Primer probe combination for detecting bovine susceptible virus, multiplex fluorescent quantitative PCR (polymerase chain reaction) kit and detection method

Abstract

The invention provides a primer probe combination for detecting bovine susceptible viruses, a multiplex fluorescent quantitative PCR (polymerase chain reaction) kit and a detection method, and belongs to the technical field of bovine epidemic virus detection. Specific primers and probes are designed according to gene sequences of two high-frequency detected viruses, namely, the bovine coronavirus and the bovine respiratory syncytial virus, and whether infection of the two viruses exists in a sample or not is simultaneously identified by utilizing multiple fluorescent quantitative PCR, so that the detection time is shortened, and the primer and the probe have important significance on prevention of the bovine epidemic virus. Meanwhile, the multiple primer probe group and the detection method disclosed by the invention are high in sensitivity and good in specificity, also have the characteristics of rapidness, practicability, low cost and simplicity and convenience in operation, and can meet the detection requirements on the two bovine susceptible viruses, namely the bovine coronavirus and the bovine respiratory syncytial virus.

Description

Technical Field

[0001] The present invention relates to the technical field of bovine epidemic virus detection, in particular to a primer-probe combination for detecting bovine susceptible viruses and a multiplex fluorescence quantitative PCR kit and a detection method. Background Art

[0002] Viral infectious diseases are important diseases that endanger cattle. In recent years, the expansion of the scale of cattle farming, the increase in mixed farming models, the increased mobility of people and animals, and the decline in water quality caused by water source pollution have created favorable conditions for the spread of viruses. Local viral diseases have increased significantly, and new epidemics have continued to occur, causing serious economic losses to the cattle industry. At present, the main viruses that infect cattle are influenza viruses such as bovine coronavirus, bovine parainfluenza virus, bovine adenovirus, and bovine respiratory syncytial virus. Bovine coronavirus (BCoV) can cause respiratory and intestinal diseases in cattle, such as diarrhea in newborn calves and winter dysentery in adult cattle, which brings huge economic losses to the cattle industry; it can spread rapidly among cattle, affecting the growth and development, reproductive performance, and milk production of cattle. Bovine respiratory syncytial virus (BRSV) also threatens the health of cattle, causing respiratory diseases, leading to symptoms such as difficulty breathing in cattle, and in severe cases, it can cause lung lesions and increase the mortality rate of cattle. It can be seen that bovine coronavirus and bovine respiratory syncytial virus are seriously harmful to cattle, and these two viruses are highly infectious. Therefore, how to establish a method for rapid detection of cattle viruses so as to take preventive measures as soon as possible and reduce economic losses is an important issue that plagues the cattle industry.

[0003] Clinically, virus isolation and identification, serological testing, immunoelectron microscopy, ELISA, Real-time PCR, LAMP and ordinary PCR have been applied to the detection of these viral infections, but virus isolation and identification takes a long time, serological and ELISA testing is time-consuming and laborious, and immunoelectron microscopy has high requirements for equipment and virus purification, which have brought limitations to clinical diagnosis. PCR detection technology is highly sensitive, simple, rapid, safe, easy to promote, and can be detected without isolating the virus. Multiplex PCR (m-PCR) is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to amplify multiple nucleic acid fragments at the same time. The process and principle are the same as ordinary PCR, but it has incomparable advantages over ordinary PCR. In terms of viral disease detection and differential diagnosis, multiplex PCR can detect and identify multiple viruses at the same time, and is an effective method for rapid diagnosis of mixed viral infections in clinical practice. At present, there are no reports on multiplex PCR for bovine coronavirus and bovine respiratory syncytial virus. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a primer-probe combination for detecting cattle susceptible viruses, a multiplex fluorescence quantitative PCR kit and a detection method. The detection method of the present invention can simultaneously detect bovine coronavirus and bovine respiratory syncytial virus.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a primer-probe combination for detecting cattle susceptible viruses, wherein the cattle susceptible viruses include bovine coronavirus and bovine respiratory syncytial virus. The primer-probe combination is as follows:

[0007] The primer probe for detecting bovine coronavirus (primer probe combination I) includes an upstream primer BCoV-F, a downstream primer BCoV-R and a probe BCoV-P: the nucleotide sequence of the upstream primer BCoV-F is shown in SEQ ID NO.1, the nucleotide sequence of the downstream primer BCoV-R is shown in SEQ ID NO.2, and the nucleotide sequence of the probe BCoV-P is shown in SEQ ID NO.3;

[0008] The primer probe for detecting bovine respiratory syncytial virus (primer probe combination II) includes an upstream primer BRSV-F, a downstream primer BRSV-R and a probe BRSV-P: the nucleotide sequence of the upstream primer BRSV-F is shown in SEQ ID NO.4, the nucleotide sequence of the downstream primer BRSV-R is shown in SEQ ID NO.5, and the nucleotide sequence of the probe BRSV-P is shown in SEQ ID NO.6.

[0009] The present invention also provides the use of the primer-probe combination in at least one or more of the following:

[0010] (1) Detecting whether the virus to be tested is bovine coronavirus or bovine respiratory syncytial virus;

[0011] (2) preparing a kit for detecting whether the virus to be tested is bovine coronavirus or bovine respiratory syncytial virus;

[0012] (3) Detecting whether the sample to be tested contains bovine coronavirus and / or bovine respiratory syncytial virus;

[0013] (4) preparing a kit for detecting whether a sample to be tested contains bovine coronavirus and / or bovine respiratory syncytial virus;

[0014] The application is for non-disease diagnosis purposes.

[0015] The invention also provides a kit containing the primer-probe combination.

[0016] The present invention also provides a multiplex fluorescent quantitative PCR method for simultaneously detecting bovine coronavirus and bovine respiratory syncytial virus, using the genomic DNA of the virus in the sample to be tested as a template, and amplifying with the primer probe combination, if the primer probe combination I shows positive amplification, the sample to be tested contains bovine coronavirus; if the primer probe combination II shows positive amplification, the sample to be tested contains bovine respiratory syncytial virus;

[0017] The multiplex fluorescence quantitative PCR method is for non-disease diagnosis purposes.

[0018] Preferably, the reaction system of multiplex fluorescence quantitative PCR is: 2×All-Powerful fluorescence quantitative PCR PreMix 10 μL, upstream primer BCoV-F, downstream primer BCoV-R, upstream primer BRSV-F, downstream primer BRSV-R 0.4 μL each, probe BCoV-P, BRSV-P 0.2 μL each, ddH2O 5.8 μL, and genomic DNA of the virus to be tested 2 μL.

[0019] Preferably, the reaction procedure of multiplex fluorescence quantitative PCR is: 37°C (contamination digestion) for 2 min; 95°C (pre-denaturation) for 30 s; [95°C (extension) for 10 s, 58°C (annealing) for 30 s] (these two steps are a cycle reaction, cycled 45 times), 45 cycles.

[0020] By adopting the above technical scheme, the present invention has the following beneficial effects: the present invention designs specific primers and probes for the gene sequences of the two high-frequency detected viruses, bovine coronavirus and bovine respiratory syncytial virus, and uses multiple fluorescent quantitative PCR to simultaneously identify whether the sample is infected with the two viruses, thereby shortening the detection time and having important significance for the prevention of bovine epidemic viruses. At the same time, the multiple primer probe set and the detection method of the present invention have high sensitivity and good specificity, and are also fast, practical, low-cost and easy to operate, and can meet the detection needs of the two cattle susceptible viruses, bovine coronavirus and bovine respiratory syncytial virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the result of amplification of the BCoV target fragment.

[0022] Figure 2 This is the result of amplification of the BRSV target fragment.

[0023] Figure 3 This is the single-plex fluorescence quantitative PCR amplification curve of BCoV primer 0.2μM probe 0.2μM, from left to right, 1×10 8 Up to 1×10 1 , the same below.

[0024] Figure 4This is the single-plex fluorescence quantitative PCR standard curve with a BCoV primer concentration of 0.2 μM and a probe concentration of 0.2 μM.

[0025] Figure 5 This is the single-plex fluorescence quantitative PCR amplification curve with a BCoV primer concentration of 0.2 μM and a probe concentration of 0.15 μM.

[0026] Figure 6 This is the single-plex fluorescence quantitative PCR standard curve with a BCoV primer concentration of 0.2 μM and a probe concentration of 0.15 μM.

[0027] Figure 7 This is the single-plex fluorescence quantitative PCR amplification curve with a BCoV primer concentration of 0.2 μM and a probe concentration of 0.1 μM.

[0028] Figure 8 This is the single-plex fluorescence quantitative PCR standard curve with a BCoV primer concentration of 0.2 μM and a probe concentration of 0.1 μM.

[0029] Fig. 9 This is the single-plex fluorescence quantitative PCR amplification curve with a BCoV primer concentration of 0.15 μM and a probe concentration of 0.15 μM.

[0030] Fig.10 This is the single-plex fluorescence quantitative PCR standard curve with a BCoV primer concentration of 0.15 μM and a probe concentration of 0.15 μM.

[0031] Fig.11 This is the seven-gradient standard curve of the optimal concentration of BCoV.

[0032] Fig.12 This is the single-plex fluorescence quantitative PCR amplification curve with a BRSV primer concentration of 0.2 μM and a probe concentration of 0.2 μM.

[0033] Fig.13 This is the single-plex fluorescence quantitative PCR standard curve with a BRSV primer concentration of 0.2 μM and a probe concentration of 0.2 μM.

[0034] Fig.14 This is the single-plex fluorescence quantitative PCR amplification curve with a BRSV primer concentration of 0.2 μM and a probe concentration of 0.15 μM.

[0035] Fig.15 This is the single-plex fluorescence quantitative PCR standard curve with a BRSV primer concentration of 0.2 μM and a probe concentration of 0.15 μM.

[0036] Fig.16 This is the single-plex fluorescence quantitative PCR amplification curve with a BRSV primer concentration of 0.2 μM and a probe concentration of 0.1 μM.

[0037] Fig.17This is the single-plex fluorescence quantitative PCR standard curve with a BRSV primer concentration of 0.2 μM and a probe concentration of 0.1 μM.

[0038] Fig.18 This is the single-plex fluorescence quantitative PCR amplification curve with a BRSV primer concentration of 0.1 μM and a probe concentration of 0.1 μM.

[0039] Fig.19 This is the single-plex fluorescence quantitative PCR standard curve with a BRSV primer concentration of 0.1 μM and a probe concentration of 0.1 μM.

[0040] Fig. 20 This is the seven-gradient standard curve of the optimal concentration of BRSV.

[0041] Fig.21 It is the amplification curve of dual fluorescence quantitative PCR at annealing temperature of 57℃; the solid line is BCoV and the dotted line is BRSV.

[0042] Fig. 22 This is the standard curve of dual fluorescence quantitative PCR at an annealing temperature of 57°C. Blue represents BCoV and red represents BRSV.

[0043] Fig.23 It is the amplification curve of dual fluorescence quantitative PCR at annealing temperature of 58°C; the solid line is BCoV, and the dotted line is BRSV.

[0044] Fig.24 This is the standard curve of dual fluorescence quantitative PCR at an annealing temperature of 58°C. Blue represents BCoV and red represents BRSV.

[0045] Fig.25 It is the amplification curve of dual fluorescence quantitative PCR at annealing temperature of 60℃; the solid line is BCoV and the dotted line is BRSV.

[0046] Fig.26 This is the standard curve of dual fluorescence quantitative PCR at an annealing temperature of 60°C. The blue represents BCoV and the red represents BRSV.

[0047] Fig. 27 Graph showing the amplification curves of BCoV and BRSV in the multiplex PCR system of the sensitivity experiment in Example 5, wherein the solid line is the amplification curve of BCoV; and the dotted line is the amplification curve of BRSV.

[0048] Fig.28 This is the amplification curve of BCoV in the multiplex PCR system of the sensitivity experiment in Example 5.

[0049] Fig.29 This is the BRSV amplification curve in the multiplex PCR system of the sensitivity experiment in Example 5.

[0050] Fig.30 Example 5 Standard curves of BCoV and BRSV in the multiplex PCR system of the sensitivity experiment, where blue represents BCoV and red represents BRSV.

[0051] Fig.31 This is the amplification curve of multiplex PCR in the specific experiment of Example 6. DETAILED DESCRIPTION

[0052] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0053] Example 1 Design of primers and probes for multiplex fluorescence quantitative PCR

[0054] The gene sequences of CDS (U00735) of bovine coronavirus N gene and CDS (OP137030) of bovine respiratory syncytial virus N gene were retrieved from NCBI for primer and probe design. The designed primers and probes were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.

[0055] The primer probes for detecting bovine coronavirus are as follows:

[0056] Upstream primer BCoV-F: CTAGTAACCAGGCTGATGTC (SEQ ID NO. 1);

[0057] Downstream primer BCoV-R: ACCTAGTCGGAATAGCCT (SEQ ID NO. 2);

[0058] Probe BCoV-P:

[0059] 5'FAM-CCGGCTGACATTCTCGATCGGGACCCAA-3'BHQ1 (SEQ ID NO.3);

[0060] The primer probe for detecting BRS virus is as follows:

[0061] Upstream primer BRSV-F: TCTTTGCAGGGTTATTCATG (SEQ ID NO. 4);

[0062] Downstream primer BRSV-R: CTGGCATGACCAAGCATAAT (SEQ ID NO. 5);

[0063] Probe BRSV-P: 5'HEX-TGCATATGGAGCAGGTCAAGTGATGT-3'BHQ1 (SEQ ID NO. 6).

[0064] Bovine coronavirus qPCR amplification sequence, amplification length is 81bp, as shown in SEQ ID NO.7:

[0065] CTAGTAACCAGGCTGATGTCAATACCCCGGCTGACATTCTCGATCGGGACCCAAGTTGCGATGAGGCTATTCCGACTAGGT (SEQ ID NO. 7).

[0066] Bovine respiratory syncytial virus qPCR amplification sequence, the amplification length is 103bp, as shown in SEQ ID NO.8:

[0067] TCTTTGCAGGGTTATTCATGAATGCATATGGAGCAGGTCAAGTGAT GTTAAGATGGGGTGTGCTAGCAAAATCAGTCAAGAACATTATGCTTGG TCATGCCAG (SEQ ID NO. 8).

[0068] Example 2 Preparation of Standards

[0069] 1. Stool Sample Pretreatment

[0070] Place the cotton swab used to collect the fecal sample into a 1.5 mL centrifuge tube, add PBS buffer, and vortex to fully suspend the feces.

[0071] 2. Sample Nucleic Acid Extraction

[0072] The pretreated samples were transferred to a suitable centrifuge tube, and an appropriate amount of lysis buffer (Nanjing Novozyme Biotechnology Co., Ltd., catalog number: R701-02) was added, and the nucleic acids were released according to the subsequent instructions.

[0073] 3. Reverse Transcription

[0074] The Servicebio (G3337-50) reverse transcriptase system was used to reverse transcribe the RNA extracted from each sample according to the instructions to obtain cDNA.

[0075] Reverse transcription system and process: 20 μL reaction system (Servicebio, 5xSweScript All-in-One SuperMixfor fluorescent quantitative PCR 4 μL, gDNA Remover 1 μL, RNA 0.1 ng-5 μg, Nuclease-Free Water to 20 μL), after mixing evenly, set the reverse transcription program as follows: 25°C 5 min, 42°C, 25 min, 85°C 5 s, and the above reactions have no cycles.

[0076] 4. Construction of standard plasmid

[0077] Bovine coronavirus common PCR primer pair:

[0078] F:GAGCGTCCTTTGGAAATCGT (SEQ ID NO.9);

[0079] R:GCTTAGTTACTTGCTGTGGC(SEQ ID NO.10);

[0080] Bovine syncytial virus common PCR primer pair:

[0081] F: CTCAATAAGTTGTGTGGTATGC (SEQ ID NO. 11);

[0082] R:AACCAGCTTCTCCACCTAAC (SEQ ID NO. 12);

[0083] Using the designed common PCR primers, the target gene fragment was amplified from the template DNA by polymerase chain reaction. The common PCR amplification fragment of bovine coronavirus is 730bp ( Figure 1 ), the common PCR amplification fragment of bovine syncytial virus is 769bp ( Figure 2 ). The cut target band was recovered by gel recovery according to the instructions of the gel recovery kit (Nanjing Novozyme Biotechnology Co., Ltd.), and the recovered target fragment was connected to the pMD-19T (purchased from Takara official website) vector to prepare the plasmid, and the plasmid was transformed into competent Escherichia coli DH5α, and the single colony with successful transfection was selected and screened. The colony was picked and shaken for PCR identification of the bacterial solution. The plasmid was extracted according to the instructions of the plasmid extraction kit (Tiangen Biochemical Technology Co., Ltd.) to extract the plasmid of the positive bacterial solution. The plasmid was sequenced and aligned, and it can be used after verification.

[0084] The circular plasmid was digested, the linear plasmid concentration was determined, and the initial plasmid copy number was calculated and used as the standard. The concentration of the bovine coronavirus plasmid obtained was 1.99×10 9 copies / μL, and the concentration of bovine syncytial virus plasmid was 1.90×10 9 copies / μL.

[0085] Example 3 Determination of the optimal concentration of primers and probes by single-plex fluorescence quantitative PCR and establishment of a standard curve

[0086] By gradient 1×10 1 ~1×10 8The diluted linear plasmid was used as a template, and 2 μL of the plasmid of each concentration gradient was taken as a template for single fluorescence quantitative PCR. The fluorescence quantitative PCR reaction was carried out on a LightCycler 96 quantitative PCR amplification instrument (Roche, Switzerland). The fluorescence quantitative PCR reaction system was 20 μL (purchased from Takara's RR390A): Premix Ex Taq (Probe fluorescence quantitative PCR) 10 μL, 0.4 μL of each upstream and downstream primers of the fluorescence quantitative PCR for detecting bovine coronavirus, 0.2 μL of the probe, 7 μL of sterile enzyme-free water, and 2 μL of the template; Premix Ex Taq (Probe fluorescence quantitative PCR) 10 μL, 0.4 μL of each upstream primer BRSV-F and downstream primer BRSV-R of the bovine syncytial virus fluorescence quantitative PCR, 0.4 μL of the probe, 7 μL of sterile enzyme-free water, and 2 μL of the template. The single-plex fluorescence quantitative PCR reaction program is: 95°C for 30s; 95°C for 5s, 60°C for 30s, 45 cycles; 50°C for 30s.

[0087] The single-plex fluorescence quantitative PCR experiment for detecting bovine coronavirus (BCoV) was divided into 4 groups, and the concentrations of primers and probes were: 0.2μM, 0.2μM; 0.2μM, 0.15μM; 0.2μM, 0.1μM; 0.15μM, 0.15μM;

[0088] Amplification was performed with the above-mentioned primers and probes at different concentrations to obtain different amplification curves, and a standard curve was drawn. The amplification curves of primers and probes at different concentrations are shown in FIG. Figure 3 , Figure 5 , Figure 7 , Fig. 9 The standard curve is shown in Figure 4 , Figure 6 , Figure 8 , Fig.10 The criteria for determining the optimal concentration amplification curve and standard curve data of bovine coronavirus (BCoV) are mainly based on the standard curve R 2 Is it closest to 1?

[0089] The results showed that when the final concentration of the bovine coronavirus primer was 0.2 μM and the final concentration of the probe was 0.1 μM, the accuracy was the highest. 2 is 0.9844; considering the sensitivity, 10 is discarded 1 Cq value, keep 10 8 -10 2 The standard curve was constructed using the Cq value. Fig.11 As shown, the R of the bovine coronavirus standard curve 2 It is 0.9982.

[0090] The standard plasmid of bovine respiratory syncytial virus (BRSV) was amplified in the same way. The amplification curves of primers and probes with different concentrations are shown in Figure 2. Fig.12 , Fig.14 , Fig.16 , Fig.18 The standard curve is shown in Fig.13 , Fig.15 , Fig.17 , Fig.19 As shown in the figure, the criterion for determining the optimal concentration amplification curve and standard curve data of bovine syncytial virus (BRSV) is mainly whether the standard curve R2 is closest to 1. The results showed that when the final concentration of the bovine syncytial virus primer was 0.2μM and the final concentration of the probe was 0.2μM, the accuracy was the highest, and the single fluorescence quantitative R 2 is 0.9855. Considering the sensitivity, 10 1 Cq value, keep 10 8 -10 2 The standard curve was constructed using the Cq value. Fig. 20 As shown, single fluorescence quantitative R 2 It is 0.9948.

[0091] Example 4 Determination of the optimal annealing temperature of BCoV and BRSV by multiplex fluorescence quantitative PCR

[0092] Optimize the temperature based on the optimal concentration determined above, and optimize from the annealing temperature. Because the annealing temperatures of the primers designed for the two viruses are different, it is necessary to adjust to a temperature that is suitable for both viruses. This is the key to successful detection.

[0093] The optimal primer and probe concentrations of BCoV and BRSV determined in Example 3 were used for multiplex fluorescence quantitative PCR. The reaction system was: 10 μL of 2×All-Powerful fluorescence quantitative PCR PreMix, 0.4 μL of upstream primer BCoV-F, downstream primer BCoV-R, upstream primer BRSV-F, and downstream primer BRS VR, 0.2 μL of probes BCoV-P and BRSV-P, 5.8 μL of ddH2O, 2 μL of genomic DNA of the virus to be tested (the linear plasmids of BCoV and BRSV were mixed in equal volumes and then serially diluted 1×10 1 ~1×10 8 fold, 8 gradients of mixed plasmids were obtained), 37℃ (contamination digestion) 2min; the reaction program was: 95℃ (pre-denaturation) 30s; 95℃ (extension) 10s, annealing 30s, 45 cycles. Now the optimal annealing temperature is tested. The experiment is divided into three groups, with annealing temperatures of 57℃, 58℃, and 60℃ respectively. The amplification curve and standard curve are shown in Figures 21 to 26 From the above data, it can be seen that when the annealing temperature is 58℃, the dual fluorescence quantitative bovine coronavirus R2 is 0.9948; bovine syncytial virus R 2 It is 0.9974, which is the optimal annealing temperature.

[0094] Example 5 Sensitivity Experiment

[0095] The two linear plasmids prepared in Example 2 were mixed in equal volumes and then heated to 10 1 -10 8 The diluted linear plasmid was used as a template, and 2 μL of each concentration gradient was taken as a template for dual fluorescent quantitative PCR. The fluorescence quantitative PCR reaction was carried out on a LightCycler 96 quantitative PCR amplifier (Roche, Switzerland). The fluorescence quantitative PCR reaction system (20 μL, purchased from the official website of Novezan, item number: QN222-01): 2×All-Powerful fluorescence quantitative PCR PreMix 10 μL, bovine coronavirus fluorescence quantitative PCR upstream and downstream primers 0.4 μL each, probe 0.2 μL, bovine syncytial virus fluorescence quantitative PCR upstream and downstream primers 0.4 μL each, probe 0.4 μL, sterile enzyme-free water 5.8 μL, template 2 μL. The dual fluorescent quantitative PCR reaction procedure is: 37°C (contamination digestion) 2 min; 95°C (pre-denaturation) 30 s; 95°C (extension) 10 s, 58°C (annealing) 30 s, 45 cycles, the results are as follows Figures 27-30 shown.

[0096] The results show that the minimum detection template is 1×10 2 copies / μL, when the annealing temperature was 58℃, dual fluorescence quantitative bovine coronavirus R 2 is 0.9948; bovine syncytial virus R 2 is 0.9974.

[0097] Example 6 Specificity Experiment

[0098] Extract RNA from four bovine respiratory disease viruses, including bovine coronavirus, bovine respiratory syncytial virus, bovine parainfluenza virus type III, and bovine adenovirus type III, and then reverse transcribe them into cDNA using a reverse transcription kit. The extracted products were diluted to 1×10 7 As a template, TaqMan probe fluorescence quantitative PCR reaction amplification was performed, and the results are shown in Fig.31 In the figure, only the reaction system containing samples, probes and primers of BCoV and BRSV can show good amplification curves, while other samples do not show amplification curves, indicating that the established multiplex fluorescence quantitative PCR detection method has good specificity.

[0099] As can be seen from the above examples, the present invention provides primers, probe combinations, multiplex fluorescence quantitative PCR kits and detection methods for detecting susceptible viruses of cattle. The multiplex fluorescence quantitative PCR detection method of the present invention can simultaneously identify whether the sample is infected with the two viruses, bovine coronavirus and bovine respiratory syncytial virus, and has the characteristics of high sensitivity and strong specificity, which is of great significance for the prevention of bovine epidemic viruses.

[0100] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer-probe combination for detecting cattle susceptible viruses, wherein the cattle susceptible viruses include bovine coronavirus and bovine respiratory syncytial virus, characterized in that: The primer-probe combination is as follows: The primer probe for detecting bovine coronavirus includes an upstream primer BCoV-F, a downstream primer BCoV-R and a probe BCoV-P: the nucleotide sequence of the upstream primer BCoV-F is shown in SEQ ID NO.1, the nucleotide sequence of the downstream primer BCoV-R is shown in SEQ ID NO.2, and the nucleotide sequence of the probe BCoV-P is shown in SEQ ID NO.3; The primer probe for detecting bovine respiratory syncytial virus includes an upstream primer BRSV-F, a downstream primer BRSV-R and a probe BRSV-P: the nucleotide sequence of the upstream primer BRSV-F is shown in SEQ ID NO.4, the nucleotide sequence of the downstream primer BRSV-R is shown in SEQ ID NO.5, and the nucleotide sequence of the probe BRSV-P is shown in SEQ ID NO.

6.

2. The primer-probe combination according to claim 1, characterized in that: The 5' end of the probe BCoV-P is connected to the FAM fluorescent group, and the 3' end is connected to the BHQ-1 quenching group; the 5' end of the probe BCoV-P is connected to the HEX fluorescent group, and the 3' end is connected to the BHQ-1 quenching group.

3. Use of the primer-probe combination according to claim 1 or 2 in at least one or more of the following: (1) Detecting whether the virus to be tested is bovine coronavirus or bovine respiratory syncytial virus; (2) preparing a kit for detecting whether the virus to be tested is bovine coronavirus or bovine respiratory syncytial virus; (3) Detecting whether the sample to be tested contains bovine coronavirus and / or bovine respiratory syncytial virus; (4) preparing a kit for detecting whether a sample to be tested contains bovine coronavirus and / or bovine respiratory syncytial virus; The application is for non-disease diagnosis purposes.

4. A kit comprising the primer-probe combination according to claim 1 or 2.

5. A multiplex fluorescence quantitative PCR method for simultaneously detecting bovine coronavirus and bovine respiratory syncytial virus, characterized in that: Using the genomic DNA of the virus in the sample to be tested as a template, amplification is performed using the primer probe combination of claim 1. If the primer probe combination I shows positive amplification, the sample to be tested contains bovine coronavirus; if the primer probe combination II shows positive amplification, the sample to be tested contains bovine respiratory syncytial virus; The multiplex fluorescence quantitative PCR method is for non-disease diagnosis purposes.

6. The multiplex fluorescence quantitative PCR method according to claim 5, characterized in that: The reaction system of multiplex fluorescence quantitative PCR was: 2×All-Powerful fluorescence quantitative PCRPreMix 10 μL, upstream primer BCoV-F, downstream primer BCoV-R, upstream primer BRSV-F, downstream primer BRSV-R 0.4 μL each, probe BCoV-P 0.2 μL, BRSV-P 0.4 μL, ddH2O 5.8 μL, and genomic DNA of the virus to be tested 2 μL.

7. The multiplex fluorescence quantitative PCR method according to claim 5, characterized in that: The reaction program of multiplex fluorescence quantitative PCR was as follows: 37°C for 2 min; 95°C for 30 s; 95°C for 10 s, 58°C for 30 s, for 45 cycles.

Images