4. Preparation of mRNA-CaLNP preparations by different calcium acetate addition methods.

[0386] Take 400mmol / l calcium acetate-acetate buffer with a pH value of 5 as the aqueous phase, weigh 65.0mg of DLin-MC3-DMA, 31.0mg of cholesterol, 16.5mg of DSPC, and 8.0mg of PEG2000-DMG, and dissolve them in 10ml of ethanol to form the organic phase; the organic phase is 4ml / min, and the aqueous phase is 18ml / min, mixed using a microfluidic chip, and the intermediate ① is collected. Intermediate ① is dialyzed using a 300KDa tangential flow membrane bag, and the dialysate is 25mmol / l sodium acetate-acetate buffer with a pH of 4.0. When the dialysis external liquid volume is 200ml, the dialysis is completed, the volume is fixed, and 10mL of internal liquid is obtained, which is intermediate ②. Take 0.855ml of intermediate ②, add 0.200ml of ethanol and mix well, then add 0.045ml of 1mg / ml Firefly Luciferase mRNA (N 1 -Me-Pseudo UTP) was mixed thoroughly, and 100 mmol / l sodium hydrogen phosphate solution was added to adjust the pH to 7.4. The mixture was dialyzed on ice in PBS buffer (pH 7.4) using an 8000D molecular weight cutoff dialysis tubing. The internal solution was collected and sterilized by filtration to obtain mRNA-CaLNPs, designated 4-1. The measured content was 17 μg / ml, the encapsulation efficiency was 44.30%, and the average particle size was 169.6 nm.

[0387] Take 0.4mg Firefly Luciferase mRNA(N 1-Me-Pseudo UTP) was added to 3.2 ml of 28 mmol / l sodium acetate-acetate buffer at pH 4 to form aqueous phase 1. 65.0 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG2000-DMG were weighed and dissolved in 10 ml of ethanol to form the organic phase. A 400 mmol / l calcium acetate solution at pH 5 was used as aqueous phase 2. The organic phase was mixed at 4 ml / min and aqueous phase 1 at 18 ml / min using a microfluidic chip to collect intermediate ①. The organic phase was mixed at 4 ml / min and aqueous phase 2 at 18 ml / min using a microfluidic chip to collect intermediate A. 1 ml of intermediate ① was added to 1 ml of A and mixed thoroughly to obtain intermediate ②. Intermediate ② was mixed with 0.4 mol / l Tris buffer (pH 9) at 8 ml / min using a microfluidic chip. Intermediate ③ was collected and dialyzed on ice in Tris buffer (pH 7.4) using an 8000D dialysis bag. The internal phase of the dialysate was collected and sterilized by filtration to obtain mRNA-CaLNPs, designated 4-2. The measured content was 17 μg / ml, the encapsulation efficiency was 97.64%, and the average particle size was 90.8 nm.

[0388] Take 0.4ml 1mg / ml Firefly Luciferase mRNA(N 1 -Me-Pseudo UTP) was added to 3.2 ml of 28 mmol / l sodium acetate-acetic acid buffer at pH 4 to form aqueous phase 1. 65.0 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG2000-DMG were weighed and dissolved in 10 ml of ethanol to form the organic phase. An 800 mmol / l calcium acetate-acetic acid solution was used as aqueous phase 2. The organic phase was mixed at 4 ml / min and aqueous phase 1 at 18 ml / min on a microfluidic chip to collect intermediate ①. Intermediate ① was mixed at 5 ml / min and aqueous phase 2 at 20 ml / min on a microfluidic chip to collect the finished product. The product was dialyzed in an ice bath against Tris buffer at pH 7.4 using an 8000D molecular weight cutoff dialysis bag. The internal phase dialyzate was collected and sterilized by filtration to obtain calcium-containing mRNA-CaLNP, labeled 4-3. The content was measured to be 9 μg / ml, the encapsulation efficiency was 100%, and the average particle size was 207.4 nm.

[0389] Take 0.4mg Firefly Luciferase mRNA(N 1-Me-Pseudo UTP) was added to 3.2 ml of 28 mmol / l sodium acetate-acetate buffer at pH 4 to form aqueous phase 1. 65.0 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG2000-DMG were weighed and dissolved in 10 ml of ethanol to form the organic phase. 400 mmol / l calcium acetate solution at pH 8 was used as aqueous phase 2. The organic phase was mixed at 4 ml / min and aqueous phase 1 at 18 ml / min using a microfluidic chip to collect intermediate ①. The organic phase was mixed at 4 ml / min and aqueous phase 2 at 18 ml / min using a microfluidic chip to collect intermediate A. 1 ml of intermediate ① was mixed with 8 ml of A to form intermediate ②. The solution was dialyzed in Tris buffer at pH 7.4 on an ice bath using an 8000D molecular weight cutoff dialysis bag. The internal dialyzate was collected and sterilized by filtration to obtain mRNA-CaLNP, labeled 4-4. The content was measured to be 19 μg / ml, and the encapsulation efficiency was 60.49%.

[0390] Example 5. Preparation of siRNA-CaLNP preparations by different calcium acetate addition methods.

[0391] Weigh 65.0 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG2000-DMG, and dissolve them in 10 ml of ethanol to form the organic phase.

[0392] 1 mg of GAPDH siRNA (Seq No. 1) was added to 1 ml of water, followed by 8 ml of 28 mmol / l sodium acetate-acetic acid buffer at pH 4 as aqueous phase 1, and 400 mmol / l calcium acetate-acetic acid solution at pH 5 as aqueous phase 2. The organic phase was mixed at 4 ml / min and aqueous phase 1 at 18 ml / min on a microfluidic chip, collecting intermediate ①. The organic phase was mixed at 4 ml / min and aqueous phase 2 at 18 ml / min on a microfluidic chip, collecting intermediate A. 1 ml of intermediate ① was mixed with 1 ml of A to obtain intermediate ②. This was dialyzed against Tris buffer at pH 7.4 using an 8000 molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to yield siRNA-CaLNPs, designated 5-1. The measured content was 34 μg / ml, the encapsulation efficiency was 81.61%, and the average particle size was 121.4 nm.

[0393] 1 mg of siRNA (Seq No. 1) was added to 1 ml of water, followed by 8 ml of 28 mmol / l sodium acetate-acetate buffer (pH 4) to form aqueous phase 1. The organic phase was mixed at 4 ml / min, and aqueous phase 1 at 18 ml / min, using a microfluidic chip to collect intermediate 1. 30.0 mg of cholesterol and 30 mg of EPC were weighed and dissolved in 10 ml of ethanol to form intermediate A. Intermediate B was prepared by mixing intermediates A and B in a 400 mmol / l calcium acetate solution at 4 ml / min and 18 ml / min, respectively, using a microfluidic chip to collect intermediate 2. Intermediate 2 was mixed at 20 ml / min and intermediate 1 at 2.5 ml / min, using a microfluidic chip to collect intermediate 3. The mixture was dialyzed against Tris buffer (pH 7.4) using an 8000D molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to yield siRNA-CaLNP, designated 5-2. The content was measured to be 9 μg / ml, the encapsulation efficiency was 83.72%, and the average particle size was 111.8 nm.

[0394] 1 mg of siRNA (Seq No. 1) was added to 1 ml of water, followed by 8 ml of 28 mmol / l sodium acetate-acetic acid buffer (pH 4) as aqueous phase 1; 400 mmol / l acetic acid solution as aqueous phase 2. The organic phase was mixed at 4 ml / min and aqueous phase 1 at 18 ml / min on a microfluidic chip, collecting intermediate ①. Intermediate ① was mixed at 2.5 ml / min and aqueous phase 2 at 16.3 ml / min on a microfluidic chip, collecting the finished product, and dialyzing it on ice against Tris buffer (pH 7.4) using an 8000D molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to obtain siRNA-CaLNPs, designated 5-3. The measured content was 31 μg / ml, the encapsulation efficiency was 91.16%, and the average particle size was 88.7 nm.

[0395] 1 mg of siRNA (Seq No. 1) was added to 1 ml of water, followed by 8 ml of 28 mmol / l sodium acetate-acetate buffer (pH 4) as aqueous phase 1 and the organic phase; 800 mmol / l calcium acetate solution as aqueous phase 2. The organic phase was mixed at 4 ml / min and aqueous phase 1 at 18 ml / min on a microfluidic chip, collecting intermediate ①. Intermediate ① was mixed at 2.5 ml / min and aqueous phase 2 at 10 ml / min on a microfluidic chip, collecting the finished product, which was dialyzed on ice in Tris buffer (pH 7.4) using an 8000D molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to yield siRNA-CaLNPs, designated 5-4. The measured content was 37.11 μg / ml, the encapsulation efficiency was 97.56%, and the average particle size was 76.4 nm.

[0396] Table 4 Cholesterol and DSPC test data of each preparation in Example 5

[0397] Example 6. For comparison with calcium-containing formulations, a calcium-free siRNA-LNP formulation was prepared.

[0398] 65.0 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG2000-DMG were weighed and dissolved in 10 ml of ethanol to form the organic phase. 0.1 mg of GAPDH siRNA (Seq No. 1) was added to 0.9 ml of a 28 mmol / l sodium acetate-acetic acid solution at pH 4 and mixed thoroughly to form the aqueous phase. 0.9 ml of the aqueous phase was manually mixed with 0.2 ml of the organic phase to obtain intermediate ①. This was dialyzed against PBS buffer at pH 7.4 using an 8000D molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to obtain calcium-free siRNA-LNP, designated 6-1. The measured content was 57 μg / ml, the encapsulation efficiency was 97.07%, and the average particle size was 102.6 nm.

[0399] Table 5 Cholesterol and DSPC test data of each preparation in Example 6

[0400] Example 7. For comparison with a calcium-containing formulation, a calcium-free mRNA-LNP formulation was prepared.

[0401] Take 0.4ml 1mg / ml Firefly Luciferase mRNA(N 1 -Me-Pseudo UTP) was added to 3.2 ml of 28 mmol / l sodium acetate-acetate buffer at pH 4 to form the aqueous phase. 65.0 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG2000-DMG were weighed and dissolved in 10 ml of ethanol to form the organic phase. The organic phase was mixed at 4 ml / min and the aqueous phase at 18 ml / min using a microfluidic chip to collect the intermediate product ①. Dialysis was performed on an ice bath in PBS buffer at pH 7.4 using an 8000D molecular weight cutoff dialysis bag. The internal phase dialyzate was collected and sterilized by filtration to obtain calcium-free mRNA-LNP, designated 7-1. The measured content was 26 μg / ml, the encapsulation efficiency was 96.82%, and the average particle size was 96.9 nm.

[0402] Example 8. For comparison with calcium-containing formulations, a DNA-LNP formulation without calcium was prepared.

[0403] 65.0 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG2000-DMG were weighed and dissolved in 10 ml of ethanol to form the organic phase. 1.0 mg / ml of pGL3-control plasmid was added to 8 ml of 28 mmol / l sodium acetate-acetate buffer (pH 4.0) and mixed thoroughly to form the aqueous phase. The organic phase and the aqueous phase were mixed using a microfluidic chip at 4 ml / min and 18 ml / min, respectively. Intermediate product ① was collected. Dialysis was performed on an ice bath using an 8000D dialysis bag with a molecular weight cutoff (MWCO) against PBS buffer (pH 7.4). The internal phase was collected and sterilized by filtration to obtain the calcium-free DNA-LNP, designated 8-1. The measured content was 54 μg / ml, the encapsulation efficiency was 97.22%, and the average particle size was 106.2 nm.

[0404] Example 9. Preparation of siRNA-CaLNPs with Different Ionizable Cationic Materials and Neutral Lipids

[0405] 65.0 mg of DLinDMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG2000-DMG were weighed and dissolved in 10 ml of ethanol to form the organic phase. 0.1 mg of GAPDH siRNA (Seq. No. 1) was added to 0.9 ml of 200 mmol / l calcium acetate solution at pH 5 and mixed thoroughly to form the aqueous phase. 0.9 ml of the aqueous phase was manually mixed with 0.2 ml of the organic phase to obtain an intermediate. The intermediate was dialyzed against Tris buffer at pH 7.4 using an 8000D molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to obtain siRNA-CaLNPs, designated 9-1. The measured content was 17 μg / ml, the encapsulation efficiency was 77.54%, and the average particle size was 268.7 nm. 0.1 mg of GAPDH siRNA was added to 0.9 ml of 25 mmol / l sodium acetate solution at pH 4 and mixed thoroughly. This served as the aqueous phase. 0.9 ml of the aqueous phase was then manually mixed with 0.2 ml of the organic phase to produce an intermediate. The intermediate was dialyzed against Tris buffer at pH 7.4 using an 8000D molecular weight cutoff dialysis bag. The dialysate was collected and sterilized by filtration to yield siRNA-LNPs, designated 9-2. The measured content was 36 μg / ml, the encapsulation efficiency was 92.64%, and the average particle size was 91.94 nm.

[0406] 65.0 mg of DODMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG2000-DMG were weighed and dissolved in 10 ml of ethanol to form the organic phase. 0.1 mg of GAPDH siRNA (Seq. No. 1) was added to 0.9 ml of 200 mmol / l calcium acetate solution at pH 5 and mixed thoroughly to form the aqueous phase. 0.9 ml of the aqueous phase was manually mixed with 0.2 ml of the organic phase to obtain an intermediate. The intermediate was dialyzed against Tris buffer at pH 7.4 using an 8000D molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to obtain siRNA-CaLNPs, designated 9-3. The measured content was 33 μg / ml, the encapsulation efficiency was 83.93%, and the average particle size was 139.7 nm. 0.1 mg of GAPDH siRNA (Seq. No. 1) was added to 0.9 ml of 25 mmol / l sodium acetate solution at pH 4 and mixed thoroughly. This served as the aqueous phase. 0.9 ml of the aqueous phase was then manually mixed with 0.2 ml of the organic phase to produce an intermediate. The intermediate was dialyzed against Tris buffer at pH 7.4 using an 8000D molecular weight cutoff dialysis tubing. The dialyzate was collected and sterilized by filtration to yield the siRNA-LNP, designated 9-4. The measured content was 36 μg / ml, the encapsulation efficiency was 88.88%, and the average particle size was 91.91 nm.

[0407] 65.0 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DOPE, and 8.0 mg of PEG2000-DMG were weighed and dissolved in 10 ml of ethanol to form the organic phase. 0.1 mg of GAPDH siRNA (Seq. No. 1) was added to 0.9 ml of 200 mmol / l calcium acetate solution at pH 5 and mixed thoroughly to form the aqueous phase. 0.9 ml of the aqueous phase was manually mixed with 0.2 ml of the organic phase to obtain an intermediate. The intermediate was dialyzed against Tris buffer at pH 7.4 using an 8000D molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to obtain siRNA-CaLNPs, designated 9-5. The measured content was 32 μg / ml, the encapsulation efficiency was 95.83%, and the average particle size was 105.4 nm. 0.1 mg of GAPDH siRNA was added to 0.9 ml of 25 mmol / l sodium acetate solution at pH 4 and mixed thoroughly. This served as the aqueous phase. 0.9 ml of the aqueous phase was then manually mixed with 0.2 ml of the organic phase to produce an intermediate. The intermediate was then dialyzed against Tris buffer at pH 7.4 using an 8000D molecular weight cutoff dialysis bag. The dialysate was collected and sterilized by filtration to yield siRNA-LNPs, designated 9-6. The measured content was 32 μg / ml, the encapsulation efficiency was 93.37%, and the average particle size was 93.38 nm.

[0408] 65.0 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DOPC, and 8.0 mg of PEG2000-DMG were weighed and dissolved in 10 ml of ethanol to form the organic phase. 0.1 mg of GAPDH siRNA (Seq. No. 1) was added to 0.9 ml of 200 mmol / l calcium acetate solution at pH 5 and mixed thoroughly to form the aqueous phase. 0.9 ml of the aqueous phase was manually mixed with 0.2 ml of the organic phase to obtain an intermediate. The intermediate was dialyzed against Tris buffer at pH 7.4 using an 8000D molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to obtain siRNA-CaLNPs, designated 9-7. The measured content was 33 μg / ml, the encapsulation efficiency was 94.83%, and the average particle size was 87.43 nm. 0.1 mg of GAPDH siRNA was added to 0.9 ml of 25 mmol / l sodium acetate solution at pH 4 and mixed thoroughly. This served as the aqueous phase. 0.9 ml of the aqueous phase was then manually mixed with 0.2 ml of the organic phase to obtain an intermediate. The intermediate was dialyzed against Tris buffer at pH 7.4 using an 8000D molecular weight cutoff dialysis bag. The dialysate was collected and sterilized by filtration to yield siRNA-LNPs, designated 9-8. The measured content was 36 μg / ml, the encapsulation efficiency was 94.75%, and the average particle size was 74.86 nm.

[0409] Example 10. Preparation of calcium acetate siRNA-CaLNP preparations with different concentrations.

[0410] 32.5 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG-DMG were weighed and dissolved in 10 mL of ethanol to form the organic phase. 0.2 mg of siRNA (human GAPDH) was diluted with 1.8 mL of calcium acetate solution of varying concentrations to form the aqueous phase. The pH of the calcium acetate solution was adjusted to 5 using acetic acid. 1.8 mL of the aqueous phase and 0.4 mL of the organic phase were mixed at a total flow rate of 22 mL / min through a T-junction tube to obtain intermediate ①. This intermediate was dialyzed against a Tris buffer at pH 7.2 using a 14000D molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to obtain siRNA-CaLNP. The calcium acetate solutions of varying concentrations in Table 6 are 25 mmol / L, 50 mmol / L, 100 mmol / L, 200 mmol / L, and 400 mmol / L.

[0411] Table 6. Characteristics of siRNA-CaLNP formulations in Example 10

[0412] Example 11. Preparation of siRNA-CaLNP Preparations in Calcium Acetate Solutions with Different pH Values

[0413] 32.5 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG-DMG were weighed and dissolved in 10 ml of ethanol to form the organic phase. 0.2 mg of siRNA (human GAPDH gene) was diluted with 1.8 ml of 200 mmol / l calcium acetate solution to form the aqueous phase. The calcium acetate solution was adjusted to different pH values ​​with acetic acid. 1.8 ml of the aqueous phase and 0.4 ml of the organic phase were mixed through a T-junction at a total flow rate of 22 ml / min to obtain intermediate ①. This was dialyzed against a Tris buffer containing pH 7.2 using a 14000 D molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to obtain siRNA-CaLNP. The different pH values ​​of the 200 mmol / l calcium acetate solution in Table 7 are pH 4.5, pH 4.8, pH 5.0, pH 5.2, and pH 5.5.

[0414] Table 7. Characteristics of siRNA-CaLNP formulations in this study

[0415] Through the preparation under different pH conditions, it can be known that the pH value of CaLNP is applicable in a wide range, and good preparation effects can be obtained under acidic conditions (such as pH 4.5-5.5).

[0416] Example 12 Preparation of siRNA-CaLNP Preparations with Different N / P Ratios

[0417] 32.5 mg of DLin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG-DMG were weighed and dissolved in 10 ml of ethanol to form the organic phase. Different amounts of siRNA (human GAPDH gene) were diluted with 1.8 mL of 200 mmol / L calcium acetate solution (pH 5.0) and 400 mmol / L calcium acetate solution (pH 5.0) to form the aqueous phase. The pH of the calcium acetate solution was adjusted with acetic acid. 1.8 mL of the aqueous phase and 0.4 mL of the organic phase were mixed in a three-way tube at a total flow rate of 22 mL / min to obtain intermediate ①. This was dialyzed in a Tris buffer containing pH 7.2 using a 14000D molecular weight cutoff dialysis bag. The internal phase dialyzate was collected and sterilized by filtration to obtain siRNA-CaLNP. The amounts of siRNA in Table 8 are 0.1 mg, 0.2 mg, and 0.4 mg, respectively.

[0418] Table 8 Preparation of LNPs with the same calcium acetate ion concentration and different N / P ratios

[0419] Example 13. Preparation of different types of cationic lipid siRNA-CaLNP preparations

[0420] Weigh different types of cationic lipids, cholesterol 31.0mg, DSPC 16.5mg, and PEG-DMG 8.0mg and dissolve them in 10ml of ethanol to form the organic phase. Take 0.2mg of siRNA (human GAPDH gene) and dilute it with 1.8ml of 200mmol / l calcium acetate solution (pH 5.0) to form the aqueous phase. The pH of the calcium acetate solution is adjusted with acetic acid. Take 1.8ml of the aqueous phase and 0.4ml of the organic phase and mix them in a three-way pipe at a total flow rate of 22ml / min to obtain intermediate ①. Use a dialysis bag with a molecular weight cutoff of 14000D and dialyze it in Tris buffer at pH 7.2. The internal phase dialyzate is collected and sterilized by filtration to finally obtain siRNA-CaLNP. The type and amount of cations in Table 9 are Dlin-MC3-DMA 32.5mg, Dlin-DMA 32.5mg, SM102 35.9mg, and DOTAP 35.0mg, respectively.

[0421] Table 9 Preparation of different types of cationic lipid siRNA-CaLNP formulations

[0422] Example 14 Preparation of different amounts of cationic lipid siRNA-CaLNP preparations

[0423] Different amounts of Dlin-MC3-DMA, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG-DMG were weighed and dissolved in 10 ml of ethanol to form the organic phase. Different amounts of siRNA (human GAPDH gene) were diluted with 1.8 ml of 200 mmol / l calcium acetate solution (pH 5.0) to form the aqueous phase. The pH of the calcium acetate solution was adjusted with acetic acid. 1.8 ml of the aqueous phase and 0.4 ml of the organic phase were mixed through a T-junction at a total flow rate of 22 ml / min to obtain intermediate ①. This was dialyzed against Tris buffer at pH 7.2 using a 14,000 molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to obtain siRNA-CaLNP. The dosages of Dlin-MC3-DMA and siRNA in Table 10 are Dlin-MC3-DMA 65 mg and siRNA 0.4 mg, Dlin-MC3-DMA 32.5 mg and siRNA 0.2 mg, and Dlin-MC3-DMA 16.3 mg and siRNA 0.1 mg, respectively.

[0424] Table 10 Preparation of siRNA-CaLNP formulations with different amounts of cationic lipids

[0425] Example 15. Preparation of different amounts of neutral lipid siRNA-CaLNP preparations

[0426] 32.5mg of DLin-MC3-DMA, 31.0mg of cholesterol, various amounts of DSPC, and 8.0mg of PEG-DMG were weighed and dissolved in 10ml of ethanol to form the organic phase. 0.2mg of siRNA (human GAPDH gene) was diluted with 1.8ml of 200mmol / l calcium acetate solution (pH 5.0) to form the aqueous phase. The calcium acetate was adjusted to pH 5 with acetic acid. 1.8ml of the aqueous phase and 0.4ml of the organic phase were mixed in a three-way tube at a total flow rate of 22ml / min to obtain intermediate ①. This was dialyzed in a Tris buffer with a molecular weight cutoff of 14000D using a dialysis bag. The internal phase dialyzate was collected and sterilized by filtration to obtain siRNA-CaLNP. The various amounts of DSPC in Table 11 were 33.0mg, 16.5mg, 8.3mg, and 0mg, respectively.

[0427] Table 11 Preparation of siRNA-CaLNP formulations with different amounts of neutral lipids

[0428] Example 16. Preparation of siRNA-CaLNP Formulations with Different Amounts of Cholesterol

[0429] 32.5mg of DLin-MC3-DMA, various amounts of cholesterol, 16.5mg of DSPC, and 8.0mg of PEG-DMG were weighed and dissolved in 10ml of ethanol to form the organic phase. 0.2mg of siRNA (human GAPDH gene) was diluted with 1.8ml of 200mmol / l calcium acetate solution (pH 5.0) to form the aqueous phase. The calcium acetate was adjusted to pH 5 with acetic acid. 1.8ml of the aqueous phase and 0.4ml of the organic phase were mixed in a T-junction at a total flow rate of 22ml / min to obtain intermediate ①. This was dialyzed in a Tris buffer with a 14000D molecular weight cutoff using a dialysis bag. The internal phase dialyzate was collected and sterilized by filtration to obtain siRNA-CaLNP. The various amounts of Chol in Table 12 were 62.0mg, 31.0mg, 15.5mg, and 0mg, respectively.

[0430] Table 12 Preparation of siRNA-CaLNP formulations with different amounts of cholesterol

[0431] Example 17. Preparation of siRNA-CaLNP formulations with different amounts of PEG lipids

[0432] 32.5mg of DLin-MC3-DMA, 31.0mg of cholesterol, 16.5mg of DSPC, and various amounts of PEG-DMG were weighed and dissolved in 10ml of ethanol to form the organic phase. 0.2mg of siRNA (human GAPDH gene) was diluted with 1.8ml of 200mmol / l calcium acetate solution (pH 5.0) to form the aqueous phase. The calcium acetate was adjusted to pH 5 with acetic acid. 1.8ml of the aqueous phase and 0.4ml of the organic phase were mixed in a T-tube at a total flow rate of 22ml / min to obtain intermediate ①. Dialysis was performed using a 14000D molecular weight cutoff dialysis bag against a Tris buffer at pH 7.2. The internal phase dialyzate was collected and sterilized by filtration to obtain siRNA-CaLNP. The various amounts of PEG-DMG in Table 13 were 16.0mg, 8.0mg, 4.0mg, and 0mg, respectively.

[0433] Table 13 Preparation of siRNA-CaLNP formulations with different amounts of PEG lipids

[0434] Example 18. Preparation of siRNA-LNP formulations containing different types of cationic lipids

[0435] Weigh different cationic lipids, 31.0 mg of cholesterol, 16.5 mg of DSPC, and 8.0 mg of PEG-DMG and dissolve them in 10 ml of ethanol to form the organic phase. Different amounts of siRNA (human GAPDH gene) were diluted with 1.8 ml of a 25 mmol / L acetic acid-sodium acetate solution (pH 4.0) to form the aqueous phase. The 25 mmol / L acetic acid-sodium acetate solution was adjusted to pH 4.0 with acetic acid. 1.8 ml of the aqueous phase and 0.4 ml of the organic phase were mixed at a total flow rate of 22 ml / min through a T-junction to obtain intermediate ①. The intermediate was dialyzed against PBS buffer at pH 7.2 using a 14,000 molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to obtain the siRNA-LNP. The different types of cationic lipids and different amounts of siRNA in Table 14 are Dlin-MC3-DMA 65 mg and 0.4 mg, Dlin-MC3-DMA 32.5 mg and 0.2 mg, Dlin-DMA 65 mg and 0.4 mg, Dlin-DMA 32.5 mg and 0.2 mg, SM102 71.8 mg and 0.4 mg, SM102 35.9 mg and 0.2 mg, DOTAP 70.0 mg and 0.4 mg, and DOTAP 35.0 mg and 0.2 mg, respectively.

[0436] Table 14 Preparation of siRNA-LNP formulations with different types of cationic lipids

[0437] Preparations coded 10-4, 12-2, 13-1, 14-2, 15-2, 16-2 and 17-2 are from the same batch of preparations and are marked with different codes in different examples.

[0438] Experimental Example 1. GAPDH siRNA cell transfection experiment

[0439] Cell culture:

[0440] Human liver cancer cell line HepG2 was cultured in 90% DMEM medium + 10% fetal bovine serum + 1% double-antibody medium, incubated at 37°C in a 5% CO2 atmosphere, and observed under an inverted microscope. Cells in the logarithmic growth phase were selected and digested with 0.25% trypsin for counting and plating. (1) Discard the culture medium, add 2ml PBS solution to wash once, and discard the PBS. (2) Add 1ml 0.25% trypsin, spread evenly from top to bottom and left to right, and digest at 37°C for 10 minutes. Observe at any time. When the cells flow down in a muddy state, the digestion is complete. (3) Add 1ml culture medium to stop the digestion. Repeatedly blow the digested cells to detach the wall and disperse them to make a cell suspension. Centrifuge and discard the supernatant. (4) Resuspend the cells in culture medium and count them on a counting plate. 2ml culture medium was added to each six-well plate, and 300,000 cells were seeded per well. Cultured for 24 hours. Drug addition began when the cells grew to 70%-80%.

[0441] Drug addition and cell treatment:

[0442] When cells reached 70%-80% growth, drugs were added. Positive control (100 nM siRNA, Seq. No. 1): 5.4 μl of 1 mg / ml siRNA plus 8 μl of lipofectamin 3000 solution was added to 200 μl of serum-free DMEM and diluted sequentially to various concentrations. For negative control (direct addition of PBS), each drug was prepared in serum-free DMEM to the desired concentration. After preparation, 100 μl was added to the corresponding six-well plate. Culture was continued for 24 hours. Cells in the six-well plate were digested, harvested, and analyzed by RT-qPCR.

[0443] RT-qPCR:

[0444] Biotech RNAeasy TM RNA was extracted using the Animal RNA Extraction Kit (spin column type) and BeyoFast TM SYBR Green One-step qRT-PCR Kit was used for one-step reverse transcription real-time fluorescence quantitative PCR.

[0445] (1) RNA extraction: The collected cells were centrifuged at 1500 g, the supernatant was discarded, 1 ml of PBS was added, and the cells were centrifuged at 1500 g, the supernatant was discarded, 0.3 ml of lysis buffer was added, and the cells were vortexed. 0.3 ml of binding buffer was added and the cells were vortexed.

[0446] The mixture was transferred to a purification column, centrifuged at 12000 g for 30 s, and the liquid in the tube was discarded;

[0447] Add 600 μl of washing solution 1, centrifuge at 12000 g for 30 s, and discard the liquid in the tube;

[0448] Add 600 μl of washing solution 2, centrifuge at 12,000 g for 30 s, discard the liquid in the tube, and repeat this operation;

[0449] Centrifuge at a maximum speed of 14000g for 2 minutes to remove the remaining liquid;

[0450] Discard the lower centrifuge tube, replace it with an RNA elution tube, add 50 μl of elution buffer (add as much as possible into the groove), place it at room temperature for 2 minutes, and centrifuge it at 14000g for 2 minutes. The resulting solution is the purified RNA.

[0451] (2) Template preparation: Dilute the extracted RNA 50-fold with RNase-free water;

[0452] (3) Primer preparation: A: The amount of each sample added (20 μl) is as follows: 10 μl SYBR Green One-Step Reaction Buffer (2X); 2 μl SYBR Green One-Step Enzyme Mix (10X); 0.4 μl Low ROX (50X); 3.6 μl RNase-free water; 2 μl template sample; 2 μl primers containing 3 nmol / ml each of GAPDH-F and GAPDH-R (GAPDH-F sequence: CTTCTTTTGCGTCGCCAGCC, GAPDH-R sequence: GTTCTCAGCCTTGACGGTGC).

[0453] B: The amount of each sample added (20 μl) was: 10 μl SYBR Green One-Step Reaction Buffer (2X); 2 μl SYBR Green One-Step Enzyme Mix (10X); 0.4 μl Low ROX (50X); 3.6 μl RNase-free water; 2 μl template sample; 2 μl primers containing 3 nmol / ml each of β-αctin-F and β-αctin-R (β-αctin-F sequence: CCTGGCACCCAGCACAAT, β-αctin-R sequence: GGGCCGGACTCGTCATAC).

[0454] The samples were added to the corresponding 96-well plate or 8-well tube for RT-qPCR and detected on a real-time fluorescence quantitative PCR instrument according to the kit instructions. β-actin was used as the reference gene and the ΔΔCt method was used to calculate the relative expression of GAPDH mRNA.

[0455] The comparison results are shown in Figures 1-4.

[0456] Experimental Example 2. Exploration of the Mechanism of CaLNP Enhanced Gene Expression Compared with LNP

[0457] As in the above test example, CaLNP and LNP cell transfection of GAPDH siRNA was performed, but at the same time, calcium acetate or liposomes encapsulating calcium acetate (A) were added to the LNP group (Example 6-1) to investigate whether it improves the efficiency of gene knockdown at the cellular level. The results are shown in Figure 5. As can be seen, adding the maximum amount of free calcium acetate corresponding to Example 5-2 to the control LNP of Example 6-1 did not improve the transfection efficiency of the LNP, while adding liposome-encapsulated calcium acetate helped, but not as well as the CaLNP generated after mixing in Example 1-4. It is speculated that the lipid nanoparticles encapsulating the gene and calcium in the same inclusion body help the inclusion body escape.

[0458] The drug preparation is as follows:

[0459] 100 μl of drug was added to each well of the six-well plate.

[0460] Liposome A was prepared as follows:

[0461] Weigh 30.0 mg of cholesterol and 30 mg of EPC, dissolve them in 10 ml of ethanol (10 mg) to obtain intermediate A. Dissolve 400 mmol / l of calcium acetate solution to obtain intermediate B. Mix the mixture using a microfluidic chip at a flow rate of 4 ml / min for A and 18 ml / min for B. Collect the intermediates, dialyze through an 8 kDa dialysis membrane, collect the internal phase, and filter-sterilize.

[0462] Experimental Example 5. Firefly luciferase mRNA cell transfection experiment

[0463] Cell culture:

[0464] Human liver cancer cell line HepG2 was cultured in 90% DMEM medium + 10% fetal bovine serum + 1% double-antibody medium, incubated at 37°C in a 5% CO2 atmosphere, and observed under an inverted microscope. Cells in the logarithmic growth phase were selected and digested with 0.25% trypsin for counting and plating. (1) Discard the culture medium, add 2ml PBS solution to wash once, and discard the PBS. (2) Add 1ml 0.25% trypsin, spread evenly from top to bottom and left to right, and digest at 37°C for 10 minutes. Observe at any time. When the cells flow down in a muddy state, the digestion is complete. (3) Add 1ml culture medium to stop the digestion. Repeatedly blow the digested cells to detach the wall and disperse them to make a cell suspension. Centrifuge and discard the supernatant. (4) Resuspend the cells in culture medium and count them on a counting plate. 10,000 cells / well were seeded with 0.1ml culture medium in each white opaque 96-well plate. After 24 hours of culture, drug addition began.

[0465] Dosing and testing:

[0466] When cells reach 70%-80% growth, add drugs. Positive control (mRNA): 4μl 1mg / ml mRNA + 6μl lipofectamin 3000 solution, add serum-free DMEM culture medium to 150μl, mix thoroughly, incubate at room temperature for 10-15 minutes, and then dilute to different concentrations. Each drug is prepared in serum-free DMEM to the desired concentration. After the drug is prepared, add 10μl to the corresponding 96-well plate. Continue incubation for 24 hours. Equilibrate the cell culture plate at room temperature for 10 minutes, add 100μl Bright-Glo™ to each well, incubate at room temperature for 5 minutes, and perform luminescence detection using a multi-function fluorescence microplate reader at a wavelength of 562nm.

[0467] The results are shown in Figures 6 and 7.

[0468] Experimental Example 6. Luciferase plasmid pGL3-control cell transfection experiment

[0469] Cell culture:

[0470] Human liver cancer cell line HepG2 was cultured in 90% DMEM medium + 10% fetal bovine serum + 1% double-antibody medium, incubated at 37°C in a 5% CO2 atmosphere, and observed under an inverted microscope. Cells in the logarithmic growth phase were selected and digested with 0.25% trypsin for counting and plating. (1) Discard the culture medium, add 2ml PBS solution to wash once, and discard the PBS. (2) Add 1ml 0.25% trypsin, spread evenly from top to bottom and left to right, and digest at 37°C for 10 minutes. Observe at any time. When the cells flow down in a muddy state, the digestion is complete. (3) Add 1ml culture medium to stop the digestion. Repeatedly blow the digested cells to detach the wall and disperse them to make a cell suspension. Centrifuge and discard the supernatant. (4) Resuspend the cells in culture medium and count them on a counting plate. 10,000 cells / well were seeded in 0.1ml culture medium per white opaque 96-well plate. Culture for 24 hours. Add drugs when the cells grow to 70%-80%.

[0471] Dosing and testing:

[0472] When cells reached 70%-80% growth, drugs were added. Positive control (pGL3): 1.5 μl of 1 mg / ml pGL3 solution plus 3 μl of P3000 solution was added to 75 μl of serum-free DMEM medium and mixed thoroughly to form A. 2.3 μl of lipofectamin 3000 was added to 75 μl of serum-free DMEM medium and mixed thoroughly to form B. A and B were mixed and incubated at room temperature for 10-15 minutes, then diluted sequentially to different concentrations. Each drug was prepared in serum-free DMEM to the desired concentration. After preparation, 10 μl was added to the corresponding 96-well plate. Culture was continued for 24 hours. The cell culture plate was equilibrated at room temperature for 10 minutes. 100 μl of Bright-Glo™ was added to each well and incubated at room temperature for 5 minutes. Luminescence was detected using a multi-function fluorescence microplate reader at a wavelength of 562 nm. Results are shown in Figure 8.

[0473] Experimental Example 7. In vivo transfection efficiency of luciferase mRNA and plasmid DNA - in vivo imaging experiment

[0474] C57BL / 6 mice, 8-10 weeks old, male, 25-30 g, were selected and 100 μl of the drug was administered via the tail vein. In vivo imaging was performed 24 hours later.

[0475] Drug concentration:

[0476] In vivo imaging: 24 hours after administration, (1) weigh 75 mg of potassium luciferin into a 15 ml centrifuge tube and dissolve thoroughly in 5 ml of D-PBS to a concentration of 15 mg / ml. (2) Filter the solution through a 0.22 μm sterile filter into another 15 ml centrifuge tube for later use (prepare immediately before use). (3) Intraperitoneally inject 10 μl / g body weight of potassium luciferin into an anesthetized and depilated mouse. (4) 10-20 minutes after injection, perform imaging analysis using appropriate instruments. (5) Re-inject the mouse with potassium luciferin solution and dissect it 4 minutes later. Remove various organs (heart, liver, spleen, lung, and kidney) for imaging examination.

[0477] The results are shown in Figures 9 and 10.

[0478] Experimental Example 8. GAPDH siRNA Silencing Efficiency in Vitro by siRNA-CaLNP and siRNA-LNP

[0479] HepG2 cells in the logarithmic growth phase were cultured at a rate of 1×10 5 Cells were seeded in 24-well plates at a concentration of 0.5 mL / well and incubated at 37°C, 5% CO₂ for 24 hours to allow attachment. Following incubation, the preparation sample was added to each well to a final GAPDH siRNA concentration of approximately 10 nM. PBS-treated cells served as a negative control and were cultured in a 37°C, 5% CO₂ incubator for a further 24 hours. The culture medium was then discarded, the cells rinsed once with PBS, and total RNA was extracted. Fluorescence quantitative PCR was used to determine the inhibitory effect of GAPDH-siRNA on GAPDH mRNA expression in HepG2 cells. The β-actin gene was used as an internal reference gene in the fluorescence quantitative PCR assay. The results are shown in Figures 11 and 12.

[0480] Experimental Example 9. In vivo silencing activity of FVII-siRNA and TTR-siRNA by siRNA-CaLNP and siRNA-LNP.

[0481] siRNA-CaLNP preparation

[0482] Weigh 32.5mg of DLin-MC3-DMA, 31.0mg of cholesterol, 16.5mg of DSPC, and 8.0mg of PEG-DMG and dissolve them in 10ml of ethanol to form the organic phase. 1.0mg of each siRNA (mouse FVII gene or mouse TTR gene) was diluted with 9ml of 200mmol / l calcium acetate solution (pH 5.0) to form the aqueous phase. The calcium acetate solution was adjusted to pH 5 with acetic acid. 9ml of the aqueous phase and 1ml of the organic phase were mixed through a T-junction at a total flow rate of 22ml / min to obtain intermediate ①. This was dialyzed against Tris buffer (pH 7.2) using a 14000D molecular weight cutoff dialysis bag. The dialyzate was collected and sterilized by filtration to obtain siRNA-CaLNP.

[0483] siRNA-LNP preparation

[0484] Weigh 65mg of DLin-MC3-DMA, 31.0mg of cholesterol, 16.5mg of DSPC, and 8.0mg of PEG-DMG and dissolve them in 10ml of ethanol to form the organic phase. 1.0mg of each siRNA (mouse FVII gene or mouse TTR gene) was diluted with 1.8ml of a 25mmol / L acetic acid-sodium acetate solution (pH 4.0) to form the aqueous phase. The 25mmol / L acetic acid-sodium acetate solution was adjusted to pH 4.0 with acetic acid. 9ml of the aqueous phase and 1ml of the organic phase were mixed through a T-junction at a total flow rate of 22ml / min to obtain intermediate ①. Dialysis was performed using a 14000D molecular weight cutoff dialysis bag against a Tris buffer (pH 7.2). The dialyzate was collected and sterilized by filtration to obtain the siRNA-LNP.

[0485] FVII-siRNA and TTR-siRNA sequences Lowercase 2'-O-methyl modification Uppercase 2'-deoxy-2'-fluoro modification* Phosphorothioate linkage

[0486] Characteristics of the Formulations in This Study

[0487] C57BL / 6N male mice, 6 to 8 weeks old and weighing 18 to 20 g, were provided by Beijing Weitonglihua Laboratory Animal Technology Co., Ltd.

[0488] (1) C57BL / 6N male mice were randomly divided into 5 groups, with 4 mice in each group. After one week of adaptive feeding, drug administration began. A total of 5 groups were set up as follows: (1) PBS; (2) FVII siRNA-CaLNP 0.5mg / kg (here is the nucleic acid concentration); (3) FVII siRNA-CaLNP 0.1mg / kg (here is the nucleic acid concentration); (4) FVII siRNA-LNP 0.1mg / kg (here is the nucleic acid concentration); (5) FVII siRNA-LNP 0.02mg / kg (here is the nucleic acid concentration). Each group was administered at a dose of 0.1mL / mouse by tail vein injection. 48h after administration, the mice were killed by cervical dislocation and the livers were removed.

[0489] (2) C57BL / 6N male mice were randomly divided into 6 groups, with 4 mice in each group. After one week of adaptive feeding, drug administration began. A total of 6 groups were set up as follows: (1) PBS; (2) TTR siRNA-CaLNP 0.2 mg / kg (nucleic acid concentration); (3) TTR siRNA-CaLNP 0.05 mg / kg (nucleic acid concentration); (4) TTR siRNA-CALNP 0.0125 mg / kg (nucleic acid concentration); (5) TTR siRNA-LNP 0.2 mg / kg (nucleic acid concentration). (6) TTR siRNA-LNP 0.05 mg / kg (nucleic acid concentration). Each group was administered with 0.1 mL / mouse via tail vein injection. 48 hours after administration, the mice were killed by cervical dislocation and the livers were removed.

[0490] Grind the livers from each group into a liver grinding solution. 20-30 mg of the liver grinding solution was used to extract total RNA. Fluorescence quantitative PCR was then used to determine the inhibitory efficacy of FVII and TTR siRNA on FVII and TTR mRNA expression in mice. GAPDH was used as an internal reference gene in the fluorescence quantitative PCR.

[0491] The results are shown in Figures 13 and 14.

Claims

1. A calcium-containing cationic lipid nanoparticle loaded with nucleic acid, characterized in that The cationic lipid nanoparticles comprise cationic lipids, neutral lipids, PEGylated lipids and cholesterol and / or cholesterol esters; The cationic lipid nanoparticles contain calcium ions, and the anions corresponding to the calcium ions are not phosphate, hydrogen phosphate, and dihydrogen phosphate; and The cationic lipid nanoparticles do not contain negatively charged lipids modified with non-PEG groups.

2. The calcium-containing cationic lipid nanoparticle according to claim 1, wherein The cationic lipid nanoparticles contain calcium ions in a non-precipitated state.

3. The calcium-containing cationic lipid nanoparticle according to claim 1 or 2, wherein The concentration of calcium in the entire preparation is 0.01 to 150 mmol / L; preferably 0.01 to 0.1 mmol / L or 0.1 to 150 mmol / L; preferably 0.01 to 0.1 mmol / L, 0.1 to 1 mmol / L, 1 to 10 mmol / L, 10 to 100 mmol / L or 100 to 150 mmol / L; more preferably 0.01 to 0.1 mmol / L, 0.1 to 1 mmol / L, 1 to 10 mmol / L, 10 to 30 mmol / L, 30 to 50 mmol / L, 50 to 70 mmol / L, 70 to 90 mmol / L, 90 to 110 mmol / L, 110 to 130 mmol / L or 130 to 150 mmol / L; More preferably, it is 0.01 to 1 mmol / L; more preferably, it is 0.02 to 0.8 mmol / L; more preferably, it is 0.03 to 0.5 mmol / L; more preferably, it is 0.1 to 0.5 mmol / L.

4. The calcium-containing cationic lipid nanoparticle according to claim 1 or 2, wherein The concentration of calcium in the total volume of the cationic lipid nanoparticles is 10-300 μM, preferably 15-250 μM, more preferably 20-180 μM, more preferably 20-180 μM, more preferably 60-150 μM.

5. The calcium-containing cationic lipid nanoparticles according to claim 1 or 2, wherein The molar ratio of calcium to lipid in the cationic lipid nanoparticles is 1:(0.01-20), preferably 1:(0.1-10), preferably 1:(1-10), preferably 1:(0.1-1); More preferably, it is 1:(2 to 18), more preferably, it is 1:(5 to 15), and more preferably, it is 1:(7 to 13).

6. The calcium-containing cationic lipid nanoparticles according to claim 1 or 2, wherein The molar ratio of calcium in cationic lipid nanoparticles to the total amount of cholesterol and cholesterol ester in the preparation is: (0.01:1) to (0.8:1); preferably (0.02:1) to (0.6:1); more preferably (0.03:1) to (0.4:1); more preferably (0.08:1) to (0.3:1).

7. The calcium-containing cationic lipid nanoparticles according to any one of the preceding claims, characterized in that: The calcium ion is derived from a calcium salt, preferably a soluble calcium salt, more preferably calcium acetate, calcium chloride, calcium sodium EDTA, calcium gluconate, calcium dihydrogen phosphate, calcium nitrate, calcium bicarbonate, calcium bisulfate, calcium bisulfite, calcium bromide, calcium iodide, calcium citrate, calcium lactate, calcium gluconate, further preferably calcium acetate, calcium sodium EDTA, calcium gluconate, calcium citrate, calcium lactate, calcium gluconate, further preferably calcium acetate; Preferably, the calcium ions come from a calcium salt solution with a concentration of 50 mmol / L to 1000 mmol / L; preferably, the calcium ions come from a calcium salt solution with a concentration of 50 to 150 mmol / L, a calcium salt solution with a concentration of 150 to 300 mmol / L, a calcium salt solution with a concentration of 300 to 500 mmol / L, or a calcium salt solution with a concentration of 500 to 800 mmol / L; More preferably, the calcium ions come from a calcium salt solution having a concentration of 100±50mmol / L, a calcium salt solution of 200±50mmol / L, a calcium salt solution of 300±50mmol / L, a calcium salt solution of 400±50mmol / L, a calcium salt solution of 500±50mmol / L, a calcium salt solution of 600±50mmol / L, a calcium salt solution of 700±50mmol / L, a calcium salt solution of 800±50mmol / L or a calcium salt solution of 900±50mmol / L.

8. The calcium-containing cationic lipid nanoparticles according to any one of the preceding claims, characterized in that: The substance delivered by the calcium-containing cationic lipid nanoparticles is a nucleic acid, preferably plasmid DNA, single-stranded DNA, double-stranded DNA, siRNA, shRNA, aiRNA, miRNA, mRNA, circular RNA, tRNA, rRNA, vRNA, gRNA, aptamer, ribozyme, oligonucleotide or any combination thereof.

9. The calcium-containing cationic lipid nanoparticles according to any one of the preceding claims, characterized in that The molar number of phosphate groups in the nucleic acid: the molar number of positive charges in the cationic lipid is 1:(0.5-20), preferably 1:(1-10), more preferably 1:(1.5-6), and even more preferably 1:(1.5-3) or 1:(3-6).

10. The calcium-containing cationic lipid nanoparticle according to any one of the preceding claims, characterized in that the nucleic acid:lipid mass ratio is 1:(1-100), preferably 1:(5-90), more preferably 1:(10-70), and further preferably 1:(10-30).

11. The calcium-containing cationic lipid nanoparticles according to any one of the preceding claims, characterized in that: The length of the substance delivered by the calcium-containing cationic lipid nanoparticles is about 15 to 30,000 base pairs; preferably 15 to 60, 60 to 120, 120 to 250, 250 to 500, 500 to 1000, 1000 to 2000, 2000 to 4000, 4000 to 8000, 8000 to 15000, 15000 to 20000, 20000 to 25000, 25000 to 30000 base pairs; more preferably 15 to 60, 15 to 50, 15 to 40, 15 to 30, 15 to 25, 19 to 25, 20 to 30,20~50,20~80,30~50,30~80,30~120,50~100,50~150,50~250,100~200,100~300,100~500,200~500,200~1000,300~800,300~1500,1000~3000,1000~5000,1000~8000,5000~10000,5000~15000,5000~20000,10000~25000,10000~30000 base pairs.

12. The calcium-containing cationic lipid nanoparticles according to any one of the preceding claims, characterized in that: The amount of nucleic acid loaded is 5 μg / ml to 10 mg / ml; Preferably, the amount of the loaded nucleic acid is 5 μg / ml to 10 μg / ml, 10 μg / ml to 20 μg / ml, 20 μg / ml to 40 μg / ml, 40 μg / ml to 80 μg / ml, 80 μg / ml to 150 μg / ml, 150 μg / ml to 300 μg / ml, 300 μg / ml to 400 μg / ml, 400 μg / ml to 800 μg / ml, 800 μg / ml to 1 mg / ml, 1 mg / ml to 1.5 mg / ml, 1.5 mg / ml to 2 mg / ml, 2 mg / ml to 4 mg / ml, 4 mg / ml to 6 mg / ml, 6 mg / ml to 8 mg / ml or 8mg / ml~10mg / ml; More preferably, the amount of nucleic acid loaded is 50±50 μg / ml, 100±50 μg / ml, 200±50 μg / ml, 300±50 μg / ml, 400±50 μg / ml, 500±50 μg / ml, 600±50 μg / ml, 700±50 μg / ml, 800±50 μg / ml, 900±50 μg / ml, 1000±50 μg / ml, 1 500±50μg / ml, 2000±50μg / ml, 2500±50μg / ml, 3000±50μg / ml, 4000±50μg / ml, 5000±50 μg / ml, 6000±50μg / ml, 7000±50μg / ml, 8000±50μg / ml, 9000±50μg / ml, 10000±50μg / ml.

13. The calcium-containing cationic lipid nanoparticles according to any one of the preceding claims, characterized in that The lipids constituting the cationic lipid nanoparticles include one or more combinations of the following groups: cationic lipids, cholesterol and / or cholesterol esters, neutral lipids, and PEGylated lipids; Preferably, the lipids constituting the cationic lipid nanoparticles include the following lipids: (1) Cationic lipids: The cationic lipids are selected from ionizable cationic lipids; (2) Cholesterol lipids: the cholesterol lipids are selected from cholesterol and / or cholesterol esters; (3) neutral lipids: the neutral lipids are selected from phospholipids, fatty acid glycerides or glycolipids or any combination thereof; and Optional (4) PEGylated lipid; More preferably, the lipids constituting the cationic lipid nanoparticles include: (1) Cationic lipids: The cationic lipids are selected from ionizable cationic lipids; (2) Cholesterol lipid: the cholesterol lipid is selected from cholesterol; (3) neutral lipids: the neutral lipids are selected from phospholipids; and Optional (4) PEGylated lipid.

14. The calcium-containing cationic lipid nanoparticles according to any one of the preceding claims, characterized in that The lipids constituting the cationic lipid nanoparticles include cationic lipids and / or cholesterol lipids in a molar ratio of 1% to 90%; Preferably, the cationic lipid nanoparticles comprise a molar ratio of 10%-60% of cationic lipids and / or 25%-75% of cholesterol lipids; More preferably, the cationic lipid nanoparticles comprise 20%-40% of cationic lipids and / or 40%-60% of cholesterol lipids in a molar ratio.

15. The calcium-containing cationic lipid nanoparticles according to any one of the preceding claims, characterized in that The lipids constituting the cationic lipid nanoparticles include a combination of the following groups in molar ratios: (1) Cationic lipids: 1%-90%, (2) Cholesterol lipids: 1%-90%, (3) Neutral lipids: 1%-90%, (4) PEGylated lipids: 0.1%-20%; Preferably, the lipids constituting the cationic lipid nanoparticles include a combination of the following groups in molar ratios: (1) Cationic lipids: 10%-60%, (2) Cholesterol lipids: 25%-75%, (3) Neutral lipids: 1%-30%, (4) PEGylated lipids: 0.5%-10%; More preferably, the lipids constituting the cationic lipid nanoparticles include a combination of the following groups in molar ratios: (1) Cationic lipids: 20%-40%, (2) Cholesterol lipids: 40%-60%, (3) Neutral lipids: 5%-25%, (4) PEGylated lipids: 1%-3%.

16. The calcium-containing cationic lipid nanoparticles according to any one of the preceding claims, characterized in that Cationic lipids are selected from ionizable cationic lipids; preferably, ionizable cationic lipids are selected from DSDMA, DLinDMA, DLenDMA, DODMA, A6, OF-02, A18-Iso5-2DC18, 98N 12 -5, 9A1P9, C12-200, cKK-E12, 7C1, G0-C14, L319, 304O 13 , OF-Deg-Lin, 306-O12B, 306O i10 , FTT5, SM102, ALC-0315, A9, Lipid 2, 2(8,8)4CCH3, CL1, LP01, DLin-MC3-DMA or analogs and combinations of any of the foregoing cationic lipids; and / or Neutral phospholipids are selected from one or more of egg yolk lecithin, soybean lecithin, hydrogenated soybean lecithin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, distearoylphosphatidylcholine, dimyristoylphosphatidylcholine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylethanolamine, dimyristoylphosphatidylethanolamine, dipalmitoylphosphatidylethanolamine, dioleoylphosphatidylethanolamine, distearoylphosphatidylinositol, dimyristoylphosphatidylinositol, dipalmitoylphosphatidylinositol, dioleoylphosphatidylethanolamine, 9A1P9, 10A1P10; preferably one or more of phosphatidylcholine, egg yolk lecithin, soybean lecithin, hydrogenated soybean lecithin and phosphatidylethanolamine; and / or PEGylated lipids are selected from methoxy polyethylene glycol-distearylphosphatidylethanolamine (mPEG-DSPE), methoxy polyethylene glycol-dioleylphosphatidylethanolamine (mPEG-DOPE), methoxy polyethylene glycol-dipalmitoylphosphatidylethanolamine (mPEG-DPPE), polyethylene glycol-dilauroylglycerol (PEG-DAG), polyethylene glycol-dimyristoylglycerol (PEG-DMG), polyethylene glycol-dipalmitoylglycerol (PEG-DPG), polyethylene glycol-distearoylglycerol (PEG-DSG), polyethylene glycol-dioleoylglycerol (PEG-DOG), polyethylene glycol-dilinoleoylglycerol (PEG-DLinG), polyethylene glycol-bislauroyl propylamide (PEG-DAA), polyethylene glycol-bismyristoyl propylamide (PEG-DMA), polyethylene glycol-bispalmitoyl propylamide (PEG-DPA), polyethylene glycol-bisoleoyl propylamide (PEG-DOA), polyethylene glycol-bislinoleoyl propylamide (PEG-DLinA), polyethylene glycol-ceramide (PEG-ceramide), stearoyl polyethylene glycol ester, vitamin E polyethylene glycol succinate (TPGS) and any combination thereof; wherein PEG is a PEG group having a degree of polymerization selected from 3 to 100; preferably, PEG is a PEG group having a degree of polymerization selected from 3 to 50 or 50 to 100; more preferably, PEG is a PEG group having a degree of polymerization selected from 3 to 10, 10 to 20, 20 to 30, 30 to 40, 40 to 50, 50 to 60, 60 to 70, 70 to 80, 80 to 90 or 90 to 100; more preferably, PEG is a PEG group having a degree of polymerization selected from about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95 or about 100.

17. The calcium-containing cationic lipid nanoparticles according to any one of the preceding claims, characterized in that: The particle size of the calcium-containing cationic lipid nanoparticles is 25 to 1000 nm; preferably, the particle size of the lipid nanoparticles is 25 to 500 nm or 500 to 1000 nm; more preferably, the particle size of the lipid nanoparticles is 25 to 75 nm, 75 to 125 nm, 125 to 175 nm, 175 to 225 nm, 225 to 275 nm, 275 to 350 nm, 350 nm to 500 nm, 500 to 800 nm or 800 to 1000 nm; more preferably, the particle size of the liposome nanoparticles is 40 ± 10nm, 50±10nm, 60±10nm, 70±10nm, 80±10nm, 90±10nm, 100±10nm, 110±10nm, 120±10nm, 125±10nm, 130±10nm, 140±10nm, 150±10nm, 160±10nm, 170±10nm, 180±10nm, 190±10nm, 200±10nm, 210±10nm, 220±10nm or 250±10nm.

18. The calcium-containing cationic lipid nanoparticles according to any one of the preceding claims, characterized in that: The calcium-containing cationic lipid nanoparticles are selected from the following nanoparticle preparations: siRNA-loaded cationic lipid nanoparticles using cationic lipids (preferably DLin-MC3-DMA), cholesterol, neutral phospholipids (preferably DSPC), PEGylated lipids (preferably PEG2000-DMG) as lipids and calcium acetate as a calcium ion source; Calcium-containing cationic lipid nanoparticles loaded with mRNA using cationic lipids (preferably DLin-MC3-DMA), cholesterol, neutral phospholipids (preferably DSPC), PEGylated lipids (preferably PEG2000-DMG) as lipids and calcium acetate as a calcium ion source; DNA-loaded calcium-containing cationic lipid nanoparticles are prepared using cationic lipids (preferably DLin-MC3-DMA), cholesterol, neutral phospholipids (preferably DSPC), PEGylated lipids (preferably PEG2000-DMG) as lipids and calcium acetate as a calcium ion source.

19. The calcium-containing cationic lipid nanoparticles according to any one of the preceding claims, characterized in that: The calcium-containing cationic lipid nanoparticles have the effect of targeting the liver, lung or spleen.

20. A calcium-containing cationic lipid nanoparticle composition, characterized in that The calcium-containing cationic lipid nanoparticles are mixed with nucleic acid-loaded cationic lipid nanoparticles. The pH is preferably adjusted to neutral after mixing.

21. Use of the nucleic acid-loaded calcium-containing cationic lipid nanoparticles of claims 1-19 or the calcium-containing cationic lipid nanoparticle composition of claim 20 for gene transfection into in vitro cultured cells.

22. The use according to claim 21, characterized in that The use is for non-therapeutic purposes, preferably, the use is for in vitro cell modification.

23. Use of the nucleic acid-loaded calcium-containing cationic lipid nanoparticles according to claims 1-19 or the calcium-containing cationic lipid nanoparticle composition according to claim 20 for local injection into the body to achieve gene transfection.

24. Use of the nucleic acid-loaded calcium-containing cationic lipid nanoparticles according to claims 1-19 or the calcium-containing cationic lipid nanoparticle composition according to claim 20 for preparing a gene drug for local injection into the body.

25. Use of the nucleic acid-loaded calcium-containing cationic lipid nanoparticles of claims 1-19 or the calcium-containing cationic lipid nanoparticle composition of claim 20 for local or systemic injection into the body to achieve vaccine immunity.

26. Use of the nucleic acid-loaded calcium-containing cationic lipid nanoparticles of claims 1-19 or the calcium-containing cationic lipid nanoparticle composition of claim 20 for preparing a nucleic acid vaccine for local or systemic injection into the body.

Images