Application of FvNAC073 in regulation and control of strawberry fruit maturation or fruit development

Abstract

The invention belongs to the technical field of plant biology, and discloses application of FvNAC073 in regulation and control of strawberry fruit ripening or fruit size. The invention finds that FvNAC073 has an important biological function in strawberry ripening or fruit size, after the FvNAC073 is knocked out, the anthocyanin content in strawberry fruits is reduced, the fruit softening is delayed, the abscisic acid content in the fruits is reduced, the longitudinal and transverse diameters of the fruits are reduced, and the weight of a single fruit is reduced; after the FvNAC073 is over-expressed, the content of anthocyanin in strawberry fruits is increased, the fruits are softened in advance, the content of abscisic acid in the fruits is increased, the longitudinal and transverse diameters of the fruits are increased, and the weight of a single fruit is increased, so that a new gene resource can be provided for molecular breeding for researching the sizes of the strawberry fruits and ripening of the strawberries.

Description

Technical Field

[0001] The invention belongs to the field of plant biotechnology, and particularly relates to use of FvNAC073 in regulating strawberry fruit ripening or fruit development. Background Art

[0002] Strawberry is one of the most popular fruit crops, and its fruit has a unique flavor and aroma. The development and ripening of strawberry fruit is a process of a series of changes in structure and biochemical composition, including changes in size, softening of the receptacle, and increased content of sugars, anthocyanins, and volatile compounds. Existing research on the molecular mechanisms of fruit development and ripening mainly focuses on respiratory climacteric fruits. The ripening of respiratory climacteric fruits is accompanied by a sharp increase in respiration and ethylene levels. Typical respiratory climacteric fruits include strawberries, bananas, peaches, avocados, and mangoes. The ripening of non-respiratory climacteric fruits does not show a significant increase in respiration rate or a sharp increase in ethylene levels. Non-respiratory climacteric fruits include strawberries, citrus and lemons. Strawberries are generally used as a model plant for non-respiratory climacteric fruits to study the ripening process. Exploring the genes that regulate the ripening and development of strawberry fruits and analyzing their regulatory mechanisms can provide a good theoretical basis for breeding new varieties and have good application prospects.

[0003] NAC transcription factors have been found in Arabidopsis, rice, grape, wheat, soybean, cassava, tomato, cucumber and other species, and are one of the largest transcription factor families in plants. Many studies have shown that NAC transcription factors are not only involved in the growth and development of plant roots, stems, leaves, and flowers, but also in the regulation of fruit ripening and hormone regulation. Due to the diversity of species and functions of the NAC transcription factor family, its differential regulation of non-climacteric fruit ripening deserves further study. The role of NAC transcription factors in non-climacteric fruits has been preliminarily demonstrated. Six NAC transcription factors related to fruit development and ripening were identified in pineapple strawberry: FaNAC006, FaNAC021, FaNAC022, FaNAC035, FaNAC042, and FaNAC09. Among them, FaNAC035 (FaRIF) increases the accumulation of abscisic acid (ABA) by inducing the expression of FaNCED3 and FaZEP, genes related to abscisic acid synthesis. FaNAC035 also participates in ABA signal transduction by regulating the expression patterns of FaHVA22, FaSnRK2.6, FaHY5 and FaBBX19. Although six NAC transcription factors related to fruit development and ripening have been identified, only the function of FaNAC035 has been preliminarily studied, and the functions of the remaining NAC transcription factors are still unclear.

[0004] CN115960188B discloses the use of FvNAC037, which records that overexpression of FvNAC037 can significantly promote the accumulation of sucrose in the fruit, indicating that promoting the expression of FvNAC037 has the function of promoting sucrose synthesis in strawberry fruit and increasing sugar accumulation; silencing FvNAC037 can significantly reduce the sucrose in strawberry fruit, indicating that the decreased expression of FvNAC037 has the function of inhibiting sucrose synthesis in the fruit and reducing sugar accumulation. Overall, it is shown that FvNAC037 can regulate the quality of strawberry fruit and be used to cultivate new strawberry varieties.

[0005] However, there is no research on the relationship between FvNAC037 and strawberry fruit ripening and development. Summary of the invention

[0006] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide the use of FvNAC073 in regulating strawberry fruit ripening or fruit development, thereby solving the problems in the prior art.

[0007] To achieve the above objectives and other related objectives, the present invention is achieved through the following technical solutions.

[0008] The first aspect of the present invention protects the use of FvNAC073 as a target in screening products that regulate strawberry fruit ripening or fruit development.

[0009] The second aspect of the present invention protects the use of FvNAC073 or its regulator in at least one of A1)-A3): A1) regulating the ripening of strawberry fruit; A2) regulating the development of strawberry fruit; A3) cultivating strawberry.

[0010] The third aspect of the present invention protects a method for promoting the ripening or development of strawberry fruit, which comprises one or two of the following steps: 1) introducing the FvNAC073 protein into strawberries to promote the ripening or development of strawberry fruit; 2) introducing biological materials related to the FvNAC073 protein into strawberries to promote the ripening or development of strawberry fruit.

[0011] The fourth aspect of the present invention protects a method for delaying the ripening of strawberry fruit or inhibiting the development of strawberry fruit, the method comprising the following steps: reducing the expression level of FvNAC073 protein in strawberry to inhibit the ripening of strawberry fruit or inhibit the development of strawberry fruit.

[0012] The fifth aspect of the present invention protects a method for cultivating strawberries, which comprises one or more of the following steps: D1) introducing the FvNAC073 protein to cultivate early-maturing strawberries or strawberries with larger fruits; D2) introducing biological materials related to the FvNAC073 protein to cultivate early-maturing strawberries or strawberries with larger fruits; D3) reducing the expression level of the FvNAC073 protein in strawberries to cultivate late-maturing strawberries or strawberries with smaller fruits.

[0013] The present invention has the following beneficial effects:

[0014] 1) The present invention designs sgRNA for FvNAC073, constructs a CRISPR-Cas9 vector targeting FvNAC073, and transforms the CRISPR-Cas9 vector into forest strawberry Ruegen by Agrobacterium-mediated method to obtain the fvnac073 mutant after knocking out FvNAC073. Compared with wild-type Ruegen, the coloring and softening of the fruit after knocking out FvNAC073 are delayed; the anthocyanin content is reduced; and the transverse and longitudinal diameters of the developed fruit become smaller. Overexpressing FvNAC073 in strawberry found that overexpressing FvNAC073 can significantly promote the development of the transverse and longitudinal diameters of strawberry fruits, increase the unit weight of strawberry fruits, reduce the hardness of strawberry fruits, increase the anthocyanin content, advance the coloring time and deepen the color. It is generally shown that FvNAC073 has the function of promoting the development and maturation of strawberry fruits, and provides new gene resources for molecular breeding that promotes fruit development and maturation.

[0015] 2) The present invention also analyzes the expression of genes related to anthocyanin synthesis, and finds that after knocking out FvNAC073, the expression of genes related to anthocyanin synthesis, such as FvPAL2, FvCHS, FvCHI, FvF3H, FvDFR2, FvANS, and FvUFGT, is significantly reduced, indicating that knocking out FvNAC073 inhibits anthocyanin synthesis, causing the fruit to color late; while after overexpressing FvNAC073, the expression of genes related to anthocyanin synthesis, such as FvPAL2, FvCHS, FvCHI, FvF3H, FvDFR2, FvANS, FvUFGT, and FvMYB10 is significantly increased, indicating that overexpression of FvNAC073 promotes anthocyanin synthesis, causing the fruit to color early.

[0016] 3) The present invention also analyzes the expression of genes related to the cell wall, and finds that after knocking out FvNAC073, the expression of genes related to the cell wall, such as cell wall degradation genes, cell wall remodeling genes, and cell wall loosening genes, is significantly reduced, indicating that knocking out FvNAC073 can inhibit cell wall expansion and extension, and relax the cell wall, thereby causing the fruit to be smaller and softening to be delayed; while after overexpressing FvNAC073, the expression of genes related to the cell wall, such as cell wall degradation genes, cell wall remodeling genes, and cell wall loosening genes is significantly increased, indicating that overexpressing FvNAC073 can promote cell wall expansion and extension, and relax the cell wall, thereby causing FvNAC073-OE fruits to be larger and soften earlier. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The CRISPR / Cas9-mediated FvNAC073 gene editing strain in Example 1 of the present application is shown. (A) Schematic diagram of the sgRNA1 and sgRNA2 targets in FvNAC073, and the sequence alignment obtained after amplification, purification and Sanger sequencing of the fragments around the target sites of WT, fvnac073-6 and fvnac073-9. Blue letters represent sgRNA1 and sgRNA2, bold represents PAM sequence, and red dashes represent base deletions. (B) Plant phenotypes of wild-type WT, mutant fvnac073-6 and mutant fvnac073-9.

[0018] Figure 2 It is shown that the fruit development of the mutant fvnac073 in Example 2 of the present application is inhibited and the fruit ripening time is delayed. (A) Fruit phenotypes of wild type WT, mutant fvnac073-6 and mutant fvnac073-9 at different stages, and the fruit phenotypes were monitored at 11, 16, 21, 22, 24, 25, and 28 days after flowering. (B) The percentage of fruits at different development / maturity stages at each time point. (C) Fruit weight of wild type WT, mutant fvnac073-6 and mutant fvnac073-9 22 days after flowering. (D) Changes in the transverse diameter of fruits of wild type WT, mutant fvnac073-6 and mutant fvnac073-9 from 3 to 27 days. (E) Changes in the longitudinal diameter of fruits of wild type WT, mutant fvnac073-6 and mutant fvnac073-9 from 3 to 27 days.

[0019] Figure 3It is shown that the fruit expansion of the mutant fvnac073 in Example 2 of the present application is inhibited and the fruit ripening time is delayed. (A) Changes in anthocyanin content in the fruits of WT, fvnac073-6 and fvnac073-9 at 22 days after flowering and at maturity (WT at 25 days after flowering, fvnac073-6 and fvnac073-9 mutants at 28 days after flowering). (B) Changes in fruit hardness of WT, fvnac073-6 and fvnac073-9 at 22 days after flowering and at maturity. (C) ABA content in the fruits of WT, fvnac073-6 and fvnac073-9 at 22 days after flowering.

[0020] Figure 4 The expression of genes related to fruit ripening in the fvnac073-9 mutant in Example 4 of the present application is shown. (A) Expression of anthocyanin-related genes in the fruits of the fvnac073-9 mutant. (B) Expression of genes related to ABA synthesis, degradation and signaling in the fruits of the fvnac073-9 mutant.

[0021] Figure 5 Shown is the expression of cell wall-related genes in the fruit of the fvnac073-9 mutant in Example 5 of the present application.

[0022] Figure 6 It is shown that the overexpression of FvNAC073 in Example 6 of the present application promotes fruit enlargement and ripening. (A) Phenotypic changes of EV-OE and FvNAC073-OE 1d-8d after injection. (B)(C) Changes in the horizontal and vertical diameters of the fruits of EV-OE and FvNAC073-OE after 5d and 7d of injection. (D) Changes in the fruit weight of EV-OE and FvNAC073-OE after 5d and 7d of injection. (E) Changes in the fruit firmness of EV-OE and FvNAC073-OE after 5d and 7d of injection. (F) Changes in the anthocyanin content of the fruits of EV-OE and FvNAC073-OE after 5d and 7d of injection.

[0023] Figure 7 Shown is a graph showing the results of expression analysis of genes related to ripening and cell wall in fruits after overexpression of FvNAC073 in Example 7 of the present application. DETAILED DESCRIPTION

[0024] Fruit ripening is an important stage in the growth and development of fruits. It is a highly coordinated, genetically programmed, and irreversible phenomenon that involves a series of physiological, biochemical, and sensory changes that form the edible quality attributes of mature fruits, such as flavor, texture, and color. In the process of fruit ripening, it is usually accompanied by a series of physiological and biochemical changes, such as fruit softening, reduction of organic acids, starch degradation, accumulation of soluble sugars, disappearance of tannins, synthesis of aromatic compounds, chlorophyll degradation, and accumulation of carotenoids or anthocyanins. Analyzing the ripening regulation mechanism can not only theoretically understand the important stages of plant development, but also provide a basis for improving fruit quality and extending storage and preservation time.

[0025] After knocking out FvNAC073, the present invention found that the coloring and softening of strawberry fruits were delayed, the anthocyanin content was reduced, and the horizontal and vertical diameters of the fruits were reduced; while after overexpressing FvNAC07, it was found that the horizontal and vertical diameters of strawberry fruits developed, the single weight of strawberry fruits increased, the hardness of strawberry fruits decreased, the anthocyanin content increased, the coloring time was advanced, and the color was deepened

[0026] Therefore, FvNAC073 has an important biological function in strawberry ripening or fruit development or strawberry breeding, and the present application can provide a new gene resource for molecular breeding that promotes fruit development and ripening. On this basis, the present invention is completed.

[0027] A first aspect of the present invention provides use of FvNAC073 as a target in screening products that regulate strawberry fruit ripening or fruit development.

[0028] In the present invention, the product that targets FvNAC073 in strawberry fruit ripening or fruit development specifically refers to: taking the FvNAC073 gene or the FvNAC073 protein as the object of action, screening the products to find products that can promote or inhibit the expression level of the FvNAC073 gene, promote or inhibit the expression or activity of the FvNAC073 protein as alternative products for strawberry fruit ripening or fruit development.

[0029] In the present invention, the product includes molecules that can specifically inhibit the transcription or translation of the FvNAC073 gene, or can specifically inhibit the expression or activity of the FvNAC073 protein, so that the product can reduce the expression level of the FvNAC073 gene in strawberries, delay the softening of strawberry fruits, delay the coloring of strawberry fruits, and inhibit the development of strawberry fruits.

[0030] In the present invention, the product includes molecules that can specifically promote the transcription or translation of the FvNAC073 gene, or can specifically promote the expression or activity of the FvNAC073 protein, so that the product can increase the expression level of the FvNAC073 gene in strawberries, promote the softening of strawberries, promote the coloring of strawberry fruits, and promote the development of strawberry fruits.

[0031] In the present invention, the product includes but is not limited to: nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, peptides, proteins or interfering lentiviruses. The form of the product is not particularly limited and can be in various forms such as solid, liquid, gel, semi-fluid, aerosol, etc.

[0032] In the present invention, the nucleotide sequence of FvNAC073 comprises the sequence shown in SEQ ID NO.1. The sequence shown in SEQ ID NO.1 is specifically:

[0033] ATGACATGGCACTCAGATGAGGAAGAGGAAGAAGAGAGGGCAGCAGTTCAGTCAATAACTCCCTCCTCTGCAACATATCCTCAGCAATCTAAGAATAATAAGAACAATGAAATATCATCATGCCCGTCTTGTGGCCACCCTATAGATTTTCAAGACCAGGCTGGAATTCATGATTTGCCGGGACTACCAGCAGGGGTGAAATTTGATCCGACGGACCAGGAGATTCTTCAACATTTGGAGGCAAAAGTGCTCACTGATACCAGAAAGCTTCATCCACTCATTGATGAATTCATACCAACGCTTGATGGAGAGAATGGAATCTGCTCTACCCACCCAGAAAAGCTACCAGGAGTTAACAAAGAAGGACAGATCCGCCACTTTTTTCACCGACCCTCAAAGGCCTATACCACCGGAACCAGGAAGCGAAGGAAGGTTCACACCGAAGAAGATGGAAGCGAGACAAGATGGCACAAAACGGGCAAGACAAGGCCAGTCCTAGCCAATGGAGCAGTCAAGGGTTTCAAAAAGATCTTGGTCCTCTACACCAACTACGGCAGGCAAAGGAAGCCCGAGAAGACGAATTGGGTGATGCACCAGTACCACCTTGGCAACAATGAAGAAGAAAAAGATGGGGAGCTAGTGCTATCTAAGGTCTTTTACCAAACACAACCTAGGCAATGTGGTACTGGCACTCCAAGTATCAGAGATGGTGGTCCTCCATTGTTGAATCCATTTGATAGCCATCATTATAAAGGTCAAGTGAATATTCGTAGTGGCCAAGATGGGATTCCTCTTCCTCTTCCTCCAAAGAAGGCTGGTGTTATGGAGTATTACAATCATAATCATCCTGGTCCTTTTATGAACTATGAGCATCCTCATCTAATTCAAGGAGGCCAGAATAGGGAAATCCCAGCTCAACTAATTCCTAACATGGTTCTTCAAGGTGACGGGTCTTCGTTGTTTCGATACAATGCTGCAGATACAAGCAAAGGAAACTAA

[0034] Another aspect of the present invention provides use of FvNAC073 or a regulator thereof in strawberry fruit ripening or fruit development or strawberry cultivation.

[0035] In certain embodiments, overexpression of FvNAC073 promotes strawberry fruit ripening or promotes strawberry fruit development.

[0036] In other embodiments, knocking out FvNAC073 inhibits strawberry fruit ripening or inhibits strawberry fruit development.

[0037] In certain embodiments, the fruit ripening refers to fruit softening, fruit coloring, or increased abscisic acid content in the fruit.

[0038] Furthermore, the fruit coloring refers to the increase in anthocyanin content in the fruit. The fruit ripening process is often accompanied by the degradation of chlorophyll, the synthesis and accumulation of different types of anthocyanins in the vacuole, and the accumulation of carotenoids, which is manifested in the appearance of fruit coloring. The color of the fruit is one of the key factors that determine the quality of the fruit. The present application found that the mutant fvnac073-6 obtained by knocking out FvNAC073 had a 24.04% to 98.44% decrease in anthocyanin content in the fruit compared with WT during the same period; at the same time, through transcriptome analysis, the present application found that the expression of enzymes related to anthocyanin synthesis in the mutant, such as phenylalanine ammonia lyase (PAL), chalcone synthase (CHS), chalcone isomerase (CHI), flavanone-3-hydroxylase (F3H), dihydroflavonol reductase (DFR), anthocyanin synthase (ANS) and flavonoid 3-o-glycosyltransferase (UFGT) was significantly reduced; and after overexpressing FvNAC073, it was found that the anthocyanin content in the fruit during the same period increased by 25% to 300% compared with WT. In summary, inhibiting or reducing the expression of FvNAC073 can inhibit the synthesis and accumulation of anthocyanins and delay the coloring of strawberry fruit; overexpressing FvNAC073 can promote the synthesis and accumulation of anthocyanins, advance the coloring time of strawberry fruit and deepen the color.

[0039] Further, the fruit ripening refers to fruit softening, and the fruit softening refers to a decrease in fruit hardness. Fruit softening is one of the important characteristics of ripening, which directly affects post-harvest logistics, shelf life and commercial properties. The present application found that knocking out FvNAC073 made its hardness 4-6 times higher than WT at 22d. At the same time, it was found that the cell wall loosening-related enzymes, cell wall degradation-related enzymes and cell wall remodeling-related enzymes related to the hardness of strawberry fruit in the mutant were all reduced; while overexpressing FvNAC073, its hardness was reduced by at least 61.82% compared with WT. At the same time, it was found that the expression of cell wall loosening-related enzymes, cell wall degradation-related enzymes and cell wall remodeling-related enzymes related to the hardness of strawberry fruit in the mutant was significantly increased. It is generally shown that inhibiting or reducing the expression of FvNAC073 can inhibit the softening of strawberry fruit; overexpressing FvNAC073 can promote the softening of strawberry fruit.

[0040] Furthermore, the fruit ripening refers to an increase in the abscisic acid content in the fruit. The present application found that knocking out FvNAC073 significantly reduced the abscisic acid (ABA) content in the fruit. At the same time, it was found that the expression of enzymes related to ABA synthesis, such as 9-cis-epoxycarotenoid dioxygenase (FvNCED5), was significantly downregulated, while the expression of enzymes related to ABA degradation, such as FvCYP707A4b and FvCYP707A4a, was significantly increased; and overexpressing FvNAC073 significantly increased the abscisic acid (ABA) content in the fruit. It is generally shown that inhibiting or reducing the expression of FvNAC073 can inhibit the increase in abscisic acid content in strawberry fruit; overexpressing FvNAC073 can promote the increase in abscisic acid content in the fruit.

[0041] Furthermore, the fruit development refers to the transverse diameter, longitudinal diameter or weight of the fruit. The present application found that after knocking out FvNAC073, the transverse diameter, longitudinal diameter and weight of the fruit were significantly reduced; while overexpressing FvNAC073, the transverse diameter, longitudinal diameter and weight were significantly increased. Overall, it can be seen that inhibiting or reducing the expression of FvNAC073 can inhibit the development of strawberry fruit; overexpressing FvNAC073 can promote fruit development.

[0042] In some embodiments, the regulator comprises a FvNAC073 promoter and a FvNAC073 inhibitor. In some embodiments, the regulator comprises but is not limited to: a nucleic acid molecule, a carbohydrate, a lipid, a small molecule chemical drug, an antibody drug, a polypeptide, a protein or an interfering lentivirus.

[0043] In certain specific embodiments, the FvNAC073 promoter refers to a substance that can promote the transcription or translation of the FvNAC073 gene, or can promote the expression or activity of the FvNAC073 protein.

[0044] Furthermore, the promoter comprises a protein encoded by the FvNAC073 gene or a biological material related to the FvNAC073 gene, and the biological material is selected from one or both of a recombinant expression vector and a bioengineering bacterium. The recombinant expression vector is formed by connecting FvNAC073 with a vector, and the bioengineering bacterium is obtained by transfecting a host with the recombinant expression vector. In a specific embodiment, the recombinant expression vector is obtained by connecting FvNAC073 with a starting plasmid pHB-YFP.

[0045] In certain specific embodiments, the FvNAC07 inhibitor inhibits or reduces the expression of FvNAC07 to regulate strawberry fruit ripening or fruit development or cultivate strawberries. For example, FvNAC07 can partially inhibit, i.e., reduce the expression and / or function of FvNAC07; or completely inhibit, i.e., substantially completely eliminate the expression and / or function of FvNAC073.

[0046] In certain specific embodiments, the inhibition or reduction of FvNAC07 expression can be achieved by gene knockout, gene silencing or homologous recombination. The gene knockout refers to the inactivation of a specific target gene by changing the DNA sequence, and the knockout includes knocking out the FvNAC073 gene using DNA homologous recombination technology, Cre / LoxP technology or CRISPR / Cas9 editing system. The gene silencing refers to the phenomenon of not expressing or underexpressing a gene without damaging the original DNA. Gene silencing can occur at two levels, one is gene silencing at the transcriptional level caused by DNA methylation, heterochromatinization and position effects, and the other is post-transcriptional gene silencing, that is, at the level after gene transcription, the gene is inactivated by specific inhibition of the target RNA, including antisense RNA, co-suppression, RNA interference (RNAi) and microRNA (miRNA)-mediated translation inhibition, etc.

[0047] Furthermore, the FvNAC073 inhibitor is selected from one or more of nucleic acid molecules, nucleic acid constructs, lentiviruses, adeno-associated viruses, gene editing systems and genetically engineered bacteria.

[0048] Furthermore, the FvNAC073 inhibitor is a nucleic acid molecule, and the nucleic acid molecule is a nucleic acid molecule targeting the FvNAC073 gene, such as siRNA, shRNA, sgRNA, miRNA or antisense RNA. Preferably, the nucleic acid molecule is a specific sgRNA or a DNA molecule expressing the specific sgRNA, and its target sequence is shown in SEQ ID No.2 or SEQ ID No.3.

[0049] In some other embodiments, the FvNAC073 inhibitor is a nucleic acid construct, which comprises a nucleic acid molecule targeting the FvNAC073 gene, and the sequence of the nucleic acid molecule can be inserted into a vector to form a recombinant vector. The vector refers to a bacterial plasmid, a bacteriophage, a yeast plasmid, a plant cell virus, a mammalian cell virus or other vectors well known in the art. In short, any plasmid and vector can be used as long as they can replicate and be stable in the host. The expression vector in the present invention is not limited to the CRISPR / Cas9 vector mentioned in the following examples. Preferably, the nucleic acid construct is JH4-FvNAC073. The recombinant vector containing sgRNA is constructed using the sequences shown in SEQ ID No.4 and SEQ ID No.5.

[0050] In some other embodiments, the FvNAC073 inhibitor is a gene editing system, and the gene editing system is selected from one or more of the Cre-Loxp system, the Flp-FRT system, the Dre-ROX system, the vCre-vloxp system, the sCre-sloxp system, the CRISPR / Cas9 system, the CRISPR / Cas12 system, and the CRISPR / Cas-derived single base editing system. Preferably, the gene editing system is the CRISPR / Cas9 system, specifically JH19-FvNAC073.

[0051] In other embodiments, the FvNAC073 inhibitor is a genetically engineered bacterium, and the genetically engineered bacterium is obtained by transfecting a host cell with the nucleic acid construct. The host cell can be yeast, bacteria, algae or fungi. The bacteria can be gram-positive bacteria or gram-negative bacteria. The gram-negative bacteria can be Escherichia coli or Agrobacterium. The Agrobacterium can be Agrobacterium GV3101, and the Escherichia coli can be Agrobacterium JM109.

[0052] Another aspect of the present invention provides a method for promoting the ripening or development of strawberry fruits, the method comprising one or two of the following steps:

[0053] 1) introducing the FvNAC073 protein into strawberries to promote the ripening or development of strawberry fruits;

[0054] 2) Introducing biological materials related to the FvNAC073 protein into strawberries to promote the ripening or development of strawberry fruits.

[0055] Another aspect of the present invention provides a method for delaying the ripening of strawberry fruit or inhibiting the development of strawberry fruit, the method comprising the following steps: reducing the expression level of FvNAC073 protein in strawberry to inhibit the ripening of strawberry fruit or inhibit the development of strawberry fruit.

[0056] Another aspect of the present invention provides a method for growing strawberries, the method comprising one or more of the following steps:

[0057] D1) introducing the FvNAC073 protein to cultivate early-maturing or fruit-developing strawberries;

[0058] D2) introducing biological materials related to the FvNAC073 protein to cultivate strawberries with early maturity or larger fruits;

[0059] D3) reducing the expression level of FvNAC073 protein in strawberries to cultivate strawberries that mature later or have smaller fruits.

[0060] In the present invention, the expression level and / or activity of the FvNAC073 protein can be reduced by homologous recombination, RNAi silencing or CRISPR.

[0061] In a specific embodiment of the present invention, the recombinant expression vector JH19-FvNAC073 is transformed into strawberry by Agrobacterium-mediated transformation to prepare a strawberry mutant with FvNAC073 knocked out. The method comprises the following steps: 1) transforming the recombinant expression vector JH19-FvNAC073 into Agrobacterium GV3101 to obtain the recombinant bacteria GV3101 / JH19-FvNAC073; 2) co-culturing the recombinant bacteria GV3101 / JH19-FvNAC073 with strawberry callus tissue. The co-cultivation comprises the following steps: immersing strawberry callus in the bacterial solution of the recombinant bacteria GV3101 / JH19-FvNAC073 for infection, transferring to a co-cultivation medium, then transferring to a screening medium, and finally transferring to a proliferation medium for cultivation to obtain transgenic positive plants; and confirming through PCR amplification and identification that the nucleotide sequence of the target sequence has been changed, screening out strawberries whose target sequence has been changed and which cause the protein encoded by the FvNAC073 gene to terminate prematurely, namely, mutant strawberries.

[0062] In summary, this application systematically analyzes the regulatory mechanism of FvNAC073 in the process of strawberry fruit ripening and development, which is beneficial for understanding the molecular mechanism of strawberry fruit ripening and development, and also for providing theoretical support for improving the quality of strawberry fruit through transgenic technology in production.

[0063] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0064] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0065] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0066] Example 1 Construction of CRISPR-Cas9 vector targeting FvNAC073

[0067] In this Example 1, an sgRNA targeting FvNAC073 was designed, and a CRISPR-Cas9 vector for knocking out FvNAC073 was constructed. The following are included:

[0068] 1.1 Design of sgRNA

[0069] Two sgRNAs were designed on the second and third exons of FvNAC073 using crispr (https: / / crispr.dbcls.jp / ), and the sequence of sgRNA1 was GATTTGCCGGGACTACCAGC (SEQ ID No. 2) and the sequence of sgRNA1 was GGCACAAAACGGGCAAGACA (SEQ ID No. 3).

[0070] The editing efficiency of the two sgRNAs was predicted by (http: / / crispr.dfci.harvard.edu / SSC / ). Using JH4 (for detailed information on the JH4 plasmid, see Zhou et al., Plant Biotechnology Journal. (2018) 16, 1868–1877.) as a template, the forward and reverse primers for introducing the two sgRNAs were designed. The primers are as follows:

[0071] Forward primer FvNAC073-JH4-FP:

[0072] CTAGAGTCGAAGTAGTGATT GATTTGCCGGGACTACCAGC GTTTTAGAGCTAGAAAT AGC(SEQ IDNo.4)

[0073] Reverse primer FvNAC073-JH4-RP:

[0074] GCTATTTCTAGCTCTAAAAC GGCACAAAACGGGCAAGACA GAgCTATACTGCAATGTTCT(SEQ IDNo.5)

[0075] Note: The underlined bases in the primer sequences of FvNAC073-JH4-FP and FvNAC073-JH4-RP are sgRNA1 and sgRNA2, respectively.

[0076] The PCR reaction system was: 12.5 μL PrimeSTAR Max Premix, 0.5 μL each of primers FvNAC073-JH4-FP and FvNAC073-JH4-RP, 0.1 μL of JH4 plasmid, and finally sterile distilled water was added to make up to 25 μL.

[0077] PCR reaction program: pre-denaturation at 98°C for 1 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 30 cycles from denaturation to extension; full extension at 72°C for 10 min, and storage at 25°C.

[0078] 1.2. Obtaining linear vectors

[0079] The JH4 vector was linearized with SpeI restriction endonuclease, and the linearized JH4 vector was used as a template and JH4-FP and JH4-RP were used as primers to amplify the JH4 vector backbone. The primers are as follows:

[0080] JH4-FP:GTTTTAGAGCTAGAAATAGCAA(SEQ ID No.6)

[0081] JH4-RP:AATCACTACTTCGACTCTAG(SEQ ID No.7)

[0082] The reaction system for enzyme digestion is: 10×Cutsmart buffer 5μL; JH4 plasmid 3μL (500ng-1μg); SpeI restriction endonuclease 2μL; finally, add sterile water to make up the volume to 50μL.

[0083] The enzyme digestion reaction was carried out in a 37°C water bath for 2 h.

[0084] The product after enzyme digestion was purified using the DNA product recovery kit of Tiangen Biochemical. The specific steps can be carried out according to the instructions of the kit.

[0085] 1.3. Connection

[0086] The two fragments obtained in steps 1.1 and 1.2 were ligated by recombinase according to the operating instructions of ClonExpress II One Step Cloning Kit of Novozymes to construct the intermediate vector JH4-FvNAC073.

[0087] The ligation reaction system is as follows: 7 μL of target double-stranded DNA fragment, 1 μL of T4 DNA ligase, 1 μL of 10×T4 DNA ligase Buffer, and 1 μL of linearized JH4 plasmid.

[0088] The ligation reaction was carried out at 37°C for 1 h to obtain a ligation product.

[0089] 1.4. Transformation into E. coli competent cells

[0090] The intermediate vector JH4-FvNAC073 obtained in step 1.3 was transformed into the competent E. coli JM109 (Shanghai Weidi Biotechnology Co., Ltd.), plated on LB plates (containing 50 mg / L kanamycin), and cultured overnight at 37°C. The colonies after overnight culture were PCR-identified for positive clones, and the positive clones were shaken, and the plasmids were extracted and sequenced to verify the correctness of the sequence.

[0091] 1.5. Obtaining recombinant vector

[0092] The intermediate vector JH4-FvNAC073 and JH19 (for details of the JH19 plasmid, see Zhou et al., Plant Biotechnology Journal. (2018) 16, 1868–1877.) were connected by gateway LR cloning enzyme. The obtained JH19-FvNAC073 recombinant vector was transformed into Agrobacterium competent cells GV3101 (purchased from Shanghai Weidi Biotechnology Co., Ltd., catalog number: AC1001), and the transformation method was carried out according to the instructions.

[0093] Example 2 Agrobacterium-mediated transformation of the recombinant vector JH19-FvNAC073 into forest strawberry Ruegen

[0094] In this Example 2, Agrobacterium GV3101 containing the recombinant vector JH19-FvNAC073 in Example 1 was used to infect strawberries.

[0095] These include:

[0096] 2.1. Preparation of Agrobacterium culture solution

[0097] The Agrobacterium GV3101 containing the JH19-FvNAC073 recombinant vector obtained in step 1.5 was streaked on a plate containing rifampicin (50 mg / L) and kanamycin (50 mg / L), cultured at 28°C for two days, a single clone colony was taken, inoculated into 1 mL of liquid culture medium containing rifampicin (50 mg / L) and kanamycin (50 mg / L), and cultured at 28°C, 200 rpm, and shaking for 24 h to obtain Agrobacterium culture liquid.

[0098] Take 100 μL of Agrobacterium culture and inoculate it into 100 mL of YEP liquid medium containing kanamycin (50 mg / L) and rifampicin (50 mg / L). Incubate overnight at 28°C until OD 600 Reach 0.5. Then, centrifuge at 4000rpm for 10 minutes and discard the supernatant. Then resuspend the precipitate with buffer (MS+2% sucrose+100μM acetosyringone) to obtain a resuspended bacterial solution. After activation at room temperature for 1h, use it for transformation.

[0099] 2.2 Infection

[0100] Ruegen sterile seedlings (Ruegen, abbreviated as RG, used as the wild type of diploid forest strawberry) were cultured in MS + 2% sucrose culture medium. When the sterile seedlings were 40 days old, the tender green, thick, and fully expanded strawberry leaves were cut. Then, a knife was used to quickly make 3-4 horizontal cuts on the vertical veins on the back of each leaflet. All the leaves to be transformed were placed in a tissue culture bottle filled with buffer (MS + 2% sucrose + 100 μM acetosyringone) for later use.

[0101] During infection, pour out the buffer in the tissue culture bottle containing the leaves, add all the resuspended bacterial solution prepared in step 2.1 to the tissue culture bottle, and then place it in a shaker at 28°C and 100 rpm for 30 minutes. After infection, pour out the bacterial solution and place the leaves on dry sterile filter paper to absorb as much of the bacterial solution as possible.

[0102] 2.3 Co-culture

[0103] After absorbing the bacterial solution, the leaves were transferred to strawberry co-culture medium (MS + 20g / L sucrose + 2.5g / L phytagel + 4mg / L TDZ + 0.1mg / L IBA + 100uM acetosyringone; pH = 5.8) and co-cultured in a dark environment with a cycle of 23℃16h / 20℃8h for 3d.

[0104] 2.4 Screening and cultivation

[0105] The strawberry leaves co-cultivated for 3 days were transferred to strawberry screening medium (MS + 20g / L sucrose + 2.5g / L phytagel + 4mg / L BA + 0.1mg / L IBA + 4mg / L hygromycin + 300mg / L cephalosporin; pH = 5.8), so that the wound was fully in contact with the screening medium. The leaves were cultured in a culture room under the cycle conditions of 23°C 16h / 20°C 8h until buds appeared.

[0106] 2.5 Rooting culture

[0107] After the callus sprouted, it was peeled off from the callus and transferred to a rooting bottle (MS + 20 g / L sucrose + 2.5 g / L phytagel + 0.1 mg / L IBA + 4 mg / L hygromycin + 300 mg / L cephalosporin; PH = 5.8) for rooting culture to obtain T0 generation strains.

[0108] 2.6 Screening of transgenic positive strains

[0109] When the T0 generation strains grew to 8-9 leaves, young leaves were taken to extract DNA, and primers were designed for the upstream and downstream of the two sgRNAs designed for FvNAC073. The fragments were amplified using DNA as templates and sequenced to obtain two heterozygous mutant strains. The primers are as follows;

[0110] NAC073-gRNA1-F:GATGAGGAAGAGGAAGAAGAG (SEQ ID No. 8)

[0111] NAC073-gRNA1-R:GAACTAATAAGCCAAGCACTAG (SEQ ID No. 9)

[0112] NAC073-gRNA2-F:TACTGGTATAGTGTGGTAGAC (SEQ ID No. 10)

[0113] NAC073-gRNA2-R:GAGGAAGAGGAAGAGGAATC (SEQ ID No. 11)

[0114] The seeds of these two strains were collected and planted into T1 generation strains, which were then sequenced again to obtain two independent homozygous mutant strains, fvnac073-6 and fvnac073-9.

[0115] Example 3 Fruit development of fvnac073 mutant is inhibited and fruit ripening time is delayed

[0116] In this Example 3, the mutant strains fvnac073-6 and fvnac073-9 obtained in Example 3 were investigated for fruit phenotype, fruit weight, fruit mature anthocyanin, ABA content, and hardness. The results are as follows:

[0117] 3.1. Investigation of fruit phenotypes at different stages

[0118] The fruit phenotype was monitored at 11, 16, 21, 22, 24, 25, and 28 days after flowering. Figure 2 Middle A.

[0119] from Figure 2 As shown in Figure A, the wild type WT began to turn red at 21 days, reached full maturity at 25 days, and began to lose water at 28 days; the mutant fvnac073-6 began to turn red at 24 days; the mutant fvnac073-9 began to turn red at 22 days. Compared with the mature fruits of Ruegen, the mature fruits of fvnac073-6 and fvnac073-9 were light red.

[0120] 3.2. Investigation of fruit phenotypes at different stages

[0121] According to existing research, strawberry fruits are divided into five growth stages: Small White, Big White, Pre-turning (white skin and red seed coat), Turning (skin starts to turn red) and Ripening (skin is completely red). Between the Pre-turning and Ripening stages, strawberry fruits begin to soften and continue to soften as their color changes.

[0122] Ten fruits of WT, fvnac073-6 and fvnac073-9 at 11-26 days after anthesis were compared and analyzed, and the percentages of fruits at the five growth stages were calculated.

[0123] from Figure 2 As shown in B, on the 25th day after flowering, all the Rugen fruits were in the ripening stage; only 20% of the fvnac073-6 fruits were in the ripening stage, and all the fruits of fvnac073-9 were in the pre-turning and turning stages.

[0124] from Figure 2 As shown in Figure B, on the 28th day after flowering, all the Rugen fruits were overripe, with signs of water loss and aging; while at this time, the fvnac073-6 and fvnac073-9 fruits were ripening.

[0125] 3.3. Investigation of fruit weight

[0126] After 28 days, the strawberries were picked and weighed. Figure 2 Middle C.

[0127] from Figure 2 As shown in Figure C, compared with the wild-type strawberry WT, inhibition of FvNAC073 expression resulted in a 26.52% to 41.77% reduction in strawberry fruit weight.

[0128] 3.4. Investigation of fruit horizontal and vertical diameters

[0129] The strawberries were picked on day 28 and the horizontal and vertical diameters of the single strawberry fruits were measured with a vernier caliper. The results are shown in Figure 2 Middle D and E.

[0130] from Figure 2 As can be seen from D and E, the horizontal and vertical diameters of the fvnac073 mutant are significantly smaller than those of the WT.

[0131] 3.5. Determination of anthocyanin, ABA content and hardness

[0132] 1) Determination of ABA content

[0133] Since ABA is the main plant hormone that regulates the ripening of strawberry fruit, it can increase the activity of cellulase and other enzymes, leading to the disintegration of the cell wall structure and accelerating the ripening and softening process of the fruit. The ABA content of wild-type WT and fvnac073 mutant fruits after picking was measured. The results are shown in Figure 3 Middle C.

[0134] The determination method is as follows: weigh 0.1g of pulp, put it into a 2mL sterile centrifuge tube, add sterile steel beads, freeze it quickly in liquid nitrogen, grind it thoroughly, and add 1mL of ethyl acetate extract. Mix thoroughly for 10min, centrifuge at 10000rpm, centrifuge at 4℃ for 5min, and transfer the supernatant to a new centrifuge tube. Use a nitrogen blower to blow dry the organic phase in the centrifuge tube, add 200μL of 50% methanol solution and shake it thoroughly. After centrifugation at 10000rpm for 5 minutes, absorb the supernatant with a 1mL syringe and filter it into a liquid injection bottle with a 0.22μm organic filter. The detection of endogenous plant hormones uses an LC3000 semi-preparative isobaric high-performance liquid chromatography system (CXTH, BJ, CHN). Install a UV detector (CXTH, BJ, CHN) and a Capecell PAK C18 column (4.6mm×100mm,1.8μm) with a flow rate of 0.8mL / min. The elution program was set as follows: 0-4 min, 20% A, 80% B; 4-8 min, 50% A, 50% B; 8-20 min, 80% A, 20% B; 20-22 min, 80% A, 20% B; 22-22.2 min, 20% A, 80% B. Mobile phase A (0.06% acetic acid water) and mobile phase B (0.06% acetic acid-methanol) were used, and the injection volume was 20 μL. The UV wavelength was 254 nm, and the column temperature was 40 °C. All chromatographic grade reagents were purchased from ANPEL (SHH, CHN).

[0135] from Figure 3 As shown in Figure C, the ABA content in the fruit of the fvnac073 mutant was significantly reduced compared with that in the wild-type strawberry WT.

[0136] 2) Determination of anthocyanin content

[0137] In the early stage of strawberry fruit development, the anthocyanin content is very low or undetectable, but as the fruit matures, the anthocyanin content gradually increases. The anthocyanin content of wild-type WT and fvnac073 mutant fruits after picking was measured, and the results are shown in Figure 3 Middle A.

[0138] Determination method: Grind about 0.2g of pulp in liquid nitrogen, add 600μL 1% HCl (v / v, diluted with methanol), and extract for 12 hours in the dark at 4℃. Add 400μL ddH2O and 1mL chloroform to the extract and vortex, centrifuge for 5min, separate the upper aqueous phase solution and measure the absorbance at 530nm and 657nm.

[0139] The anthocyanin content was calculated as: (A530-A657) / FW, where FW is the fresh weight of strawberry fruit. Three biological replicates were performed.

[0140] from Figure 3As shown in Figure A, after measuring the anthocyanin content of fruits 22 days after flowering and at maturity, it was found that the anthocyanin content in the mutant fvnac073-6 fruit was 98.70% and 24.04% lower than that in the wild-type strawberry WT fruit of the same period, and the anthocyanin content in the mutant fvnac073-9 fruit was 99.44% and 26.87% lower than that in the wild-type strawberry WT fruit of the same period, respectively. This indicates that inhibiting FvNAC073 can reduce the anthocyanin content and delay the coloring of strawberry fruits.

[0141] 3) Hardness measurement

[0142] The degree of fruit maturity and softening is mainly reflected by the hardness of the fruit. The hardness of the fruit mainly depends on the tension of the fruit cells and the integrity of their cell walls, among which the content and form of cellulose and pectin that make up the cell walls play a key role. Studies have found that as strawberry fruits mature, the soluble pectin content continues to increase, and the hardness of the fruit decreases and gradually softens.

[0143] Fruit firmness is one of the important indicators to measure fruit maturity and storage quality. During the fruit ripening and aging process, the fruit firmness gradually decreases. The firmness of wild-type WT and fvnac073 mutant fruits after picking was measured. The results are shown in Figure 3 Middle B.

[0144] Measurement: Fruit firmness was measured using a GY5AB fruit firmness tester with five biological replicates.

[0145] from Figure 3 As shown in Figure B, fruit softening was significantly inhibited in mutants fvnac073-6 and fvnac073-9, and their fruit hardness was 4-6 times higher than that of wild-type strawberry WT at 22 days.

[0146] Example 4 Changes in Fruit Ripening-Related Genes in the fvnac073 Mutant

[0147] To identify genes transcriptionally regulated by FvNAC073 during fruit development and ripening, we performed transcriptome analysis by RNA-seq using 22-d-old WT and fvnac073-9 mutant fruits (Shanghai Paisono Biotechnology Co., Ltd.).

[0148] Since the anthocyanin content in the fruit of the fvnac073 mutant was significantly reduced, we first focused on genes related to anthocyanin synthesis and degradation.

[0149] Anthocyanins are synthesized by a series of enzymes including phenylalanine ammonia lyase (PAL), chalcone synthase (CHS), chalcone isomerase (CHI), flavanone-3-hydroxylase (F3H), dihydroflavonol reductase (DFR), anthocyanidin synthase (ANS) and flavonoid 3-o-glycosyltransferase (UFGT).

[0150] from Figure 4 As shown in Figure A, the expression of FvPAL2, FvCHS, FvCHI, FvF3H, FvDFR2, FvANS, and FvUFGT in the fvnac073 mutant was significantly reduced, indicating that the synthesis of anthocyanins was inhibited, which is consistent with the results of step 3.5 in implementation 2.

[0151] ABA is the main plant hormone that controls the ripening of strawberry fruit. The ABA content of the mutant fvnac073 is significantly reduced. NCED is the key catalytic enzyme for the synthesis of abscisic acid, which can catalyze the conversion of violaxanthin or neoxanthin into flavonoids, and then quickly metabolize into abscisic acid; CYP707A is the key catalytic enzyme for the degradation of abscisic acid, which can degrade abscisic acid to generate phaseolinic acid. The reduction of abscisic acid content will delay the ripening and softening of the fruit, which is mainly manifested in the increase of fruit hardness and the decrease of the expression of genes related to cell wall degradation.

[0152] from Figure 4 As shown in Figure B, transcriptome analysis showed that the gene encoding 9-cis-epoxycarotenoid dioxygenase (FvNCED5), the rate-limiting enzyme in ABA biosynthesis inactivation, was significantly downregulated in fvnac073 mutant fruits. The expression of ABA degradation (ABA inactivation) enzyme genes FvCYP707A4b and FvCYP707A4a was significantly increased.

[0153] In addition, some genes involved in ABA signaling also had expression differences, including protein phosphatases (FvPP2C1, FvPP2C6, FvPP2C10), FvSnRK2.8a, and FvSnRK2.6 protein kinases.

[0154] Example 5 Changes in genes related to cell wall development and degradation in fvnac073 mutants

[0155] Fruit softening is an important feature of ripening. Fruit softening is mainly related to the cell wall structure, which mainly includes cellulose, pectin and hemicellulose, as well as some proteins. The cell wall metabolism-related enzymes and proteins found so far that are related to fruit softening are mainly pectate lyase (PL), polygalacturonase (PG), xyloglucan endotransglucosylase / hydrolase (XTH) and expansion protein (EXP).

[0156] PL acts on pectin substances through β-transfer and elimination mechanisms, randomly cleaving β-1,4-galacturonic acid residues in the gelatin layer and primary cell wall in higher plants. Its main function is to participate in the cleavage of pectin structure during fruit ripening to achieve the purpose of fruit softening; PG can catalyze the cleavage of 1,4-2-D-galactosidic bonds in pectin molecules, leading to the disintegration of cell walls and softening of fruits; XTH can promote the extension of plant cell walls; EXP is a type of non-enzymatic cell wall active protein that can relax plant cell walls; the development and hardness reduction of strawberry fruit are related to the activity of related enzymes in the process of cell wall loosening, degradation and remodeling. The expression analysis results of genes related to cell walls are shown in Figure 5 The analysis method was fluorescence quantitative PCR analysis, the same as in Example 7.

[0157] from Figure 5 It can be seen that the expression of cell wall degradation genes (polygalacturonase FvPG1, FvPG2; pectin lyase FvPL1, FvPL2), cell wall remodeling genes (xyloglucan endotransglycosylase / hydrolase FvXTH2, FvXTH3), and cell wall loosening genes (FvEXP2, FvEXP3) in the fvnac073 mutant was significantly reduced ( Figure 5 ).

[0158] The expression of cell wall degradation genes was reduced, indicating that FvNAC073 could inhibit cell wall extension; the expression of cell wall remodeling genes was reduced, indicating that FvNAC073 could inhibit cell wall extension; the expression of extensin genes was reduced, indicating that FvNAC073 could relax cell walls; overall, inhibition of FvNAC073 could inhibit cell wall expansion and extension, and relax cell walls, resulting in smaller fruits and delayed softening of fvnac073 mutants.

[0159] Example 6 Investigation of the effect of FvNAC073 overexpression on strawberry maturation and development

[0160] In this example, the overexpression vector pHB-FvNAC073-YFP in CN202210932778 was transiently injected into Ruegen strawberry fruits, and the strawberry fruits overexpressing FvNAC073 were photographed and collected for detection of physiological indicators, including the following:

[0161] 6.1 Instant injection into strawberry fruit

[0162] Overexpression experimental group (FvNAC073-OE): The Agrobacterium strain containing the overexpression vector pHB-FvNAC073-YFP was activated and added to a liquid YEP medium containing 50 mg / L Rif (rifampicin) and 50 mg / L Kan (kanamycin). The culture was shaken until OD600 = 0.6-0.8, and the cells were collected by centrifugation at 4000 rpm for 10 min at room temperature. The cells were resuspended in infection buffer (MS medium + 2% sucrose) containing 100 pMAS, and the cells were activated at 28°C for 1 h to obtain an infection solution containing the overexpression vector pHB-FvNAC073-YFP.

[0163] Select Ruegen fruits with the same growth environment and development period for instantaneous injection. Specifically, insert the needle tip of a 1mL syringe into the fruit from the base of the fruit pedicle, and slowly inject the infective solution into the strawberry fruit until the whole fruit appears to be immersed. The strawberry is marked as FvNAC073-OE.

[0164] At the same time, a negative control group (EV-OE) was set up. The negative control group (EV-OE) was composed of an empty vector pHB injected into strawberries using the same construction method and Agrobacterium-mediated method as the overexpression vector pHB-FvNAC073-YFP, and the strawberries were marked as EV-OE.

[0165] 6.2 Phenotypic observation at different days after injection

[0166] The fruit phenotype was monitored at 1, 3, 5, and 7 days after injection. Figure 6 Middle A.

[0167] from Figure 6 As shown in Figure A, FvNAC073-OE has begun to color at 3 days, and the fruit is completely red at 5 days, indicating that overexpression of FvNAC073-OE can promote the ripening of strawberry fruit.

[0168] 6.3. Investigation of fruit horizontal and vertical diameters

[0169] 5d and 7d after injection, the horizontal diameter and vertical diameter of strawberry fruit were measured with vernier calipers. The results are shown in Figure 6Medium B and C.

[0170] from Figure 6 As shown in Figures B and C, 5 and 7 days after injection, the transverse and longitudinal diameters of FvNAC073-OE were significantly larger than those of EV-OE.

[0171] 6.4. Investigation of fruit weight

[0172] The strawberries were picked 5 and 7 days after injection and the single strawberry fruits were weighed. The results are shown in Figure 6 Middle D.

[0173] from Figure 6 As shown in Figure 5D, compared with EV-OE, overexpression of FvNAC073 resulted in an increase of 79.12% and 31.01% in the fruit weight of strawberry at 5d and 7d, respectively.

[0174] 6.5. Determination of anthocyanins and hardness

[0175] 1) Hardness measurement

[0176] The fruit firmness was measured 5 and 7 days after injection. Figure 6 Middle E.

[0177] from Figure 6 As shown in Figure E, 5 days after injection, the fruit softening of FvNAC073-OE was significantly advanced, and its fruit hardness was 61.82% lower than that of EV-OE 5 days after injection.

[0178] 2) Determination of anthocyanin content

[0179] from Figure 6 As shown in Figure F, after measuring the anthocyanin content of the fruit 5d and 7d after injection, it was found that the anthocyanin content in FvNAC073-OE increased by more than 3 times and 25.38% respectively compared with that in EV-OE during the same period, indicating that overexpression of FvNAC073 can increase the anthocyanin content and promote the coloring of strawberry fruit.

[0180] Overall, the results showed that overexpression of FvNAC073 promoted the development of the horizontal and vertical diameters of strawberries, increased the single weight of the fruit, softened earlier, increased the content of anthocyanins, advanced the coloring time and deepened the color, and promoted the ripening and development of strawberries.

[0181] Example 7 Investigation of ripening-related genes in fruits after overexpression of FvNAC073

[0182] In this Example 7, the expression of genes related to ripening was analyzed using fluorescent quantitative PCR for the overexpressed FvNAC073 strawberry obtained in Example 6.

[0183] 7.1. RNA extraction

[0184] Tiangen RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit was used to extract FvNAC073-OE and EV-OE fruits 5 days after injection, with a total of 5 biological replicates.

[0185] 7.2. Obtaining cDNA

[0186] The total RNA was used as a template and reverse transcription was performed according to the instructions of the Total Gold cDNA Synthesis Kit to obtain cDNA.

[0187] 7.3 Fluorescence quantitative PCR analysis

[0188] Specific primers were designed to analyze the relative expression of genes related to fruit ripening and cell wall in strawberry fruit. The primers are shown in Table 1.

[0189] Table 1

[0190]

[0191]

[0192] Fluorescence quantitative analysis: Using the cDNA synthesized in step 7.2 as a template, fluorescence quantitative PCR analysis was performed using the specific primers in Table 1. Real-time PCR reactions were performed on a BIO-RAD Chromo 4 real-time quantification instrument.

[0193] The reaction system was 20 μL, and the reaction was carried out in three steps: denaturation at 94°C for 20 s, followed by 36 cycles of: 94°C for 15 s; 58°C for 15 s; and 72°C for 25 s. The expression results of the genes related to fruit ripening and cell wall are shown in Figure 7 .

[0194] from Figure 7 It can be seen that the expression of FvPAL2, FvCHS, FvCHI, FvF3H, FvDFR2, FvANS, FvUFGT, and FvMYB10 in FvNAC073-OE was significantly increased, indicating that overexpression of FvNAC073 can promote the increase in the synthesis of anthocyanins, which is consistent with the results in Example 4.

[0195] The expression of cell wall degradation genes FvPG1, FvPG2, FvPL1, FvPL2, cell wall remodeling genes FvXTH2, FvXTH3, and cell wall loosening genes FvEXP2, FvEXP3 in FvNAC073-OE was significantly increased ( Figure 7 ). This indicates that FvNAC073 can promote cell wall expansion and extension, while relaxing the cell wall, resulting in larger FvNAC073-OE fruits and earlier softening.

[0196] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limitations of the present invention. In addition, the various modifications listed herein and the variations of methods and compositions in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications obvious to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. Use of FvNAC073 as a target in screening products that regulate strawberry ripening or fruit development.

2. Use of FvNAC073 or a modulator thereof in at least one of A1) to A3): A1) Regulate the ripening of strawberry fruit; A2) Regulates strawberry fruit development; A3) Cultivating strawberries.

3. The use according to claim 1 or 2, characterized in that: Overexpression of FvNAC073 promotes strawberry fruit ripening or development; and / or, knocking out FvNAC073, inhibiting strawberry fruit ripening or inhibiting strawberry fruit development; And / or, the nucleotide sequence of FvNAC073 comprises the sequence shown in SEQ ID NO.

1.

4. The use according to claim 1 or 2, characterized in that: The fruit ripening refers to fruit softening, fruit coloring or increased abscisic acid content in the fruit; And / or, the fruit development refers to the transverse diameter, longitudinal diameter or weight of the fruit.

5. The use according to claim 2, characterized in that: The regulator includes a FvNAC073 promoter and a FvNAC073 inhibitor; the FvNAC073 inhibitor refers to a substance that can inhibit the transcription or translation of the FvNAC073 gene, or can inhibit the expression or activity of the FvNAC073 protein; the FvNAC073 promoter refers to a substance that can promote the transcription or translation of the FvNAC073 gene, or can promote the expression or activity of the FvNAC073 protein.

6. The use according to claim 5, characterized in that The promoter comprises a protein encoded by the FvNAC073 gene or a biological material related to the FvNAC073 gene, wherein the biological material is selected from one or both of a recombinant expression vector and a bioengineering bacterium; And / or, the FvNAC073 inhibitor is selected from one or more of a nucleic acid molecule, a nucleic acid construct, a lentivirus, an adeno-associated virus, a gene editing system and a genetically engineered bacterium.

7. The use according to claim 6, characterized in that The FvNAC073 inhibitor comprises at least one of B1)-B3): B1) the FvNAC073 inhibitor is a nucleic acid molecule, and the target sequence of the nucleic acid molecule comprises the sequence shown in SEQ ID No. 2 or SEQ ID No. 3; B2) the FvNAC073 inhibitor is a gene editing system, and the gene editing system comprises the nucleic acid molecule described in B1); B3) The FvNAC073 inhibitor is a genetically engineered bacterium, which contains the nucleic acid molecule described in B1) or is obtained by transfecting a host with the gene editing system described in B2).

8. A method for promoting the ripening or development of strawberry fruits, characterized in that: The method comprises one or both of the following steps: C1) introducing the FvNAC073 protein into strawberries to promote the ripening or development of strawberry fruits; C2) introducing biological materials related to the FvNAC073 protein into strawberries to promote the ripening or development of strawberry fruits.

9. A method for delaying the ripening of strawberry fruit or inhibiting the development of strawberry fruit, characterized in that: The method comprises the following steps: reducing the expression level of FvNAC073 protein in strawberries to inhibit the ripening of strawberry fruits or inhibit the development of strawberry fruits.

10. A method for cultivating strawberries, characterized in that: The method comprises one or more of the following steps: D1) introducing the FvNAC073 protein to cultivate early-maturing strawberries or strawberries with larger fruits; D2) introducing biological materials related to the FvNAC073 protein to cultivate strawberries with early maturity or larger fruits; D3) reducing the expression level of FvNAC073 protein in strawberries to cultivate strawberries that mature later or have smaller fruits.

Images