Nanoparticle of dual-plasmid system loaded with targeted JAK1 gene, soluble microneedle and application of nanoparticle and soluble microneedle

Abstract

The invention discloses a nanoparticle of a dual-plasmid system loaded with a targeted JAK1 gene, a soluble microneedle and application of the nanoparticle and the soluble microneedle, and belongs to the technical field of biomedical materials. The plasmid DNA is obtained by respectively transforming a first plasmid containing CasRx and a second plasmid containing the CasRx and sgRNA of a targeted JAK1 gene into a host cell, propagating, extracting the plasmid DNA and mixing according to the mass ratio of (2-5): 1. Then, the nano-particles are used as active ingredients to prepare soluble microneedles, and the nano-particles and the soluble microneedles have good application prospects in the aspect of preparing products for treating atopic dermatitis.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedical materials, and in particular to a nanoparticle loaded with a double-plasmid system targeting a JAK1 gene, a soluble microneedle and applications thereof. Background Art

[0002] Atopic dermatitis (AD) is a chronic, relapsing skin disease with clinical manifestations of skin lesions and allergies. AD is mainly caused by genetic, immune and environmental factors, which lead to impaired skin barrier function, dysregulation of inflammatory mediators, and symptoms such as itching, swelling, and rash. Frequent itching and scratching in AD patients can lead to sleep disorders, which seriously affect the quality of life of patients. Current treatment strategies for AD include emollients to repair the skin barrier, topical calcineurin inhibitors or corticosteroid anti-inflammatory treatments, phototherapy, systemic immunosuppressants, and biological therapies. However, these methods have limitations in efficacy, side effects, patient compliance, and safety.

[0003] Gene therapy is one of the emerging technologies in the modern medical system. CRISPR technology can perform precise and efficient operations on the genome and has been applied to basic research, gene therapy, agriculture and other fields. CasRx is an RNA-targeted gene editing tool in the CRISPR / Cas system family. Compared with RNA interference methods, CasRx-mediated knockdown shows good efficiency and specificity in a variety of endogenous transcripts.

[0004] However, it is still a great challenge to effectively deliver genome editing systems to target cells. There are three delivery methods for CRISPR / Cas gene editing systems: physical methods, viral vectors, and non-viral vectors. Various physical methods such as electroporation, hydrodynamic injection, and microinjection have been successfully applied to the delivery of CRISPR / Cas9, but these methods are difficult to maintain cell function and practical application. Viral vectors such as adenovirus (AV), adeno-associated virus (AAV), and lentivirus (LV) have been widely explored for efficient delivery of CRISPR / Cas9 systems in vitro and in vivo, but their safety and loading capacity are difficult to meet clinical needs. Non-viral vectors include lipids, polymer materials, gold nanoparticles, graphene oxide, metal organic frameworks, cell penetrating peptides, black phosphorus nanosheets, DNA nanostructures, etc. When these non-viral vectors are used in CRISPR / Cas gene editing systems, their biosafety, loading capacity, and modified targeting ability have great potential compared with physical methods and viral vectors, and can promote the development and application of CRISPR / Cas gene editing systems.

[0005] A Chinese patent document with publication number CN114984248A discloses a dual-responsive core-shell dendrimer that wraps nanogold particles for delivering the CRISPR / Cas system. The carrier for delivering the CRISPR / Cas system in this invention is a core-shell structure material, which has a fifth-generation polyamide-amine dendrimer modified with lactobionic acid and wrapping nanogold particles as the core, and a third-generation polyamide-amine dendrimer modified with tetrabromomethylphenylboronic acid as the shell.

[0006] There are many problems with systemic gene therapy, such as the first-pass effect of oral administration, enzymatic degradation after intravenous injection reaches the blood circulation, and poor specificity of systemic administration. Transdermal gene therapy can effectively avoid these defects. As the largest organ in the human body, the skin has a large number of lymphocytes, keratinocytes, dendritic cells and T cells, and is a suitable site for gene therapy. However, as the first line of defense of the human body, the skin also has limitations in the absorption of biomacromolecules and the effective delivery of nucleic acid drugs. Studies have shown that even for severely damaged skin, it is difficult for local administration of nanoparticles to penetrate the stratum corneum of the skin. Microneedle transdermal drug delivery can make up for the shortcomings of traditional transdermal drug delivery. Microneedle drug delivery can penetrate the stratum corneum of the skin without stimulating pain receptors, thereby safely and painlessly increasing the permeability of the drug and promoting the absorption of the drug by the target tissue. In addition, microneedle transdermal drug delivery can be applied to a variety of drugs, such as nucleic acids, proteins and small molecule compounds, which is easy to apply and has good patient compliance.

[0007] Janus kinase (JAK) / signal transducer and activation of transcription (STAT) signaling is an important signal transduction regulator of growth factors and inflammatory factors. JAK / STAT signaling is activated in the lesional skin of patients with atopic dermatitis, and participates in the release of Th2 cytokines and promotes keratinocyte dysfunction by downregulating skin barrier-related proteins. Therefore, controlling the JAK / STAT signaling pathway can become a major target for the treatment of atopic dermatitis. JAK1 is a signal transduction molecule associated with multiple cytokine receptors, participates in multiple signaling pathways, and activates STATs. Different cytokines of the JAK1 signaling system may play a role in skin barrier maintenance.

[0008] In recent years, JAK inhibitors have shown great potential in the treatment of atopic dermatitis. The receptors of key cytokines (Th2 and Th22) in atopic dermatitis involve downstream JAK / STAT signaling. JAK inhibitors exert a wide range of immunopharmacological effects, and they are able to block the signal transduction pathways of multiple type I and type II cytokine receptors.

[0009] Therefore, it is necessary to develop a new gene therapy product for atopic dermatitis. Summary of the invention

[0010] The present invention utilizes CRISPR / CasRx technology to provide a nanoparticle loaded with a dual-plasmid system targeting the JAK1 gene. The nanoparticle is uniformly spherical and can be delivered transdermally through microneedles. It can significantly inhibit the expression of the JAK1 gene and improve the symptoms of atopic dermatitis, while overcoming the side effects of commonly used atopic dermatitis treatment drugs such as local itching, skin atrophy, allergies, etc.

[0011] The specific technical solutions adopted are as follows:

[0012] A nanoparticle loaded with a dual-plasmid system targeting a JAK1 gene comprises poly(β-amino ester) and plasmid DNA, wherein the plasmid DNA is obtained by respectively transforming a first plasmid containing CasRx and a second plasmid containing CasRx and sgRNA targeting a JAK1 gene into a host cell, amplifying the cells, extracting the plasmid DNA and mixing them at a mass ratio of 2-5:1.

[0013] Experiments have shown that poly(β-amino ester) is more effective in delivering plasmid DNA than the commonly used cationic polymer linear polyethyleneimine (PEI).

[0014] Specifically, a dual-plasmid system targeting the JAK1 gene was used to knock down JAK1 gene expression (silencing at the mRNA level).

[0015] Preferably, the mass ratio of poly(β-amino ester) to plasmid DNA is 20-30:1, further 20:1; the plasmid DNA of the first plasmid containing CasRx and the second plasmid containing CasRx and sgRNA targeting the JAK1 gene are mixed at a mass ratio of 3:1.

[0016] Optionally, the nucleotide sequence of the sgRNA is selected from any one of the following four groups of primers;

[0017] (1)SGJAK1-1-F: AAACGCCTCATTTTAGCACAGAACGCCAT; SGJAK1-1-R: AAAAATGGCGTTCTGTGCTAAAATGAGGC;

[0018] (2)SGJAK1-2-F: AAACGAACAGATAGAAAGTCACCTCCACT; SGJAK1-2-R: AAAAAGTGGAGGTGACTTTCTATCTGTTC;

[0019] (3)SGJAK1-3-F: AAACGTTAAACATTCCGGAGCGTACCAGT; SGJAK1-3-R: AAAAACTGGTACGCTCCGGAATGTTTAAC;

[0020] (4) SGJAK1-4-F: AAACGAGACTTTTCAAAGCAGGTGACAGT; SGJAK1-4-R: AAAAACTGTCACCTGCTTTGAAAAGTCTC.

[0021] Most preferably, the nucleotide sequence of the sgRNA is: (2) SGJAK1-2-F: AAACGAACAGATAGAAAGTCACCTCCACT; SGJAK1-2-R: AAAAAGTGGAGGTGACTTTCTATCTGTTC. Experiments have shown that this sgRNA has a better effect of knocking down the expression of the JAK1 gene.

[0022] The present invention also provides a soluble microneedle, comprising nanoparticles loaded with the dual-plasmid system targeting the JAK1 gene.

[0023] Furthermore, the needle tip portion of the soluble microneedle includes a hydrophilic polymer and nanoparticles loaded with the dual-plasmid system targeting the JAK1 gene, and the backing portion includes a high molecular polymer.

[0024] Preferably, the preparation method of the soluble microneedle is: using a hyaluronic acid solution containing nanoparticles loaded with the dual-plasmid system targeting the JAK1 gene as a needle tip matrix, adding it to the microneedle part of the microneedle mold, vacuum drying, and then adding the hyaluronic acid solution to the base part of the microneedle mold, drying, to obtain the soluble microneedle.

[0025] More preferably, the concentration of the hyaluronic acid solution is 50-100 mg / mL, further 80 mg / mL.

[0026] The present invention also provides the use of the nanoparticles loaded with the dual-plasmid system targeting the JAK1 gene or the soluble microneedles in the preparation of atopic dermatitis therapeutic drugs.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] In the prior art, therapeutic drugs for atopic dermatitis mainly include the following categories: topical steroids (hydrocortisone, fluclothiazol propionate, beclomethasone, etc.), topical immunomodulators (tacrolimus, pimecrolimus), antihistamines (loratadine, cyproheptadine, etc.), systemic steroids (prednisone for severe cases), and biological agents (Dupilumab). However, the above-mentioned therapeutic drugs all have certain side effects, and the safety of long-term use needs to be improved. Phototherapy can also be used to treat atopic dermatitis, but it may cause skin burns, photosensitivity, etc. The present invention adopts the gene editing method (CRISPR / CasRx) targeting the JAK1 gene for the first time to prepare nanoparticles loaded with a dual-plasmid system targeting the JAK1 gene, and uses microneedle delivery technology for administration, which effectively improves the symptoms of atopic dermatitis in a short period of time and overcomes the side effects of current clinical chemical drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Figure 1 is the characterization result of PBAE / DNANPs, where a is the particle size and potential statistics of PBAE / DNANPs with different mass ratios, and b is the gel electrophoresis analysis result of PBAE / DNANPs with different mass ratios.

[0030] Figure 2 Particle size distribution and TEM images of PBAE / DNA NPs prepared when the mass ratio of PBAE to plasmid DNA was 20:1, scale bar = 500 nm.

[0031] Figure 3 The effects of PBAE / DNA NPs with different mass ratios on cell activity, where a is NIH / 3T3 cells and b is DC2.4 cells.

[0032] Figure 4 Figure 3 is a graph of the gene editing efficiency of PBAE / DNA NPs, where a is the statistical result of the JAK1 mRNA level in NIH / 3T3 cells after transfection, b is the statistical result of the JAK1 mRNA level in DC2.4 cells after transfection, and c is the JAK1 protein level after knocking down JAK1 using CRISPR-CasRx in animals.

[0033] Figure 5 The characterization and effect diagram of the soluble microneedle patch, where a is loaded with PBAE / DNA NPs (DiYO TM a is the confocal microscopy image of the microneedle with -1 staining, green), scale bar = 200 μm; b is the release effect of the plasmid system loaded in the microneedle on the mouse skin, scale bar = 200 μm; c is the back photos of mice in different treatment groups on days 0 and 35.

[0034] In the figures, the bar graph data are expressed as mean±standard deviation (n=3), *p<0.05, **p<0.01, ****p<0.0001. DETAILED DESCRIPTION

[0035] The present invention will be further described below in conjunction with the examples and accompanying drawings. It should be understood that these examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The operating methods of the following examples that do not specify specific conditions are usually performed under normal conditions or under conditions recommended by the manufacturer. The content that is not described in detail in this specification sheet belongs to the prior art known to professionals in the field. The experimental materials used in the following examples, if not otherwise specified, can be purchased by conventional biochemical reagent companies.

[0036] Example 1

[0037] Search for JAK1 CasRx-gRNA at https: / / cas13design.nygenome.org / and select the four with the best model-predicted effects as sgRNAs. The nucleotide sequences of sgRNAs are shown in Table 1;

[0038] Table 1 Nucleotide sequences of sgRNA

[0039]

[0040] The pBS-CAG-CasRx-P2A-GFP-pA and pMD-20-CasRx-U6-gRNA backbone A+ double plasmid system was used. Both contain CasRx, which can ensure effective cutting; the above-designed sgRNA was used, and after PCR amplification, the sgRNA was connected to the plasmid pMD-20-Casrx-U6-gRNA backbone A+ by enzyme cutting at the BpiI site. The first plasmid containing CasRx and the second plasmid containing CasRx and sgRNA targeting the JAK1 gene were transformed into host cells, propagated, and the plasmid DNA was extracted and mixed at a mass ratio of 3:1 (m / m) for use.

[0041] Dissolve poly (β-amino ester) PBAE in sodium acetate buffer, add it to the plasmid DNA solution extracted in the above step, control the mass ratio of PBAE and plasmid DNA to be 1:1, 5:1, 10:1, 15:1, 20:1, 30:1, 50:1, 100:1, 500:1, respectively, mix well with a pipette, and let stand at room temperature for 30 minutes to obtain PBAE / DNA NPs.

[0042] The average particle size, potential and polydispersity coefficient of PBAE / DNA NPs were determined by DLS. Figure 1 As shown in a, when the mass ratio of PBAE to plasmid DNA is less than 15, the nanoparticles are negatively charged and the average particle size is greater than 700nm. When the mass ratio of PBAE to plasmid DNA is between 20 and 500, the nanoparticles are positively charged and the average particle size is around 500nm. Nanoparticles with mass ratios of PBAE to plasmid DNA of 1:1, 5:1, 10:1, 15:1, 20:1, and 30:1 were selected for gel electrophoresis experiments. The results are shown in Figure 1 As shown in b, when the mass ratio of PBAE to plasmid DNA is 20:1, the complexing effect of PBAE and plasmid DNA is good. The PBAE / DNA NPs prepared at this concentration are observed under a cryo-transmission electron microscope and show uniform spherical particles ( Figure 2 ).

[0043] Furthermore, the mass of the fixed plasmid DNA was 100 ng, and nanoparticles PBAE / DNA NPs with mass ratios of PBAE to plasmid DNA of 5:1, 15:1, 20:1, 30:1, 50:1, and 100:1 were prepared according to the above method. Mouse embryonic fibroblasts NIH / 3T3 and mouse dendritic cells DC2.4 were treated with the prepared PBAE / DNANPs. The results were as follows: Figure 3 As shown in a and b, when the mass ratio of PBAE to plasmid DNA is ≤30, PBAE / DNA NPs have no significant effect on the activity of NIH / 3T3 and DC2.4 cells, demonstrating its excellent biocompatibility.

[0044] Example 2

[0045] According to the method in Example 1, the mass of the fixed plasmid DNA was 10 μg, and the mass ratio of PBAE to plasmid DNA was 20:1 to prepare nanoparticles PBAE / DNA NPs; the double plasmid system with different sgRNAs targeting the JAK1 gene was transfected into mouse embryonic fibroblasts NIH / 3T3 and mouse dendritic cells DC2.4, and RNA was extracted from the transfected cells and the JAK1 mRNA content was determined by fluorescent quantitative PCR;

[0046] The steps of the fluorescent quantitative PCR method are to query the primer sequence of JAK1 in PrimerBank (harvard.edu). RNA of cells and animal skin tissues was extracted by TRIZOL method, and RNA was reverse transcribed into cDNA according to the instructions of HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper). Premix Ex Taq TMII (Tli RNaseH Plus) for real-time fluorescence quantitative PCR. The primer sequences are shown in Table 2:

[0047] Table 2 Primer sequences (SEQ ID NO.9-SEQ ID NO.10)

[0048]

[0049]

[0050] The results are as follows Figure 4 As shown in a and b, sgJAK1-2 (SGJAK1-2-F and SGJAK1-2-R) had the best knockdown efficiency.

[0051] In order to verify the gene knockdown effect in vivo, PBAE / DNA NPs (sgJAK1-2) were injected subcutaneously on the back of mice. Figure 4 As shown in c, protein electrophoresis bands and quantitative analysis showed that PBAE / DNA NPs could significantly reduce the expression of JAK1 protein in the back skin of mice.

[0052] Example 3

[0053] The preparation process of soluble microneedles is as follows: clean the microneedle mold and put it in an oven to dry for use; weigh 0.8g of hyaluronic acid HA and add it to a centrifuge tube filled with 10mL of pure water, stir it and put it in a 50℃ water bath, heat and dissolve it for 10 minutes to obtain a uniform hyaluronic acid solution, which is used as the base layer solution. The hyaluronic acid solution is dripped onto the base of the microneedle mold to make it dome-shaped to avoid a concave shape after drying. Put it in a desiccator filled with color-changing silica gel and dry it overnight at room temperature.

[0054] An HA solution (the concentration of the HA solution is 80 mg / mL) containing PBAE / DNA NPs (loaded with sgJAK1-2, the mass ratio of PBAE to plasmid DNA is 20:1) is added to the needle tip of the microneedle mold, and the excess solution is removed to form a hydrogel, which is deposited into the needle hole and then dried under vacuum for 15 minutes. The gap is then filled with 80 mg / mL HA solution. After complete drying, the microneedle patch is separated from the mold to prepare a soluble microneedle.

[0055] In order to visualize the drug loading effect of the soluble microneedles, PBAE / DNA NPs were coated with DiYO TM -1 staining. Figure 5 Image a in the figure shows that the green fluorescence of the microneedle is evenly distributed inside the microneedle, indicating that the soluble microneedle has successfully loaded the nanoparticle drug.

[0056] The effect of the soluble microneedle was verified by using a BALB / c mouse atopic dermatitis model induced by 1-chloro-2,4-dinitrobenzene DNCB. Male BALB / c mice (6-8 weeks old) were used to establish an atopic dermatitis model after a week of adaptive culture. The back of the mice was shaved and then adaptively cultured for two days. In the first week, 200 μL of 0.5% DNCB was dripped into a limited area of ​​the back skin every 2 days. The solvent was acetone / olive oil. Starting from the second week, 200 μL of 1% DNCB was dripped into a limited area of ​​the back skin twice a week for 4 consecutive weeks. Soluble microneedles were topically applied to each mouse in the PBAE / DNA group twice a week for a total of 5 weeks. A control group (Model) was also set up without soluble microneedle treatment. Normal mice (Control) without any treatment were not stimulated by DNCB.

[0057] After applying the microneedle patch on the back skin of mice, the skin cut from the mice after treatment was prepared into frozen sections and observed under a confocal microscope to obtain the following picture results: Figure 5 As shown in Figure b, the nanoparticle drugs loaded by microneedles can be effectively released into the mouse skin. Figure 5 As shown in c, on the 0th day of the experiment, the mice in each group were in the same condition, with smooth skin and no skin lesions. After 35 days, the skin of the mice in the blank control group was smooth, while the skin of the mice in the model group was severely damaged. The therapeutic effect after treatment with the microneedle patch was significant.

[0058] The embodiments described above provide a detailed description of the technical solutions of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, supplements or similar substitutions made within the scope of the principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A nanoparticle loaded with a dual plasmid system targeting the JAK1 gene, characterized in that: The method comprises poly(β-amino ester) and plasmid DNA. The plasmid DNA is obtained by respectively transforming a first plasmid containing CasRx and a second plasmid containing CasRx and sgRNA targeting the JAK1 gene into host cells, amplifying them, extracting the plasmid DNA and mixing them at a mass ratio of 2-5:

1.

2. The nanoparticle loaded with a dual plasmid system targeting the JAK1 gene according to claim 1, characterized in that: The mass ratio of poly(β-amino ester) to plasmid DNA was 20-30:1; the plasmid DNA of the first plasmid containing CasRx and the second plasmid containing CasRx and sgRNA targeting the JAK1 gene were mixed at a mass ratio of 3:

1.

3. The nanoparticle loaded with a dual plasmid system targeting the JAK1 gene according to claim 1, characterized in that: The nucleotide sequence of the sgRNA is selected from any one of the following four groups; (1)SGJAK1-1-F: AAACGCCTCATTTTAGCACAGAACGCCAT; SGJAK1-1-R: AAAAATGGCGTTCTGTGCTAAAATGAGGC; (2)SGJAK1-2-F: AAACGAACAGATAGAAAGTCACCTCCACT; SGJAK1-2-R: AAAAAGTGGAGGTGACTTTCTATCTGTTC; (3)SGJAK1-3-F: AAACGTTAAACATTCCGGAGCGTACCAGT; SGJAK1-3-R: AAAAACTGGTACGCTCCGGAATGTTTAAC; (4) SGJAK1-4-F: AAACGAGACTTTTCAAAGCAGGTGACAGT; SGJAK1-4-R: AAAAACTGTCACCTGCTTTGAAAAGTCTC.

4. The nanoparticle loaded with a dual plasmid system targeting the JAK1 gene according to claim 1, characterized in that: A two-plasmid system targeting the JAK1 gene was used to knock down JAK1 gene expression.

5. A soluble microneedle, characterized in that: The invention comprises nanoparticles of the double plasmid system loaded with the JAK1 gene targeting system as described in any one of claims 1 to 4.

6. The soluble microneedle according to claim 5, characterized in that: The needle tip part of the soluble microneedle comprises a hydrophilic polymer and nanoparticles loaded with the double plasmid system targeting the JAK1 gene, and the backing part comprises a high molecular polymer.

7. The soluble microneedle according to claim 5, characterized in that: The preparation method of the soluble microneedle is as follows: a hyaluronic acid solution containing nanoparticles loaded with the dual plasmid system targeting the JAK1 gene is used as a needle tip matrix, added to the microneedle part of the microneedle mold, vacuum dried, and then the hyaluronic acid solution is added to the base part of the microneedle mold, dried, and the soluble microneedle is obtained.

8. The soluble microneedle according to claim 7, characterized in that: The concentration of the hyaluronic acid solution is 50-100 mg / mL.

9. Use of the nanoparticles loaded with the dual-plasmid system targeting the JAK1 gene according to any one of claims 1 to 4 and the soluble microneedles according to any one of claims 5 to 8 in the preparation of a drug for treating atopic dermatitis.

Images