SNP (Single Nucleotide Polymorphism) molecular marker related to pig growth traits and application of SNP molecular marker

Abstract

The invention relates to an SNP molecular marker related to pig growth traits and application thereof.The nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO: 1, the SNP molecular marker is located at the 30318006bp position of the No.7 chromosome of a pig reference genome Sscrofa11.1 version, the SNP molecular marker is located at the 60bp position corresponding to the SEQ ID NO: 1, and the basic group at the 60bp position mutates from G to A; an individual of which the genotype is AA of the SNP molecular marker has a high growth inheritable character; an individual of which the genotype is GG or AG of the SNP molecular marker has a low growth hereditary character; during breeding, individuals with the genotype of AA of the SNP molecular marker are reserved, and individuals with the genotype of GG or AG are eliminated, so that the growth performance of offspring pigs is improved.

Description

Technical Field

[0001] The present invention relates to the fields of molecular biology and genetic breeding, and in particular to a SNP molecular marker associated with pig growth traits and an application thereof. Background Art

[0002] China and Europe are the two largest pork production and consumption regions in the world, with many domestic pig breeds. During the domestication process, China and Europe selected and bred domestic pigs in different directions for different purposes, resulting in obvious differentiation of the phenotypes of domestic pig breeds in the two regions. Growth rate is one of the most significant differences, among which the growth rate of Chinese local pig breeds is significantly slower than that of European commercial pigs. Although with the development of social productivity, people have more diverse ways to obtain meat protein foods, and poultry eggs, aquatic products, and more nutritious beef and mutton have replaced pork, pork is still the main meat on the table of Chinese residents. Due to the huge demand for pork in my country, in order to meet people's demand for pork in daily life, pig farming is mainly based on European commercial pigs such as Large White and Duroc. Although my country has many local pig breeds with excellent meat quality, they grow slowly and have high breeding costs, making them difficult to breed on a large scale. Therefore, exploring candidate genes related to domestic pig growth traits and cultivating fast-growing pig breeds can not only improve meat quality and meet market demand, but also enhance breeding efficiency and bring greater economic benefits to the breeding industry.

[0003] In recent years, the rapid development of molecular genetic technology has made DNA molecular marker technology play an important role in the study of pig genetic diversity. In order to better develop and utilize the excellent economic characteristics of excellent breeds and protect and rationally utilize breed resources, it is necessary to develop molecular markers specific to pig growth traits and apply them to the selection and breeding of high growth trait pigs to provide a theoretical basis for molecular breeding of pigs. According to the query in the FarmGTEx database, the HMGA1 gene (Growth arrest-specific gene7, HMGA1) is a gene with tissue spectrum expression, which is expressed in fat, muscle, and bone tissues. Compared with wild-type mice, the body size and weight of mice were significantly reduced after knocking out HMGA1. Through RNA-seq data analysis, the gene was significantly differentially expressed in the longissimus dorsi muscle tissue of large white and horse-body pigs, with high expression in large white pigs (high growth trait group) and low expression in horse-body pigs (low growth trait group). However, SNP molecular markers related to pig growth traits based on the HMGA1 gene have not been fully studied. Summary of the invention

[0004] In order to solve the above problems, the present invention proposes a SNP molecular marker related to pig growth traits and application thereof.

[0005] The invention discloses an application of a SNP molecular marker related to pig growth traits in pig breeding. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, the SNP molecular marker is located at 30318006bp of chromosome 7 of the pig reference genome Sscrofa11.1 version, the SNP molecular marker is located at the 60bp of the corresponding SEQ ID NO:1, and the base at the position mutates from G to A; an individual whose genotype of the SNP molecular marker is AA has a high growth genetic trait; an individual whose genotype of the SNP molecular marker is GG or AG has a low growth genetic trait; during breeding, the growth performance of offspring pigs is improved by retaining the individual whose genotype of the SNP molecular marker is AA and eliminating the individual whose genotype is GG or AG.

[0006] Furthermore, the primer combination for detecting the SNP molecular marker includes a forward primer as shown in SEQ ID NO:2 and a reverse primer as shown in SEQ ID NO:3.

[0007] Furthermore, the application includes the selection and breeding of pig growth traits, breeding of high growth trait pig strains, genetic improvement of pigs, and screening of high growth trait piglets.

[0008] Furthermore, when applied to the breeding of pig growth traits, the SNP molecular markers of reserve breeding pigs are first detected, and then individuals with the genotype of the SNP molecular markers being AA are retained, and individuals with the genotypes being GG or AG are eliminated.

[0009] Furthermore, when applied to breeding high growth trait pig strains, the SNP molecular markers of reserve breeding pigs are first detected, and then individuals with the SNP molecular marker genotype of AA are retained as breeding pigs, and individuals with the genotype of GG or AG are eliminated, and the male and female pigs used as breeding pigs are mated, and then the SNP molecular markers are detected for the pigs born from the mating, and individuals with the genotype of AA are retained, and individuals with the genotype of GG or AG are eliminated, and then breeding is carried out to obtain high growth trait pig strains.

[0010] Furthermore, when applied to the genetic improvement of pigs, the SNP molecular markers of reserve breeding pigs are first detected, and then the individuals with the SNP molecular marker genotype of AA are retained as breeding pigs, and the individuals with the genotype of GG or AG are eliminated, and the male and female pigs used as breeding pigs are mated, and the breeding pig individuals with the genotype of AA continue to be selected in the offspring, and the individuals with the genotype of AG or GG are eliminated, so as to increase the frequency of the allele A in the offspring pig population generation by generation, thereby improving the growth performance of the offspring breeding pigs.

[0011] Furthermore, when applied to screening piglets with high growth traits, the SNP molecular markers of the piglets to be screened are first detected. When the genotype of the detected SNP molecular marker is AA, the piglets to be screened have the high growth genetic trait and are retained; when the genotype of the detected SNP molecular marker is GG or AG, the piglets to be screened have the low growth genetic trait and are eliminated.

[0012] The beneficial effects of the present invention are as follows:

[0013] 1. The present invention screened and identified a SNP molecular marker (chr7-30318006: G>A) related to the growth traits of pigs. The weight of pigs with different genotypes of the SNP molecular marker at 240 days of age was significantly different; the average weight of pigs with the SNP molecular marker genotype GG at 240 days of age was 105Kg, and the average weight of pigs with the molecular marker genotype AA at 240 days of age was 115.3Kg. The A allele significantly improved the growth traits, and the AA genotype was the dominant genotype. Therefore, by applying the molecular marker, the growth of pigs can be greatly improved, the production performance of pigs can be improved, and the genetic improvement progress and breeding process of breeding pigs can be accelerated.

[0014] 2. By detecting the genotype of the SNP molecular marker to assist in the selection of sows, the growth performance of pigs can be effectively improved by selecting sows with the AA genotype, which is convenient for the comprehensive breeding of subsequent sows.

[0015] 3. By applying the SNP molecular marker to the cultivation of high growth trait pig strains, pig strains with high growth traits during the fattening period can be obtained, thereby improving the production performance of the strain of pigs and accelerating the genetic improvement and breeding process of breeding pigs.

[0016] 4. By applying the SNP molecular markers to the genetic improvement of pigs, the genetic breeding period can be greatly shortened, the growth of pigs can be improved, and the genetic improvement progress and breeding process of breeding pigs can be accelerated.

[0017] 5. By applying the SNP molecular marker to screen piglets with high growth genetic traits, breeding pigs with high growth traits can be screened out at the piglet stage and selected. In this way, the growth traits of breeding pigs are selected at the piglet stage, which can greatly improve breeding efficiency and save feeding costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 For growth trait correlation analysis;

[0019] Figure 2 This is the phenotype of the body weight trait of the F2 generation of the hybrid resource group of Large White and Min pigs at 240 days of age;

[0020] Figure 3Manhattan plot of GWAS analysis of body weight trait of F2 individuals at 240 days of age in the hybrid resource group of Large White and Min pigs;

[0021] Figure 4 Manhattan plot (upper) and LD block analysis (lower) of the candidate region of chromosome 7 for the weight trait of F2 individuals at 240 days of age in the hybrid resource group of Large White and Min pigs;

[0022] Figure 5 The binding site of transcription factor NR2C2 is changed;

[0023] Figure 6 This is the analysis of slaughter weight of individuals with different genotypes at the mutation site (chr7-30318006:G>A) at 240 days of age;

[0024] Figure 7 This is the sequencing result of individuals with different genotypes at the mutation site (chr7-30318006:G>A). DETAILED DESCRIPTION

[0025] The present invention will be further described below with reference to the embodiments.

[0026] Example 1: Process steps for obtaining SNP molecular markers:

[0027] 1. Based on a total of 675 individuals in three generations of the Large White and Min pig hybrid resource group (19 F0 generations, 55 F1 generations, and 601 F2 generations), tissue samples of 675 individuals in the group and growth phenotypes of F2 generation individuals (weight at 240 days of age and marbling traits) were collected, total DNA from tissue samples was extracted, and the DNA was quality controlled and sent to a sequencing company for whole genome resequencing (Novogene, Illumina platform). The sequencing depth of F0 generation individuals was about 42.06×, and the coverage reached 99.16%, the sequencing depth of F1 generation individuals was about 7.18×, and the coverage reached 98.07%, and the sequencing depth of F2 generation individuals was about 6.10×, and the coverage reached 96.71%.

[0028] 2. Arrange the fastq files downloaded from the sequencing company and the fastq data of other pig breeds downloaded from NCBI. Quality control: According to the results of whole genome resequencing, first use FastQC (version v0.11.9) software to perform quality control analysis on the original sequencing data to remove the adapter sequence and low-quality sequencing data.

[0029] 3. Sequence alignment: The domestic pig Sscrofa11.1 version was used as the reference genome and the BWA (version0.7.17) alignment software was used for data alignment. Then, the Picard (version 1.119) software was used to add headers to the Sam files and add sample names. The Sam format files were converted to Bam files and sorted and output. Then, the sorted Bam files were indexed using the Samtools (version 1.0) software.

[0030] 4. Remove duplicate reads: Use Picard (version 1.119) software to remove duplicates and create an index. Variant detection: After the whole genome data of F0, F1, and F2 generations are aligned and deduplicated, Sscrofa11.1 is used as the reference genome to perform variant detection at the whole genome level using the HaplotypeCaller module in GATK (version 3.6) software to generate VCF format files.

[0031] 5. Data filtering: Filter SNPs and indels data with the filtering criteria of FS>60, QD<2.0, QUAL<40, and MQ<25.

[0032] 6. Genotype filling: Then, the high-quality VCF file of the F0 generation was used as a reference to fill the genotypes of the F1 generation individual data through beagle (version 4.0) software. Then, the F2 generation individual data was further filled with genotypes based on the F1 generation data to obtain the genome variation data of the F2 generation individuals as accurately as possible.

[0033] from Figure 1 It can be seen that based on the growth phenotype data analysis of a total of 675 individuals in three generations of the Large White and Min pig hybrid resource group (19 F0 generation, 55 F1 generation, and 601 F2 generation), the six growth traits of body height, body length, carcass straight length, left carcass weight, right carcass weight and slaughter weight at 240 days of age were strongly correlated with each other (the correlation coefficient was greater than 0.6). Figure 1 BW240 is the slaughter weight at 240 days of age, BL is the body length, BH is the body height, CL is the carcass length, CSL is the straight length of the carcass, CWL is the left carcass weight, and CWR is the right carcass weight. The correlation coefficient R2>=0.6 among the above growth traits is strongly correlated.

[0034] The 240-day-old slaughter weight and body height, body length, carcass length, left carcass weight, and right carcass weight were selected for joint GWAS analysis based on whole genome resequencing data. It was found that these six growth traits shared a quantitative trait locus ( Figure 2 ), among which HMGA1 is a gene significantly associated with pig growth traits ( Figure 3), combined with functional annotation, it was found that a SNP in the promoter region of HMGA1 (chr7-30318006:G>A) was a SNP significantly associated with pig growth traits. The mutation of this site changes the binding ability of transcription factor NR2C2, thereby regulating the expression of the HMGA1 gene and affecting the growth traits of pigs ( Figure 4 , Figure 5 , Figure 6 ).

[0035] Example 2: The process steps for screening and verifying the above-mentioned SNP molecular markers:

[0036] The population used in the present invention is an artificially constructed hybrid population of Large White and Min pigs of the third generation, which has a certain population structure. The pig growth trait is a quantitative trait. The compressed mixed linear model (CMLM) is selected as the calculation model. The model is developed from the mixed linear model (MLM). Compared with the mixed linear model, the model divides the research population into groups according to kinship, compresses the research population into more small groups to replace individuals, thereby speeding up the calculation speed and improving the accuracy of the calculation. The calculation formula of the model is:

[0037] y=Wα+xβ+Zu+ε

[0038] Where y is the phenotypic value of the trait to be studied, Wα is the fixed effect, xβ is the genetic marker effect, Zu is the random effect, usually refers to the kinship of individuals, and ε is the random error. In this model, we use the first 10 principal components of the principal component analysis results as covariates to correct the data, so as to better reduce the false positive results. The analysis process is as follows:

[0039] 1. Data filtering: We further filtered the VCF files after genotype filling of 601 F2 individuals. In order to detect rare variants that affect traits and variants with small effects, we filtered variant sites with minor allele frequency (MAF) less than 0.01.

[0040] 2. Constructing the population structure file: Our research population is an artificially constructed hybrid population. After two hybridizations, gene separation will occur in the F2 generation population, resulting in a certain population structure. Therefore, we further use the plink software (version 1.9) to perform principal component analysis (PCA) based on SNP data. Then, we use admixture (version 1.3.0) software to perform population structure analysis, generate a population structure matrix, and add the first ten principal components of the principal component analysis results to the population structure matrix to generate the final population structure file, which is used as a fixed effect to correct the calculation results during the calculation process.

[0041] 3. Construct a kinship matrix: Use EMMAX software to calculate the kinship matrix of the population and use the results as covariates to reduce the possibility of false positives and false associations.

[0042] 4. Construct trait data file: Construct trait file based on previously statistical trait data and sample number for subsequent association analysis ( Figure 1 and Figure 2 ).

[0043] 5. Construct genotype file: First convert the VCF file into plink format using vcftools (version 0.1.13) software, then use plink software to convert the plink format file into a binary format file, and finally continue to use plink software to convert the binary format file into a genotype input file that can be recognized by EMMAX software.

[0044] 6. Association analysis: Based on the constructed population structure file, kinship matrix, trait data file and genotype file, whole genome association analysis was performed using EMMAX software ( Figure 3 and Figure 4 ).

[0045] 7. SnpEff software was used to annotate candidate SNPs. Combined with functional annotation, it was found that a SNP in the promoter region of HMGA1 (chr7-30318006:G>A) was a SNP significantly associated with pig growth traits. The mutation of this site changes the binding ability of transcription factor NR2C2, thereby regulating the expression of the HMGA1 gene and affecting the growth traits of pigs ( Figure 5 The average weight at 240 days of age for the molecular marker genotype GG was 105 kg, and the average weight at 240 days of age for the molecular marker genotype AA was 115.3 kg. The A allele significantly improved growth traits, and the AA genotype was the dominant genotype ( Figure 6 ).

[0046] Example 3, the process steps of the above molecular marker function annotation:

[0047] In order to explore the distribution of variant sites in the genome, we used the filtered high-quality variant site data as the input file, the Sscrofa11.1 version genome and the Sscrofa11.1.106.gtf version annotation file as references, and used snpEeff (version 5.0) software to functionally annotate the variant sites.

[0048] According to previous studies, most functional variations in the genome often occur in non-coding regions of the genome, which play a role in regulating gene expression by destroying or enhancing the binding ability of certain specific transcription factors to motif sequences (specific binding sequences of transcription factors). Therefore, in order to verify whether the variant sites screened by GWAS will destroy the motif sequences of related transcription factors, we selected sequences located 15bp upstream and downstream of the variant sites and annotated motifs in the JASPAR database (https: / / jaspar.genereg.net / ) with humans and mice, two species that are closely related to domestic pigs, as references (JASPAR database is a free and open transcription factor collection database, which collects data from six major categories of different organisms, including fungi, insects, nematodes, plants, urochordates and vertebrates, among which vertebrates include humans and mice. The JASPAR CORE database is a collection of experimentally verified transcription factor binding site data sets with high reliability).

[0049] This example found that a SNP (chr7-30318006: G>A) in the promoter region of HMGA1 is a SNP significantly associated with pig growth traits. The mutation of this site changes the binding ability of the transcription factor NR2C2, thereby regulating the expression of the HMGA1 gene, affecting the growth traits of pigs ( Figure 5 ).

[0050] In this embodiment, the following primers are used to amplify the (chr7-30318006:G>A) molecular marker, the forward primer sequence is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3:

[0051] Forward primer: 5′CCCCAGTCCCATTAAAGCCT 3′

[0052] Reverse primer: 5′TGTAAGCCAGCTCAAACCCT 3′

[0053] PCR amplification methods include:

[0054] (1) Extracting genomic DNA from the pig to be tested;

[0055] (2) using genomic DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO. 2-3;

[0056] (3) Analyze the PCR amplification products.

[0057] The amplification system used in the PCR reaction was as follows in 50 μl: 1 μl of 100 ng / μl template DNA, 1 μl of 10 pmol / μl forward primer and reverse primer, 1 μl of 10 mmol / L dNTP Mixture, 1 μl of 1.25 U / 25 μl TaKaRa Ex Taq DNA polymerase, 25 μl of 2× PCR reaction buffer, and the remainder was double distilled water.

[0058] The PCR reaction program was as follows: PCR reaction conditions were: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 64°C annealing for 30 s, 72°C extension for 30 s, for a total of 32 cycles; 72°C incubation for 5 min; 4°C hold. Figure 7 Label.

[0059] In summary, the present invention screened and identified a SNP molecular marker (chr7-30318006: G>A) associated with pig growth traits, and the weight of pigs with different genotypes of the SNP molecular marker at 240 days of age had extremely significant differences, and individuals with the genotype of the SNP molecular marker being AA had high growth genetic traits; individuals with the genotype of the SNP molecular marker being GG or AG had low growth genetic traits; during breeding, the growth performance of offspring pigs was improved by retaining individuals with the genotype of the SNP molecular marker being AA and eliminating individuals with the genotype of GG or AG. By applying this molecular marker, the genetic improvement progress and breeding process of breeding pigs can be accelerated.

[0060] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

[0061] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. Application of a SNP molecular marker associated with pig growth traits in pig breeding, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, and the SNP molecular marker is located at the 30318006bp of chromosome 7 of the pig reference genome Sscrofa11.1 version. The SNP molecular marker is located at the 60bp corresponding to SEQ ID NO:1, and the base therein mutates from G to A; individuals whose genotype of the SNP molecular marker is AA have a high growth genetic trait; individuals whose genotype of the SNP molecular marker is GG or AG have a low growth genetic trait; during breeding, the growth performance of offspring pigs is improved by retaining individuals whose genotype of the SNP molecular marker is AA and eliminating individuals whose genotype is GG or AG.

2. The use of the SNP molecular marker associated with pig growth traits in pig breeding according to claim 1, characterized in that: The primer combination for detecting the SNP molecular marker includes a forward primer as shown in SEQ ID NO:2 and a reverse primer as shown in SEQ ID NO:

3.

3. The use of the SNP molecular marker associated with pig growth traits in pig breeding according to claim 1, characterized in that: The applications include breeding of pig growth traits, cultivating pig strains with high growth traits, genetic improvement of pigs, and screening of piglets with high growth traits.

4. The use of the SNP molecular marker associated with pig growth traits in pig breeding according to claim 3, characterized in that: When applied to the breeding of pig growth traits, the SNP molecular markers of reserve breeding pigs are first detected, and then individuals with the genotype of the SNP molecular marker being AA are retained, and individuals with the genotype being GG or AG are eliminated.

5. The use of the SNP molecular marker associated with pig growth traits in pig breeding according to claim 3, characterized in that: When applied to breeding high growth trait pig strains, the SNP molecular markers of reserve breeding pigs are first detected, and then individuals with the SNP molecular marker genotype of AA are retained as breeding pigs, and individuals with the genotype of GG or AG are eliminated, and the male and female pigs used as breeding pigs are mated, and then the SNP molecular markers are detected for the pigs born from the mating, and individuals with the genotype of AA are retained, and individuals with the genotype of GG or AG are eliminated, and then breeding is carried out to obtain high growth trait pig strains.

6. The use of the SNP molecular marker associated with pig growth traits in pig breeding according to claim 3, characterized in that: When applied to the genetic improvement of pigs, the SNP molecular markers of reserve breeding pigs are first detected, and then the individuals with the SNP molecular marker genotype of AA are retained as breeding pigs, and the individuals with the genotype of GG or AG are eliminated, and the male and female pigs used as breeding pigs are mated, and the breeding pig individuals with the genotype of AA continue to be selected in the offspring, and the individuals with the genotype of AG or GG are eliminated, so as to increase the frequency of allele A in the offspring pig population generation by generation, thereby improving the growth performance of the offspring breeding pigs.

7. The use of the SNP molecular marker associated with pig growth traits in pig breeding according to claim 3, characterized in that: When used for screening piglets with high growth traits, the SNP molecular markers of the piglets to be screened are first detected. When the genotype of the detected SNP molecular marker is AA, the piglets to be screened have the high growth genetic trait and are retained; when the genotype of the detected SNP molecular marker is GG or AG, the piglets to be screened have the low growth genetic trait and are eliminated.

Images