Breeding method of paralichthys olivaceus

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) site linked with the growth traits of paralichthys olivaceus, the SNP site is positioned at the 179th site of a nucleotide fragment with the sequence of SEQ ID NO: 1, and the basic group of the SNP site is T or A. On the other hand, the invention provides a method for screening paralichthys olivaceus with rapid growth potential, the method is realized by detecting the SNP locus, and the body size data of an AA homozygous individual with the locus genotype is obviously higher than that of other genotype individuals. The AA genotype is used as a parent for breeding, the obtained filial generation also has a growth advantage, and in production, individuals with the genotype of the site being AA can be preferentially selected as the parent for large-scale breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of fish genetic breeding, and in particular relates to a breeding method for Japanese flounder. Background Art

[0002] The body of the Japanese flounder (Paralichthys Olivaceus) is elongated, oval and flat. It is commonly known as the flatfish, flatfish and flounder in China. It is a precious marine fish and one of the important marine aquaculture fish. It is large in size, tender and delicious in meat, and is a top-quality material for sashimi. It is deeply loved by consumers, has a very broad market, and has high economic value. It is an important marine aquaculture economic fish in northern my country. In recent years, due to overfishing and environmental pollution, the number of wild populations of Japanese flounder has been showing a downward trend, and it is a vulnerable fish. Therefore, it is urgent to carry out germplasm resource protection and large-scale seedling breeding of Japanese flounder, and carry out breeding work while preserving seeds.

[0003] Molecular biology is one of the important themes of contemporary biological research. The continuous progress of scientific research technologies related to molecular biology has enabled researchers to gain a deeper understanding of the various mechanisms of individual inheritance, development and growth. Among them, molecular marker technology has gradually become an important means of studying aquatic animals. All the information required for the development of fish individuals is stored in DNA sequences. Therefore, the genome, transcriptome, and proteome sequences contain a large amount of data information related to individual growth and development.

[0004] However, the breeding of Japanese flounder is still in the traditional artificial breeding aspect. Although some research has been done on molecular genetic markers, there are few reports on the research on the location of growth trait-related genes at the genome level and the development of molecular markers for selective breeding. Compared with traditional morphological research, molecular marker technology with low cost, large amount of information and high accuracy has been widely used in the research of fish growth traits. SNP marker sites related to growth traits have been developed for species such as Nile tilapia, largemouth bass, schizothorax, and Japanese flounder. The present invention uses MyoD1 gene as a candidate gene for the growth traits of Japanese flounder, detects SNP markers by direct sequencing, and performs association analysis with related growth traits, in order to obtain SNP markers associated with the growth traits of Japanese flounder as candidate markers for molecular marker-assisted breeding of Japanese flounder, shorten the breeding cycle, and improve the selection efficiency. Summary of the invention

[0005] The invention provides a method for breeding Japanese flounder. On the basis of screening and obtaining a SNP site linked to the growth trait of Japanese flounder, the Japanese flounder with fast growth trait is bred by detecting whether the SNP site exists.

[0006] The invention firstly provides a SNP molecular marker related to growth traits of Japanese flounder. The SNP molecular marker is located at the 179th position of a nucleic acid fragment with a sequence of SEQ ID NO: 1 and is a T / A substitution.

[0007] The present invention also provides a primer pair for detecting the SNP molecular marker, and a specific primer sequence information thereof is as follows:

[0008] Upstream primer: F: 5′-GTGCAACTCACCGTGTACCA-3′ (SEQ ID NO: 2),

[0009] Downstream primer: R: 5′-TTGTCTTGTGGTTTCTCCATCAT-3′ (SEQ ID NO: 3);

[0010] The present invention also provides a method for screening Japanese flounder with rapid growth potential, which is to screen individuals with the specific genotype of the SNP site;

[0011] The individual of the specific genotype is an individual of AA type;

[0012] The present invention analyzes the correlation between the site genotype and the growth traits of the Japanese flounder and finds that the weight, body length, head length and body height of the Japanese flounder homozygous genotype AA are significantly higher than the phenotypic values ​​of the growth traits of the AT and TT genotype individuals (p<0.05), and the corresponding traits can be quickly identified by PCR and gene sequencing. Therefore, in production, the AA genotype of the site can be preferentially selected as the parent for large-scale breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 : Screened SNP polypeptide loci associated with rapid growth traits of flounder gallbladder;

[0014] Figure 2 :Genotype detection diagram of SNP site T179ADE, a. AT genotype; b. AA genotype; c. TT genotype;

[0015] Figure 3 : Growth data of flounder in the marked group and other groups;

[0016] Figure 4 : Growth data of offspring flounder. DETAILED DESCRIPTION

[0017] The invention continuously designs multiple pairs of primers on the myomodulator protein 1 (MyoD1) gene (GeneID: 109624655) on the chromosome of the Japanese flounder NW_017859644.1, performs PCR amplification on the Japanese flounder and the parent, and performs gene sequencing on the Japanese flounder. When the target fragment amplified by one pair of primers (SEQ ID NO: 2 and SEQ ID NO: 3) is subjected to genotype analysis, a SNP site is found, and there are three genotypes. Through Chromas and DNAMAN 8 software analysis, a SNP site is screened out at the 179th base of the fragment of the sequence SEQ ID NO: 1. Then, the correlation between the mutation genotype frequency of 158 individuals of Japanese flounder with different genotypes and the growth traits of the Japanese flounder is analyzed through SPSS22.0 software, and it is found that the weight, body length and total body length of the individuals with the AA homozygous genotype are significantly higher than the phenotypic values ​​of the corresponding growth traits of the individuals with the TA and TT genotypes (p<0.05). Therefore, in production, individuals with the AA genotype at this site can be preferentially selected as parents or for large-scale breeding.

[0018] The present invention is described in detail below in conjunction with embodiments and drawings.

[0019] Example 1: Screening of SNP sites

[0020] Six large individuals (1.14±0.14kg) and six small individuals (1.00±0.10kg) aged 16 months were selected from the same batch of flounder breeding groups in a flounder farm in Yantai, Shandong Province. The tail fins of each fish were cut and frozen in liquid nitrogen. They were stored in a -20 degree refrigerator for DNA extraction. The total RNA of the flounder was extracted using the Trizol (Invitrogen, USA) kit, and the cDNA chain was synthesized to construct a cDNA library. The transcriptome of the tail fin tissue of the fast-growing group and the slow-growing group of the flounder was analyzed using RNA-Seq technology, and it was found that the myoregulator protein 1 (MyoD1) gene was an important candidate gene affecting the growth of the flounder.

[0021] The genomic DNA was extracted using QIAamp DNA Mini Kit (Qiagen, Beijing). The cloned MyoD1 gene sequence (Gene ID: 109624655) of the Japanese flounder was compared with the whole genome sequence of the Japanese flounder to screen for SNP polymorphic sites in the 5' flanking region, exons and introns. Multiple pairs of primers were designed on the DNA sequence using Primer Premier 5.0 software according to the mutation site (Table 1). The primers were synthesized by Shanghai Shenggong Biotechnology Co., Ltd.

[0022] Table 1: Primer names and sequence list for screening MyoD1 SNP markers in Japanese flounder

[0023]

[0024] Primers were designed according to the upstream and downstream sequences of the SNP markers (Table 1), and multiple PCR amplification was performed on the target fragments. The reaction program used the Touch-down method, 95°C, 3min; 94°C, 15s, 60°C, 15s, 72°C, 30s, 11 cycles, and the annealing temperature of each cycle dropped by 0.5°C; then entered the next cycle program, 94°C, 15s, 54°C, 15s, 72°C, 30s, 24 cycles; , 72°C, 3min. The target fragments obtained by PCR were purified using ExoI and FastAP. The PCR products were fully mixed with the SNaPshot Mix reagent, and the PCR extension reaction was performed. Finally, the target fragments were sequenced on the ABI 3730 sequencer.

[0025] Twelve SNP markers were obtained in the MyoD1 gene of the Japanese flounder, and the correlation between the SNP markers and the growth traits of the Japanese flounder was analyzed in a group of 30 fish in a fast-growing group and a group of 30 fish in a slow-growing group. SNP loci that may be correlated with growth were subjected to SNaPshot typing detection in the remaining 300 individuals to further verify the correlation between the SNP markers and the growth traits of the Japanese flounder.

[0026] SPSS20.0 software was used to analyze the genotype distribution, sample size, and chi-square test of the 12 SNPs of the MyoD1 gene in the fast-growing and slow-growing groups and their correlation with the fast-growing trait. The results showed (Table 2) that the genotype frequency of the SNP site T179A was significantly different in the fast-growing and slow-growing groups (P<0.01), and the AA genotype of the SNP site T179A was significantly correlated with the fast trait.

[0027] Table 2: Correlation between different genotypes of some SNP markers and growth traits of Japanese flounder

[0028]

[0029] The PCR product was sent to a bioengineering company for sequencing. The SNP site was located at position 179 of SEQ ID NO: 1, which was a T / A substitution. The target sequence was as follows:

[0030] TTCACATTATCGTCCGTATTAACACATCTCAATGTCAAATTAAGACAA

[0031] AGACTGCAGCAAGGGTGCAACTCACCGTGTACCACATTTTAGCAGGAGG

[0032] GACATTTAAAGTTACCACTTGGGAAACATCTATCATTATAACAGCATTTTT

[0033] CCTTTTTTCAAGCATTGTTGGATAAAGCATACAGTCTCCAAAAAAACTAA

[0034] AGCACATTTCAATATGATGGAGAAACCACAAGACAATTAAACAGACTAA

[0035] TCTAAATTATGAATCAATG (SEQ ID NO: 1).

[0036] The primer sequence information used to detect the above sequences is as follows:

[0037] Upstream primer: F: 5′-GTGCAACTCACCGTGTACCA-3′ (SEQ ID NO: 2),

[0038] Downstream primer: R: 5′-TTGTCTTGTGGTTTCTCCATCAT-3′ (SEQ ID NO: 3).

[0039] SNaPshot was used to perform genotyping on the SNP locus, which contained three genotypes: TT, AT, and AA. Figure 2 ), among which the body size data of individuals with AA genotype were significantly higher than those with TT and AT genotypes, indicating that it is a dominant gene.

[0040] Example 2: Screening for fast-growing traits in Japanese flounder individuals using SNP loci

[0041] Healthy, well-developed, intact flounder fry were purchased from a flounder breeding pond in a flounder farm in Dalian. The flounder tissues were obtained by non-destructive sampling to obtain the genomic DNA of each flounder. The T179A marker site was amplified and detected using primers with upstream and downstream sequences of SEQ ID NO: 2 and SEQ ID NO: 3, and individuals with genotype AA were screened.

[0042] A total of 220 flounders with T179A marker loci were screened from a total of 2,000 flounders, of which 68 were AA individuals. The screened individuals were cultured indoors under the same culture conditions as the other individuals, and then their growth traits were measured (Table 3 / Figure 3 ), and the results showed that individuals containing specific bands had significant growth effects.

[0043] Table 3: Growth trait data of flounder in the marked group and other groups

[0044]

[0045] The individuals with AA genotype obtained by screening were used as parents for offspring breeding. When the offspring grew to 1 year old, 200 individuals with no obvious damage, no apparent lesions, and good vitality were randomly selected. The morphological traits of the Japanese flounder were measured using a vernier caliper and a balance (Table 4 / Figure 4 ).

[0046] Table 4 Growth trait data of offspring flounder

[0047]

[0048] The growth rate of the AA genotype individuals of Japanese flounder screened by detecting the SNP loci of the present invention is significantly higher than that of the AT and TT genotype individuals. Therefore, the present invention provides a molecular marker for breeding excellent varieties of Japanese flounder, and individuals with the AA genotype of the locus can be preferentially selected as parents for large-scale breeding in production.

Claims

1. A SNP locus linked to growth traits of Japanese flounder, characterized in that: The site is located at the 179th position of the nucleotide fragment of SEQ ID NO: 1, and its base is T or A.

2. A primer pair for detecting the SNP site according to claim 1, characterized in that: The forward primer of the primer pair has a sequence of SEQ ID NO: 2, and the reverse primer has a sequence of SEQ ID NO:

3.

3. A method for screening a flounder parent with rapid growth potential, characterized in that: The method is to screen the Japanese flounder individuals by detecting the genotype of the SNP site described in claim 1.

4. The method according to claim 3, characterized in that The method described is a PCR amplification sequencing detection method.

5. The method according to claim 3, characterized in that The screening of individuals with rapid growth potential is to screen individuals with AA genotype.

Images