Application of reagents for inhibiting NAT10 protein expression in the preparation of drugs for preventing and treating calcific aortic valve disease

Abstract

The present invention belongs to the field of biomedicine and specifically relates to a method for inhibiting the osteogenic differentiation of human aortic valve interstitial cells (hVICs). Specifically, the method involves silencing N-acetyltransferase 10 (NAT10) in vitro and in vivo using biological methods. According to this method, NAT10 was over-silenced in mice using an adeno-associated virus, and it was found that NAT10 silencing could inhibit mouse aortic valve calcification. NAT10 was also silenced in hVICs using an adenovirus, and it was found that NAT10 silencing could inhibit the osteogenic differentiation of hVICs, thereby delaying or inhibiting valve calcification. Furthermore, a method for preventing and treating aortic valve calcification by inhibiting NAT10 protein expression is proposed, providing a new non-surgical treatment option for the prevention and treatment of calcific aortic valve disease.

Description

Technical field:

[0001] The present invention relates to the field of biomedicine, and in particular to the use of a reagent for inhibiting NAT10 protein expression in the preparation of a drug for preventing and treating calcific aortic valve disease. Background technology:

[0002] Calcific aortic valve disease (CAVD) is a progressive disease of the elderly with high morbidity and mortality. Its primary pathophysiological changes are fibrous proliferation and calcification of the aortic valve leaflets. Numerous basic research studies in recent years have demonstrated that, in addition to age-related degenerative factors, CAVD is a complex pathological process mediated by endothelial injury, inflammatory cell infiltration, extracellular matrix remodeling, and osteoblastic differentiation of valvular interstitial cells. Valvular endothelial cells (VECs) and valvular interstitial cells (VICs) are cell types found in valvular tissue. Studies have demonstrated that osteoblastic differentiation of VICs is a key initiator of valvular calcification. Currently, there is a lack of effective clinically available medical treatments for CAVD, and surgery remains the mainstay of treatment. However, surgery carries a high economic burden and serious complications such as postoperative bleeding and bioprosthetic valve failure. Therefore, exploring the specific pathogenesis of CAVD and using non-surgical methods to effectively prevent and / or treat calcific aortic valve disease are urgent needs in the current clinical treatment of CAVD.

[0003] N-acetyltransferase 10 (NAT10) is an enzyme with acetyltransferase and RNA binding activities. It can catalyze the epitranscriptome modification of N4-acetylcytosine (ac4C) on mRNA. It has important biological effects on many cellular events. Current research on this protein mainly focuses on its effects on ribosome biogenesis, bone remodeling, RNA translation efficiency, cell proliferation and epithelial-mesenchymal transition.

[0004] Related studies have found that NAT10 has a positive regulatory effect on the osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs). NAT10 may play an important role in the phenotypic transition of valvular interstitial cells into osteogenic differentiation and aortic valve calcification. Reagents that inhibit NAT10 protein expression have potential clinical value in the preparation of drugs for the prevention or treatment of calcific aortic valve disease. Summary of the invention:

[0005] (1) Technical problems solved

[0006] Against the above background, the present invention discovered through research that inhibiting NAT10 protein expression can effectively downregulate the expression of the osteogenic differentiation marker gene CD36 in human valvular interstitial cells (hVICs), inhibit hVICs osteogenic differentiation, and effectively inhibit aortic valve calcification in mice induced by a high-fat, high-cholesterol diet. The invention proposes the use of a reagent that inhibits NAT10 protein expression in the preparation of drugs for the prevention and treatment of calcific aortic valve disease, thereby providing a new non-surgical treatment option for the prevention and treatment of calcific aortic valve disease.

[0007] (2) Technical solution

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] The present invention provides use of a reagent for inhibiting NAT10 protein expression in the preparation of a medicament for preventing and treating calcific aortic valve disease.

[0010] Furthermore, the reagent for inhibiting NAT10 protein expression includes any one of the following:

[0011] A recombinant vector containing a short hairpin RNA (shNAT10) that inhibits the expression of a gene encoding NAT10 protein;

[0012] A recombinant virus containing a short hairpin RNA (shNAT10) that inhibits the expression of the gene encoding the NAT10 protein;

[0013] Furthermore, the recombinant virus containing short hairpin RNA (shNAT10) that inhibits the expression of the gene encoding NAT10 protein is a recombinant adenovirus or a recombinant adeno-associated virus containing shNAT10.

[0014] The reagent containing the amount of NAT10 protein that inhibits expression inhibits the mRNA N4-acetylcytosine (ac4C) modification of CD36, a key gene that promotes hVICs osteogenic differentiation, thereby reducing its mRNA stability and protein expression, thereby inhibiting the osteogenic differentiation of valve interstitial cells and delaying valve calcification.

[0015] Furthermore, the reagent for inhibiting the expression of NAT10 protein also includes the NAT10 small molecule inhibitor Remodelin.

[0016] Furthermore, the drug for preventing and treating calcific aortic valve disease is a pharmaceutical composition prepared from an agent that inhibits the expression of NAT10 protein and a conventional pharmaceutical carrier.

[0017] Furthermore, the pharmaceutical composition is a capsule, granule, injection, sustained-release tablet, buccal tablet or powder injection.

[0018] Furthermore, the drug for preventing and treating calcific aortic valve disease is a drug that inhibits the expression level of NAT10 in aortic valve tissue.

[0019] Furthermore, the calcific aortic valve disease is a calcified lesion of the heart valve.

[0020] The present invention also provides a method for preventing and treating aortic valve calcification, which comprises inhibiting the expression level of NAT10 protein in a subject to be treated, so as to prevent and treat aortic valve calcification.

[0021] (3) Beneficial effects

[0022] The beneficial effects of the present invention are as follows: the present invention provides the use of a reagent for inhibiting NAT10 protein expression in the preparation of a drug for preventing and treating calcific aortic valve disease. Through research, it was found that inhibiting NAT10 protein expression can effectively downregulate the mRNA stability and protein expression of the key osteogenic differentiation gene CD36 in valvular interstitial cells, inhibit the osteogenic differentiation of valvular interstitial cells, thereby delaying or inhibiting valve calcification. Furthermore, a reagent for inhibiting NAT10 protein expression and a method for preventing and treating aortic valve calcification by inhibiting the expression level of NAT10 are proposed, providing a new solution for the treatment of calcific aortic valve disease. Description of the drawings:

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments.

[0024] Figure 1 : Quantitative analysis of NAT10 in calcified and normal aortic valve tissues;

[0025] A shows that the expression of NAT10 in calcified aortic valve tissue is significantly increased compared with that in normal aortic valve tissue by real-time fluorescence quantitative PCR; B shows that the expression of NAT10 in normal and calcified aortic valve tissue by Western blot shows that the protein level of NAT10 is significantly increased in calcified aortic valve tissue;

[0026] Figure 2 : Quantitative analysis of NAT10 in osteogenic differentiation of human aortic valve interstitial cells induced by osteogenic induction medium;

[0027] A is a timely fluorescence quantitative PCR showing that compared with the control group, the expression of NAT10 in human valvular interstitial cells induced by osteogenic induction medium for 0 days, 1 day, 3 days, 5 days, 7 days and 14 days was significantly increased in a time-dependent manner; B is a Western blot test showing that compared with the control group, the expression of NAT10 protein level in human valvular interstitial cells induced by osteogenic induction medium for 0 days, 1 day, 3 days, 5 days, 7 days and 14 days was significantly increased in a time-dependent manner;

[0028] Figure 3 :Overexpression of NAT10 promotes phenotypic transformation of human valvular interstitial cells into osteogenic differentiation in vitro.

[0029] A shows that compared with the control group, the calcium salt nodules in the human aortic valve interstitial cells in the NAT10 overexpression group were significantly increased; B shows that the calcium salt deposition in the human aortic valve interstitial cells was significantly increased after NAT10 overexpression;

[0030] Figure 4 :Knockdown of NAT10 inhibits osteogenic differentiation of human aortic valve interstitial cells.

[0031] A shows that compared with the control group, the calcium salt nodules of human aortic valve interstitial cells in the NAT10 knockdown group were significantly reduced; B shows that the calcium quantitative analysis showed that after NAT10 knockdown, the calcium salt deposition of human aortic valve interstitial cells was significantly reduced;

[0032] Figure 5 : Knockdown of NAT10 inhibits the osteogenic differentiation of human aortic valve interstitial cells by suppressing the mRNA stability and expression of CD36, a key pathogenic gene of valve calcification.

[0033] A is the q-RTPCR detection of the changes in CD36 mRNA stability after NAT10 knockdown. The results show that after NAT10 knockdown, the stability of CD36 mRNA is significantly decreased; B is the q-RTPCR detection of the changes in CD36 expression after NAT10 knockdown. The results show that after NAT10 knockdown, CD36 expression is significantly downregulated;

[0034] Figure 6 :In vivo silencing of NAT10 inhibits aortic valve calcification in mice induced by a high-fat, high-cholesterol diet.

[0035] Figure 7 :Remodelin, a small molecule inhibitor of NAT10, inhibits osteogenic differentiation of human aortic valve interstitial cells.

[0036] A shows that compared with the control group, the calcium salt nodules of human aortic valve interstitial cells in the group treated with the NAT10 small molecule inhibitor Remodelin were significantly reduced; B shows that the calcium quantitative analysis showed that the calcium salt deposition of human aortic valve interstitial cells in the group treated with the NAT10 small molecule inhibitor Remodelin was significantly reduced; Specific implementation method:

[0037] The technical solutions in the embodiments of the present invention will be described clearly and completely below with reference to the accompanying drawings in the embodiments of the present invention.

[0038] Example 1. Detection of NAT10 tissue level expression.

[0039] The specific experimental plan is as follows:

[0040] 1. RNA Extraction

[0041] 1) Tissue processing: Approximately 50 mg of aortic valve tissue was collected and ground with liquid nitrogen until satisfactory. 1 ml of Trizol reagent was added and homogenized. After thorough lysis, the tissue was centrifuged at 12,000 rpm and 4°C for 15 minutes, and the supernatant was collected.

[0042] 2) Add 200 μl of chloroform, shake to mix, and let stand at room temperature for 15 minutes.

[0043] 3) Centrifuge at 12,000 rpm at 4°C for 15 minutes. Separate the three layers. Transfer the upper aqueous phase to a new enzyme-free EP tube. Add an equal volume of isopropanol, mix well, and incubate at room temperature for 10 minutes to precipitate the RNA.

[0044] 4) Centrifuge at 12,000 rpm at 4°C for 15 minutes. Carefully remove the supernatant and the RNA precipitate from the bottom of the tube.

[0045] 5) Add 1 ml of 75% ethanol for every 1 ml of Trizol and mix thoroughly by inversion.

[0046] 6) Centrifuge at 8000 g at 4°C for 5 minutes, discard the supernatant, and dry in the sun at room temperature (5-10 minutes).

[0047] 7) Add an appropriate amount of DEPC water to dissolve the RNA and determine the RNA concentration. Perform reverse transcription based on the quantitative results.

[0048] 8) RNA A260 / A280 = 1.8-2.1

[0049] 2. cDNA reverse transcription

[0050] 1) Reverse transcription system of Japan TAKARA kit (10ul):

[0051]

[0052] Reaction conditions: 37°C, 15 minutes of reverse transcription reaction; 85°C, 5 seconds of reverse transcriptase inactivation reaction; 4°C, the reaction is completed, and the product is cDNA.

[0053] 3. QRT-PCR was used to detect the expression of NAT10 in normal and calcified aortic valve tissues, wherein the primer sequences of NAT10 real-time fluorescence quantitative PCR were as shown in SEQ ID NO: 2 (GGATTGCCTCAACATCACTCGG) and SEQ ID NO: 3 (CGTTGGAGGAAAACTTCAGAGGC).

[0054] 1) Experimental system:

[0055]

[0056]

[0057] 2) Reaction conditions:

[0058] 95°C, 2 minutes; 40 cycles (95°C, 10 seconds; 60°C, 60 seconds); 60-95°C melting curve.

[0059] 3) Amplification was performed on the machine. After the reaction was completed, the amplification curve and melting curve were confirmed. The expression intensity of each gene was calculated according to the CT value (threshold cycle values) and the P value was calculated by T test. The sequence of the real-time fluorescence quantitative PCR primer specific for the internal reference housekeeping gene β-actin is as shown in SEQ ID NO: 4

[0060] The primer pair is shown as SEQ ID NO: (CACCATTGGCAATGAGCGGTTC) and SEQ ID NO: 5 (AGGTCTTTGCGGATGTCCACGT).

[0061] 4) Result analysis

[0062] See the results Figure 1 A. NAT10 expression was detected in 32 normal aortic valve tissue samples and 32 calcified aortic valve tissue samples. The results showed that NAT10 was significantly upregulated in calcified aortic valve tissue compared with normal aortic valve tissue.

[0063] 2. Western blot analysis

[0064] SDS-PAGE gel preparation.

[0065] Considering the cumbersome and time-consuming traditional gel preparation process and the biotoxicity of acrylamide, all gels in this study were prepared using the Rapid PAGE preparation kit provided by Shanghai Yazyme Biotechnology Co., Ltd. The gels are premixed, easy to use, and utilize a modified coagulant, eliminating the need for acrylamide. Different concentrations can be selected as needed. The product details are listed in the table below:

[0066]

[0067]

[0068] Gel production process (taking the production of two 1.5mm gels as an example):

[0069] (1) Take 8 mL of the lower gel solution and gel buffer solution and mix thoroughly.

[0070] (2) Add 160uL of improved coagulant and mix thoroughly.

[0071] (3) After thorough mixing, inject into the glass plate for glue making, inject about 7 mL, and keep the liquid surface 0.5 cm away from the inserted comb teeth. Completely cover with anhydrous ethanol and flatten the liquid surface.

[0072] (4) Wait until the lower layer of glue is completely solidified and use filter paper to absorb the anhydrous ethanol.

[0073] (5) Take 2 mL of the upper gel solution and buffer solution, and mix thoroughly.

[0074] (6) Add 40uL of improved coagulant.

[0075] (7) After mixing, inject into the glass plate and insert the comb teeth.

[0076] (8) After the upper layer of gel is completely solidified, remove the comb teeth and prepare for electrophoresis.

[0077] Transfer solution preparation

[0078] This study used Yazyme Bio Omni-Flash TM Ice-bath-free rapid transfer buffer (10×) can replace methanol with anhydrous ethanol, avoiding the use of toxic reagents, generating little heat, and eliminating the need for an ice bath, making it efficient and convenient.

[0079]

[0080] The preparation method is as follows (taking 1000mL of Rapid Transfer Buffer 1× as an example):

[0081] Transfer conditions: 4% to 20% gradient gel, 1.5mm thickness, molecular weight 10-250kDa, constant current 400mA, transfer is completed in 30 minutes. For standard SDS-PAGE gels, the transfer time depends on the gel concentration. A 10% gel with a constant current of 400mA is commonly used, and proteins with a molecular weight below 150kDa can be transferred in 30 minutes. For proteins with a molecular weight greater than 150kDa, the transfer time needs to be extended by approximately 5-10 minutes.

[0082] The blocking solution is prepared as shown in the following table (5% skim milk powder)

[0083] Component name content skimmed milk powder 5g TBST 100mL

[0084] TBST preparation

[0085] The preparation ratio is: 1000mL Tris-HCl balanced salt buffer + 1mL Tween 20

[0086] Protein sample preparation

[0087] (1) Wash the cell samples in the 6-well plate with pre-cooled PBS three times, 5 minutes each time.

[0088] (2) Add 100uL of pre-cooled RIPA lysis buffer to each well, let it stand on ice for 10 minutes, and collect the cell lysate into a new EP tube.

[0089] (3) Continue to process the cell sample using an ultrasonic cell disruptor. Ultrasonication conditions are 60 Hz, 30 seconds each time, for a total of 5 times. Keep the ultrasonication process on ice. Let it stand on ice for 20 minutes.

[0090] (4) Centrifuge at 4°C, 12,000 rpm for 15 minutes. Collect the supernatant and determine the protein concentration.

[0091] Protein concentration determination

[0092] The protein concentration was detected by BCA method.

[0093] (1) Prepare BCA working solution: Mix reagent A and reagent B in a ratio of 50:1 to make a working solution, mix well and store at room temperature.

[0094] (2) Preparation of protein standard: Prepare a stock solution of protein standard by adding 0.8 mL of preparation solution to 20 mg of BSA. Dilute the stock solution to 0.5 mg / mL in PBS to prepare the working solution.

[0095] (3) The method of adding samples to 96-well plates is shown in the table below.

[0096]

[0097] (4) Incubate at 37°C for 30 minutes and measure the absorbance (wavelength 562 nm) with an enzyme-labeled instrument.

[0098] (5) Calculate protein concentration using Excel preset equation.

[0099] Protein denaturation

[0100] After protein concentration determination, add sample buffer, mix well, and heat denature at 99°C for 10 minutes. After denaturation, place on ice until ready for use or store at -80°C.

[0101] Protein electrophoresis

[0102] (1) Use the old Beijing Liuyi electrophoresis tank. After preparing the gel as described above, fill the inner tank with electrophoresis solution, remove the comb teeth, and use a micropipette to add 5uL of protein pre-stained marker (Thermo26616) and protein sample (the sample volume is calculated according to the protein concentration) into the swimming lane as needed.

[0103] (2) Perform electrophoresis at a constant voltage of 80 V. After all samples in each lane have reached the separation gel, adjust the voltage to 150 V and adjust the time according to the molecular weight of the target protein.

[0104] Protein transfer

[0105] (1) After electrophoresis, cut out the gel blocks with the molecular weight of the target protein around 20 kDa.

[0106] (2) Soak the activated PVDF membrane in methanol (about 30 seconds), discard the methanol and place it in pre-cooled transfer solution, equilibrate for 10 minutes and then set aside.

[0107] (3) Place the gel and PVDF membrane using the sandwich method.

[0108] (4) Transfer the membrane using the transfer buffer without ice bath, 400 mA, constant current, and adjust the transfer time according to the molecular weight (Note: All transfer buffers in this study can be recycled and used 3 times).

[0109] PVDF membrane immunoblotting

[0110] (1) Blocking. After transfer, block with 5% skim milk at room temperature for 1 hour.

[0111] (2) Primary antibody incubation. After blocking, wash the membrane with TBST. Cut the target band and absorb the TBST with filter paper. Prepare the target protein primary antibody in advance using commercial primary antibody diluent (15ml centrifuge tube, the primary antibody concentration should be diluted according to the manufacturer's instructions, which can be adjusted later based on experimental results). Incubate overnight at 4℃.

[0112] (3) Secondary antibody incubation. The next day, complete the primary antibody incubation and recover the primary antibody. Wash the membrane with TBST three times for 10 minutes each time. Prepare the secondary antibody in TBST at a dilution ratio of 1:5000 or 1:10000 (the specific dilution ratio can be adjusted according to the secondary antibody brand and experimental results). Incubate with the secondary antibody for 1 hour.

[0113] (4) Chemical development. Discard the secondary antibody and wash the membrane with TBST. Use the Bio-Tech ECL Chemiluminescence Kit (Cat. No. P0018S) and mix developer A and developer B in a ratio of 1:1 as the working solution. Place the target band flat on the developer. Add about 100 μL of developer to the membrane until it completely covers the target band. Keep it away from light for 20 seconds. Expose and capture images using the software program.

[0114] (5) Image analysis. Grayscale values ​​were detected using ImageJ1.55. The grayscale value ratio of the target protein and the internal reference protein was analyzed to calculate the expression difference of the target protein between samples.

[0115] Result Analysis

[0116] See the results Figure 1 B. NAT10 expression was detected in 32 normal aortic valve tissue samples and 32 calcified aortic valve tissue samples. The results showed that NAT10 was significantly upregulated in calcified aortic valve tissue compared with normal aortic valve tissue.

[0117] Example 2: Construction of a cell model of osteogenic differentiation of human valvular interstitial cells induced by calcification induction medium.

[0118] 1. Extraction and culture of primary hVICs

[0119] hVICs extraction

[0120] (1) In a clean bench, transfer the aortic valve from sterile saline or high-glucose culture medium to a sterile 10 cm cell culture dish. Add approximately 10 mL of sterile PBS (containing penicillin and streptomycin) and rinse 3 to 5 times with a Pasteur pipette. Use sterile microscissors to separate the valve and cut it into small pieces for later use.

[0121] (2) Dissolve 1 tube of type I collagenase in 50 mL of DMEN high-glucose medium and add the double antibody at the same time. The working solution concentration is 2 mg / mL.

[0122] (3) Take about 10 mL of type I collagenase working solution, mix it with the chopped valve tissue in step (1), transfer it to a 15 mL sterile centrifuge tube, and digest it at 37°C overnight.

[0123] (4) After complete digestion, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and resuspend the pellet in 10% FBS + DMEM. Mix gently and culture in a T25 culture flask at 37°C in a constant temperature incubator.

[0124] hVICs culture

[0125] (1) After primary cells are isolated and inoculated into culture flasks or culture dishes, the medium is changed regularly every 2 to 3 days. When the cell density reaches about 90%, they can be digested and passaged.

[0126] (2) Passage. Add 1 mL of 0.25% trypsin to each T25 culture flask for digestion for about 30 seconds. Discard the trypsin and add 3 mL of DMEM medium containing 10% FBS to each T25 culture flask. Pipet and suspend the adherent cells. Passage at a ratio of 1 to 2 and continue culturing.

[0127] (3) Take cells from passages 2 to 5 for subsequent experiments.

[0128] 2. Method for inducing hVICs osteogenic differentiation:

[0129] After 24 hours of transfection, the cell confluence of each group was observed, and human valvular interstitial cells with a culture density of about 90% were taken and starved overnight with DMEM high-glucose medium containing 2% fetal bovine serum. On the second day, human valvular interstitial cells were induced to differentiate into osteoblasts using a newly prepared osteoinduction medium (50 mg / mL vitamin C, 5 mmol / L β-glycerophosphate, 100 nmol / L dexamethasone, and the solvent was high-glucose DMEM medium containing 2% fetal bovine serum). The medium was changed every three days for 14 days of induction.

[0130] Example 3: Osteogenic induction medium induced the inhibition of NAT10 expression in human valvular interstitial cells.

[0131] In this example, the method of Example 2 was used to induce osteogenic differentiation of human valvular interstitial cells at different time points, namely, day 0, day 1, day 3, day 5, day 7, and day 14. Then, the real-time fluorescence quantitative PCR and western blot methods of Example 1 were used to detect the changes in the mRNA and protein expression levels of NAT10 in the osteogenic differentiation-induced cells at different time points. The results showed that the mRNA ( Figure 2 A) and protein ( Figure 2 B) The expression levels in the osteogenic induction culture group increased significantly in a time-dependent manner.

[0132] Example 4: Overexpression of NAT10 can promote osteogenic differentiation of human valvular interstitial cells, and knockdown of NAT10 can inhibit osteogenic differentiation of human valvular interstitial cells.

[0133] In this example, valvular interstitial cells were isolated and cultured. NAT10-overexpressing adenovirus and NAT10-specific short hairpin RNA (shNAT10) were constructed and transfected into the valvular interstitial cells. The cells were then induced with osteogenic differentiation induction medium for 4 days to establish an in vitro osteogenic differentiation model. The degree of valvular interstitial cell calcification was assessed using Alizarin Red staining and calcium quantification analysis.

[0134] The specific experimental plan is as follows:

[0135] 1. Cell transfection

[0136] In this study, gene silencing was performed using gene-specific short hairpin RNAs (shRNAs). NAT10-specific shRNAs and negative control shRNAs were synthesized by Shanghai Genema Biotechnology Co., Ltd. The shNAT10 sequence is SEQ ID NO: 1: GCAATTGTACACAGTGACTAT. The NAT10 overexpression vector and the control empty vector GV144 were synthesized by Shanghai Genechem Biotechnology Co., Ltd. Lipofectamine 3000 was used as the gene transfection reagent. The transfection steps were as follows:

[0137] (1) Cells were seeded into 6-well plates and transfection was started after the confluence reached 80%.

[0138] (2) Dilute Lipofectamine 3000 (5uL) in 125uL reduced serum culture medium.

[0139] (3) Dilute plasmid DNA (2.5ug) in 125uL reduced serum medium and add 5uL of P3000.

[0140] (4) Mix the reagents obtained in step 2 and step 3 in a 1:1 ratio and incubate at room temperature for 5 minutes.

[0141] (5) Add the mixed reagents in step 4 to the cells and transfect the cells at 37°C. Analyze the transfection results after 72 hours.

[0142] 2. Alizarin red staining

[0143] Primary culture of hVICs

[0144] (1) Take the cells to be stained from a 12-well plate and wash them three times with 1 mL of pre-cooled 1× PBS.

[0145] (2) Add 500uL of 4% paraformaldehyde to each well and fix at room temperature for 20 minutes.

[0146] (3) Wash the paraformaldehyde with 1×PBS for 3 times, 5 minutes each time.

[0147] (4) Add 600uL of Alizarin Red staining solution to each well and stain for 15 to 20 minutes.

[0148] (5) Wash with 1×PBS 3 to 5 times and observe under a microscope. The calcium salt deposits in the cells will appear orange-red.

[0149] 3. hVICs calcium quantitative detection

[0150] (1) Wash the cells cultured for 2 weeks in the test well plate with TBS, then add 0.6N HCl to the 12-well plate for 24 hours, and collect the supernatant containing calcium ions and HCl.

[0151] (2) Calcium content was detected according to the instructions of the Calcium C-test Wako detection kit. After gentle washing with TBS, the remaining cells at the bottom of the six-well plate were lysed with 0.1N NaOH solution containing 0.1% SDS, and total protein was extracted.

[0152] (3) The protein concentration was determined using a BSA kit and the obtained calcium content was normalized to the protein content.

[0153] 3. Results Analysis

[0154] Alizarin red staining and calcium quantitative analysis showed that compared with the control group, overexpression of NAT10 significantly promoted the formation of calcium salt nodules in valvular interstitial cells induced by osteogenic induction medium ( Figure 3 A) and calcium salt deposition ( Figure 3 B) increased effect (P < 0.05), while knockdown of NAT10 significantly inhibited the calcium salt nodules of valvular interstitial cells induced by osteogenic induction medium ( Figure 4 A) and calcium salt deposition ( Figure 4 B) Increased effect (P<0.05).

[0155] Example 6: Knockdown of NAT10 can inhibit the mRNA stability and expression level of CD36, a key gene for valve calcification, and thus inhibit the osteogenic differentiation of human aortic valve interstitial cells.

[0156] In this example, valvular interstitial cells were isolated and cultured. Following the method described in Example 4, shNAT10 was successfully transfected and then induced in osteogenic differentiation induction medium for 14 days to establish an in vitro osteogenic differentiation model. The mRNA stability and expression changes of CD36, a key gene for valvular calcification, were then detected. q-RTPCR results showed that knockdown of NAT10 significantly downregulated the mRNA stability and expression level of CD36 ( Figure 5 A, Figure 5 B). The primer sequences for CD36 real-time fluorescence quantitative PCR are shown as the primer pair in SEQ ID NO: 4 (GGCTGTGACCGGAACTGTG) and SEQ ID NO: 5 (AGGTCTCCAACTGGCATTAGAA).

[0157] Example 7. Animal Experiment: Effect of NAT10 Silencing in Vivo on the Degree of Aortic Valve Calcification in Mice

[0158] At present, the three most commonly used animal models for CAVD research are mice, rabbits, and miniature pigs. Among them, the spontaneous development of CAVD in pigs is similar to the progression of human CAVD disease, but the modeling time is long. In addition to dietary induction, rabbit modeling also requires drug intervention, and it is difficult to construct a specific gene mutation system. Compared with the first two, mice have become the most widely used modeling choice in current research because of their advantages such as low economic cost, easy management, high modeling rate, and mature gene mutation system. In this experiment, ApoE was selected - / - Genetically engineered mice were used to construct a CAVD animal model.

[0159] Recombinant adeno-associated virus (AAV) is a gene modification vector that is non-pathogenic and has broad tissue tropism. It is widely used in biomedical research. At the same time, AAV has strong genome integration ability and persistent infection ability, and can be efficiently transmitted both in vivo and in vitro (DE JESUSD F, ZHANG Z, KAHRAMAN S, et al. m(6)A mRNA Methylation Regulates Humanβ-Cell Biology inPhysiological States and in Type 2Diabetes. Nature metabolism, 2019, 1(8): 765-774). It has been successfully used in the study of many diseases (YANG Y, SHEN F, HUANG W, et al. Glucose IsInvolved in the Dynamic Regulation of m6A in Patients With Type 2Diabetes. The Journal of clinical endocrinology and metabolism, 2019, 104(3): 665-673; BUDIYANIL, PURNAMASARID, SIMADIBRATA M, et al. Insulin Resistance in Gastroesophageal Reflux Disease. Acta medica Indonesiana, 2018, 50(4): 336-342). AAV is classified according to serotype, and different serotypes have great differences in affinity for corresponding tissues. For valvular interstitial cells, studies have confirmed that among the many AAV serotypes, AAV serotype 2 (AAV2) has higher tissue affinity and gene transduction ability than other serotypes (REDDY KJ, SINGH M, BANGIT JR, et al. The role of insulin resistance in the pathogenesis of atherosclerotic cardiovascular disease: an updated review. Journal of cardiovascular medicine (Hagerstown, Md), 2010, 11(9): 633-647).AAV2-mediated gene editing in mice has also been widely used in cardiovascular disease research, especially atherosclerosis (PICHéM E, PARRY SA, KARPE F, et al. Chylomone-Derived Fatty Acid Spillover in Adipose Tissue: A Signature of Metabolic Health?. The Journal of clinical endocrinology and metabolism, 2018, 103(1): 25-34; XIE W, MA LL, XU YQ, et al. METTL3 inhibits hepatic insulin sensitivity via N6-methyladenosine modification of Fasn mRNA and promoting fatty acid metabolism. Biochemical and biophysical research communications, 2019, 518(1): 120-126). Therefore, in the present invention, ApoE is used. - / - Genetically engineered mice, using AAV2 as a gene silencing vector in mice, further demonstrated that NAT10 gene silencing is involved in ApoE - / - Effects of in vivo levels on the progression of aortic valve calcification in mice.

[0160] 1. CAVD Animal Model Grouping

[0161] 40 4-week-old male ApoE - / - Mice were divided into two groups after injection of AAV2-scr (control group, n=20) and AAV2-shNAT10 (n=20) through the tail vein:

[0162] (1) Normal diet (ND) + control group (ND + AAV2-scr), n = 10;

[0163] (2) High cholesterol diet (HCD) + control group (HCD + AAV2-scr), n = 10;

[0164] (3) normal diet + NAT10 silencing group (ND + AAV2-shNAT10), n = 10;

[0165] (4) High cholesterol diet + NAT10 silencing group (HCD + AAV2-shNAT10), n = 10.

[0166] 2. Dietary induction began at 8 weeks of age. Aortic valve specimens were obtained 24 weeks later. Methods: Mice were fasted for one day. The following day, anesthesia was induced with 10% chloral hydrate. A clear surgical field was established under a microscope, and the aorta was rapidly severed approximately 5 mm from the aortic root. The heart was harvested intact. Whole-body cardiac tissue was fixed with 4% paraformaldehyde. Serial sections were made from the aortic root. Sections were stained with hematoxylin and eosin and von Kossa to assess the degree of aortic valve calcification.

[0167] 3. Results Analysis

[0168] Figure 6 HE staining of valves revealed that after induction with a high-fat, high-cholesterol diet, aortic valve leaflet thickness was significantly reduced in the NAT10-silenced group compared with the empty vector group. Alizarin red staining of valves revealed that after induction with a high-fat, high-cholesterol diet, calcium deposition in the aortic valve leaflets of the NAT10-silenced group was significantly reduced compared with the empty vector group. These results confirm that knocking down NAT10 significantly inhibits aortic valve calcification in mice.

[0169] Example 8: Remodelin, a small molecule inhibitor of NAT10, inhibits osteogenic differentiation of human aortic valve interstitial cells.

[0170] In this example, valvular interstitial cells were isolated and cultured. After the NAT10 small molecule inhibitor Remodelin was used to treat the valvular interstitial cells to inhibit NAT10 acetyltransferase activity, the valvular interstitial cells were induced with osteogenic differentiation induction medium for 14 days to establish an in vitro osteogenic differentiation model. Alizarin red staining and calcium quantitative analysis were used to assess the degree of calcification of valvular interstitial cells. Alizarin red staining and calcium quantitative analysis showed that compared with the control group, Remodelin could significantly inhibit the formation of calcium salt nodules in valvular interstitial cells induced by osteogenic induction medium ( Figure 7 A) and calcium salt deposition ( Figure 7 B) Increased effect (P < 0.05). Remodelin has a molecular formula of C-(15)H-(14)N-4S, a molecular weight of 282.36, product number S7641, Selleck, and was used at a concentration of 20 μM.

[0171] Finally, it should be noted that the above embodiments are intended only to illustrate the present invention and are not intended to limit the scope of protection of the present invention. In addition, after reading the technical contents of the present invention, those skilled in the art may make various changes, modifications, or variations to the present invention, and all such equivalent forms also fall within the scope of protection defined by the present application.

Claims

1. Use of an agent for inhibiting NAT10 protein expression in the preparation of a drug for preventing and treating calcific aortic valve disease, characterized in that: The reagent for inhibiting NAT10 protein expression includes any of the following: a recombinant vector containing shNAT10 that inhibits the expression of a NAT10 protein-encoding gene; a recombinant virus containing shNAT10 that inhibits the expression of a NAT10 protein-encoding gene; the shNAT10 nucleotide sequence is as shown in SEQ ID NO: 1, specifically: GCAATTGTACACAGTGACTAT; the reagent for inhibiting NAT10 protein expression inhibits the osteogenic differentiation of valvular interstitial cells by inhibiting the mRNA stability and protein expression of CD36, a key gene promoting hVICs osteogenic differentiation, thereby delaying valve calcification.

2. The use according to claim 1, characterized in that The recombinant virus of shNAT10 that inhibits the expression of the gene encoding the NAT10 protein is a recombinant adenovirus or a recombinant adeno-associated virus containing shNAT10 that inhibits the expression of the gene encoding the NAT10 protein.

3. The use according to claim 1, characterized in that The reagent for inhibiting the expression of NAT10 protein also includes the NAT10 small molecule inhibitor Remodelin.

4. The use according to claim 1, characterized in that The drug for preventing and treating calcific aortic valve disease is a pharmaceutical composition prepared from the reagent for inhibiting NAT10 protein expression and a conventional pharmaceutical carrier.

5. The use according to claim 4, characterized in that The pharmaceutical composition is a capsule, granule, injection, sustained-release tablet, buccal tablet or powder injection.

6. Use of an agent for inhibiting NAT10 protein expression in the preparation of a drug for preventing and treating heart valve calcification, characterized in that: The reagent for inhibiting NAT10 protein expression includes any of the following: a recombinant vector containing shNAT10 that inhibits the expression of a NAT10 protein-encoding gene; a recombinant virus containing shNAT10 that inhibits the expression of a NAT10 protein-encoding gene; the shNAT10 nucleotide sequence is as shown in SEQ ID NO: 1, specifically: GCAATTGTACACAGTGACTAT; the reagent for inhibiting NAT10 protein expression inhibits the osteogenic differentiation of valvular interstitial cells by inhibiting the mRNA stability and protein expression of CD36, a key gene promoting hVICs osteogenic differentiation, thereby delaying valve calcification.

Images