Application of K568 site mutation of Ku80 protein in regulation and control of tumor cell proliferation and radiotherapy sensitivity

Abstract

The invention provides application of K568 site mutation of Ku80 protein in regulation and control of tumor cell proliferation and radiotherapy sensitivity, and belongs to the technical field of biology. The invention provides any one of the following applications of a substance capable of causing site-directed mutagenesis of a K568 site of Ku80 protein in a body or a cell: inhibiting tumor cell proliferation; dNA damage repair in tumor cells is inhibited; treating tumors; the tumor radiotherapy sensitivity is improved; and preparing tumor chemotherapy drugs. Tests prove that the K568 site mutation of the Ku80 protein can reduce tumor cell activity, inhibit tumor cell proliferation, promote tumor cell apoptosis, inhibit DNA damage repair after tumor cell radiotherapy and improve radiotherapy sensitivity, can be used as a target spot for researching related drugs for treating tumors, and has potential clinical application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to the application of K568 site mutation of Ku80 protein in regulating tumor cell proliferation and radiotherapy sensitivity. Background Art

[0002] Ku80 protein is a protein with important functions in cells. It usually forms a heterodimer with Ku70 protein to form Ku protein. Ku protein has the ability to recognize and bind DNA and regulate immune response, which is related to the occurrence and development of tumors. Ku80 protein may also be involved in other physiological processes of cells, such as cell cycle regulation and chromosome stability maintenance, but the specific mechanism is not yet fully understood.

[0003] Tumor is one of the major diseases that seriously threatens human health. The occurrence and development of tumors involve the disorder of many intracellular molecular mechanisms. At present, the field of tumor treatment still faces many challenges, such as the drug resistance of tumor cells during treatment and the side effects of treatment on normal cells. Existing tumor treatment methods still have a lot of room for improvement in effectiveness and specificity. Therefore, exploring new tumor treatment strategies based on Ku80 protein has important scientific significance and clinical application prospects. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide an application of the K568 site mutation of the Ku80 protein in regulating tumor cell proliferation and radiotherapy sensitivity.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: The present invention provides the use of a substance capable of causing site-directed mutation at the K568 site of Ku80 protein in an organism or cell in any of the following applications: (1) Preparation of products for inhibiting tumor cell proliferation; (2) Preparation of products for inhibiting DNA damage repair in tumor cells; (3) Preparation of products for treating tumors; (4) Preparation of products that improve tumor radiosensitivity; (5) Preparation of tumor chemotherapy drugs.

[0006] Preferably, the site-directed mutation at the K568 site is: the K at position 568 of the Ku80 protein is mutated to R.

[0007] Preferably, the substance includes any one or more of shRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA or antisense DNA, low molecular weight compounds, peptides and antibodies.

[0008] The present invention also provides the use of the K568 site of the Ku80 protein in an organism or cell as a target in the development of any of the following products: (1) Preparation of products for inhibiting tumor cell proliferation; (2) Preparation of products for inhibiting DNA damage repair in tumor cells; (3) Preparation of products for treating tumors; (4) Preparation of products that improve tumor radiosensitivity; (5) Preparation of tumor chemotherapy drugs.

[0009] Preferably, the tumor is a tumor expressing Ku80 protein; and the tumor cells are tumor cells expressing Ku80 protein.

[0010] The present invention also provides a method for inhibiting tumor cell proliferation for non-disease diagnosis or treatment purposes, comprising the following steps: causing site-directed mutation at the K568 site of the Ku80 protein in the tumor cells.

[0011] The present invention also provides a method for inhibiting DNA damage repair in tumor cells for purposes other than disease diagnosis or treatment, comprising the following steps: causing site-directed mutation at the K568 site of the Ku80 protein in the tumor cells.

[0012] The present invention also provides a method for improving the radiotherapy sensitivity of tumor cells for purposes other than disease diagnosis or treatment, comprising the following steps: causing site-directed mutation of the K568 site of the Ku80 protein in the tumor cells.

[0013] Preferably, the site-directed mutation at the K568 site is: the K at position 568 of the Ku80 protein is mutated to R.

[0014] Preferably, the tumor cells are tumor cells expressing Ku80 protein.

[0015] Compared with the prior art, the technical solution of the present invention has the following beneficial effects: The experiments of the present invention prove that the mutation of K to R at position 568 of Ku80 protein can reduce tumor cell viability, inhibit tumor cell proliferation, promote tumor cell apoptosis, inhibit DNA damage repair of tumor cells after radiotherapy, and improve radiotherapy sensitivity. It can be used as a target for the research of related drugs for treating tumors and has potential clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 :Sequencing results of Ku80 (WT)-GFP-Flag DNA product; Figure 2 :Sequencing results of Ku80 (K568R)-GFP-Flag DNA product; Figure 3 :Western blot was used to detect the knockout effect and exogenous expression level of Ku80 target protein in cells; Figure 4 : Sequencing results of Ku80 (K568R)-GFP-Flag positive cells; Figure 5 : Sequencing results of PCR products of Ku80 (K568R)-GFP-Flag positive cells compared with the original sequence; Figure 6 :Western blot was used to detect the knockout effect of Ku80 target protein and the exogenous expression level; Figure 7 : Sequencing results of Ku80 (WT)-GFP-Flag positive cells; Figure 8 : Sequencing results of PCR products of Ku80 (WT)-GFP-Flag positive cells compared with the original sequence; Fig. 9 :Western blot was used to detect the knockout effect and exogenous expression level of Ku80 target protein in Ku80 (WT)-GFP-Flag positive cells; Fig.10 :Western blot was used to detect the knockout effect and exogenous expression level of Ku80 target protein in normal HELA cells, GFP-Flag-Ku80(K568R) cell lines and GFP-Flag-Ku80(WT) cell lines; Fig.11 :Effect of Ku80 K568R mutation on cell survival rate; Fig.12 :The effect of Ku80 K568R mutation on cell growth; Fig.13 :The effect of Ku80 K568R mutation on cells treated with different drugs; Fig.14 :The effect of Ku80 K568R mutation on the changes of γ-H2AX foci in cells; Fig.15 :Effect of Ku80 K568R mutation on cell apoptosis; Fig.16 :Effects of Ku80 K568R mutation on tumor volume and weight in nude mice. DETAILED DESCRIPTION

[0017] The present invention provides the use of a substance capable of causing site-directed mutation at the K568 site of Ku80 protein in an organism or cell in any of the following applications: (1) Preparation of products for inhibiting tumor cell proliferation; (2) Preparation of products for inhibiting DNA damage repair in tumor cells; (3) Preparation of products for treating tumors; (4) Preparation of products that improve tumor radiosensitivity; (5) Preparation of tumor chemotherapy drugs.

[0018] The present invention preferably inhibits DNA damage repair in tumor cells by enhancing the sensitivity of tumor cells to DNA damage, and more preferably enhances the sensitivity of tumor cells to DNA damage after irradiation, thereby inhibiting DNA damage repair in tumor cells; the irradiation is preferably 60 Co γ-ray irradiation.

[0019] The tumor described in the present invention is a tumor expressing Ku80 protein, preferably cervical cancer or breast cancer; the tumor cell is a tumor cell expressing Ku80 protein, preferably cervical cancer cell or breast cancer cell.

[0020] The site-directed mutation at the K568 site of the present invention is: the K (lysine, Lys) at position 568 of the Ku80 protein is mutated to R (arginine, Arg). The site-directed mutation will not cause a frameshift mutation, that is, the substance can cause the K at position 568 of the Ku80 protein in the body or cell to mutate to R, and the other amino acid residues of the Ku80 protein remain unchanged.

[0021] The substance of the present invention includes any one or more of shRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA or antisense DNA, low molecular weight compounds, peptides and antibodies, but is not limited thereto.

[0022] The present invention also provides the use of the K568 site of the Ku80 protein in an organism or cell as a target in the development of any of the following products: (1) Preparation of products for inhibiting tumor cell proliferation; (2) Preparation of products for inhibiting DNA damage repair in tumor cells; (3) Preparation of products for treating tumors; (4) Preparation of products that improve tumor radiosensitivity; (5) Preparation of tumor chemotherapy drugs.

[0023] The present invention preferably inhibits DNA damage repair in tumor cells by enhancing the sensitivity of tumor cells to DNA damage, and more preferably enhances the sensitivity of tumor cells to DNA damage after irradiation, thereby inhibiting DNA damage repair in tumor cells; the irradiation is preferably 60 Co γ-ray irradiation.

[0024] The tumor described in the present invention is a tumor expressing Ku80 protein, preferably cervical cancer or breast cancer; the tumor cell is a tumor cell expressing Ku80 protein, preferably cervical cancer cell or breast cancer cell.

[0025] The site-directed mutation at the K568 site of the present invention is: the 568th K of the Ku80 protein is mutated to R. The site-directed mutation will not cause a frameshift mutation, that is, the substance can cause the 568th K of the Ku80 protein in the body or cell to mutate to R, and other amino acid residues of the Ku80 protein remain unchanged.

[0026] The present invention also provides a method for inhibiting tumor cell proliferation or inhibiting tumor cell DNA damage repair or improving tumor cell radiotherapy sensitivity, comprising the following steps: causing site-directed mutation of the K568 site of Ku80 protein in tumor cells.

[0027] The site-directed mutation of the K568 site of the present invention is: the 568th K of the Ku80 protein is mutated to R. The site-directed mutation will not cause a frameshift mutation, that is, the substance can cause the 568th K of the Ku80 protein in the body or cell to mutate to R, and the other amino acid residues of the Ku80 protein remain unchanged. The tumor cell of the present invention is a tumor cell expressing the Ku80 protein, preferably a cervical cancer cell or a breast cancer cell.

[0028] The above method of the present invention is a method for non-disease diagnosis or treatment purposes. As a method for non-disease diagnosis or treatment, it can be used for simple tumor cell proliferation research, or as a positive control when screening drugs that can inhibit tumor cell proliferation.

[0029] The technical solutions in the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] In the embodiments of the present invention, nude mice were purchased from Sibeifu Biotechnology Co., Ltd. with an animal production license number of SCXK (Beijing) 2019-0010; Lenti-HG Mix was purchased from Genomeditech / GMLCP (1 mg / mL).

[0031] In the specific embodiment of the present invention, the GFP-Flag-Ku80 (K568R) cell line and the GFP-Flag-Ku80 (WT) cell line were constructed by entrusting Jiman Biotechnology (Shanghai) Co., Ltd. The specific construction method is as follows: (1) Construction of CRISPR / Cas9 vector: A single-stranded DNA oligo of the gRNA sequence (TCTTCCTTGCCAAGTGAGAA, SEQ ID No. 1, denoted as Human XRCC5) was synthesized and annealed to produce a double-stranded DNA oligo, which was directly linked to the CRISPR / Cas9 vector (GM-31871: LentiGuide-CMV-Neo (stuffer), purchased from Genomeditech Co., Ltd.) after restriction digestion through the restriction sites at both ends. The ligation product was transferred into the prepared bacterial competent cells, and the monoclonal colonies grown were identified by sequencing. The clones with the correct alignment were the successfully constructed H_XRCC5 sgRNA-Neo (lenti-SpCas9) plasmids.

[0032] (2) H_XRCC5 sgRNA-Neo lentiviral packaging When 293T cells grow to 70%~80%, plasmid co-transfection operation is performed. The transfection system is: DMEM 850μL, plasmid 10μg, Lenti-HG Mix 10μL (10μg), HG transgene reagent 60μg. Place at room temperature for 20min, evenly add to the culture dish to be transfected, and then place in CO 2 Culture in an incubator. After 12 hours of transfection, evenly add 100×Enhancingbuffer to promote transfection. After 20 hours of transfection, carefully remove the cell culture medium and discard it in a waste liquid cup containing disinfectant, then add 12mL of DMEM cell culture medium containing 1% serum to continue culturing. After 48 hours of liquid replacement, aspirate the cell supernatant into a 50mL centrifuge tube, centrifuge at 4°C, 4000g for 5 minutes, filter the supernatant with a 0.22μm filter and transfer it to a new centrifuge tube, and finally transfer the filtrate to a concentration device in batches, centrifuge at 4°C, 3500g for 10 minutes, discard the lower layer of liquid in a waste liquid cup containing disinfectant, and centrifuge at 4°C, 3500g for the last time for 20 minutes. At this time, the liquid in the upper layer of the filter is the virus concentrate.

[0033] (3) Construction of H_XRCC5 exogenous overexpression lentivirus According to the K568R site mutation requirements of the Human XRCC5 gene, the codon-optimized target gene sequence / point mutation sequence was constructed into the GM-8077: PGMLV-CMV-MCS-eGFP-3×Flag-PGK-Puro (purchased from Genomeditech Co., Ltd.) vector. First, synthetic primers were designed to amplify the target fragment, and then it was connected to the vector after restriction digestion; the ligation product was transferred into the prepared bacterial competent cells, and the grown monoclonal colonies were sent to the sequencing company for sequencing. The correct clone was the successfully constructed vector, and the PGMLV-CMV-H_XRCC5(p.K568R)(Condon opt)-eGFP-3×Flag-PGK-Puro and PGMLV-CMV-H_ XRCC5(Condon opt)-Egfp-3×Flag-PGK-Puro overexpression plasmids were obtained.

[0034] The lentiviral packaging process is the same as that in step (2). The constructed lentiviral vector and its auxiliary packaging element vector plasmid are co-transfected into 293T cells using HG transgene reagent. Enhancing buffer is added 10-12 hours after transfection, and fresh culture medium is replaced 8 hours later. After 48 hours of continuous culture, the cell supernatant rich in lentiviral particles is collected and concentrated to obtain a high-titer lentiviral concentrate. The virus titer is measured and calibrated in 293T cells.

[0035] (4) Construction of Cas9-blast HELA cells HELA cells were infected with lentivirus Cas9-Blasticidin (GM-0220LV03, purchased from Genomeditech Co., Ltd.) to obtain the Cas9-Blast HELA stable cell line.

[0036] The experimental method is as follows: On the first day, 5E4 cells were inoculated into a 24-well plate with HELA cells. Before infection, the virus stock solution was taken out of the -80℃ refrigerator and melted in an ice bath. The virus stock solution was diluted with 500μL complete medium at MOI=100, the original medium of the treatment group was removed, and 300μL medium containing the lentivirus dilution solution was added to the cells of the treatment group. The culture medium was replaced, and the culture medium containing the lentivirus was replaced with 500μL complete culture medium 16 hours after infection. Appropriate resistance screening cells were selected (Blasticidin full lethal concentration 30μg / mL, maintenance concentration 15μg / mL), and two rounds of drug screening (1 round for 3 days) were performed, and the cells were stable. After stabilization, DMEM+10% FBS+1% Pen / Strep+15μg / mL Blasticidin complete medium was used to maintain the cells.

[0037] (5) Construction of Ku80 (K568R)-GFP-Flag cell line and Ku80 (WT)-GFP-Flag cell line Cas9-blast HELA cells were infected with packaged H_XRCC5(p.K568R)(Condon opt), H_XRCC5(Condon opt) lentivirus and H_XRCC5 sgRNA6 lentivirus at a ratio of 1:1 to obtain Ku80(K568R)-GFP-Flag cell lines and Ku80(WT)-GFP-Flag cell lines.

[0038] The experimental method is as follows: Cas9-blast HELA cells were inoculated with 1E5 cells in a 12-well plate. Before infection, the virus stock solution was taken out of the -80℃ refrigerator and melted in an ice bath. The virus stock solution was diluted with 800μL complete medium at MOI=100, the original medium of the treatment group was removed, and 500μL medium containing the lentivirus dilution solution was added to the cells of the treatment group. The culture medium was replaced. After 16 hours of infection, the culture medium containing the lentivirus was replaced with 1mL complete culture medium. Infection efficiency detection, fluorescence was observed under an inverted fluorescence microscope to estimate the efficiency of lentivirus infection of the target cells. Appropriate eukaryotic resistance screening cells (Puromycin full lethal concentration 1μg / mL, maintenance concentration 0.5μg / mL) were selected. After two rounds of drug screening, the cells were stable. After stabilization, DMEM+10% FBS+1% P.S+0.5μg / mL Puromycin complete medium was used to maintain the cells.

[0039] (6) Mixed clone pool sequencing and WB detection of expression effect DNA was extracted using the Bio-Sky DNA Extraction Kit. For specific operation methods, see the kit manual. PCR primers designed in advance for the H_XRCC5 codon optimization sequence (56939CF2: CCTGCCCTTTCAGTTACTTGG (SEQ ID No. 2); 56939CR2: TGACTAATTAGAGAGTGGCCCAGA (SEQ ID No. 3); 75400CF1: AAGGTTGATGAGGAACAGATGAAA (SEQ ID No. 4); 75400CR1: CTCGTCATCTCTAGCGGCA (SEQ ID No. 5); 71713CF1: GCCAAGAAGCTGAGAACCG (SEQ ID No. 6); 71713CR1: CTCGAAGCTGGCCTTCTTC (SEQ ID No. 7)) were synthesized for PCR.

[0040] PCR amplification system: template 100ng, Test-F 2µL, Test-R 2µL, PCR mix 25µL, ddH 2 Make up to 50 µL with HO.

[0041] Add the above materials into the thin-walled tube, mix well, and then place it into the PCR instrument. Select the appropriate annealing temperature and extension temperature, and then start PCR amplification. After the PCR is completed, perform agarose gel electrophoresis and recover the target gene. The recovered PCR product is sent for testing.

[0042] The sequencing results of Ku80 (WT)-GFP-Flag DNA products are shown in Figure 1 ; Sequencing attachment name: 0719_32723051603212_(75400-A1-3)_[56939CF2-75541]; 0194_32723052100165_(75400-A4-1A)_[75400CF1-86314]; 0195_32723052100165_(75400-A4-1A)_[75400CR1-86315]. The sequencing results of Ku80 (K568R) -GFP-Flag DNA product are as follows Figure 2 ;0695_32723051603200_(71713-A1-2)_[56939CF2-75541];0696_32723051603200_(71713-A1-2)_[56939CR2-75542] ;0253_32723051800716_(71713-A1-3)_[71713CF1-86305];0254_32723051800716_(71713-A1-3)_[71713CR1-86313].

[0043] Western blot was used to detect the knockout effect of Ku80 target protein and the exogenous expression level in cells. The results are as follows Figure 3 Lane S2 is the HELA group overexpressing H_XRCC5 plasmid, lane S3 is the Ku80 (WT)-GFP-Flag stable transfectant group, and lane S6 is the Ku80 (K568R)-GFP-Flag group (the remaining lanes are other experimental results of the same group, which cannot be removed and are therefore retained).

[0044] (7) Limited dilution method Ku80 (K568R) -GFP-Flag and Ku80 (WT) -GFP-Flag stable transfectants were diluted with DMEM + 20% FBS + 1% Pen / Stre + 0.5μg / mL Puromycin cell culture medium. After 2-3 days of culture, the positive wells with single clone growth were marked. The growth of the monoclonal was observed after one week, and the fluid was replenished in time. After about three weeks, the grown monoclonal was transferred to 48-well for expansion culture. When the cells reached the cell volume of 24-well plate, the samples were collected for subsequent detection.

[0045] (8) Monoclonal sequencing, TA cloning, and WB verification Use a DNA extraction kit to extract DNA. Use gRNA primers for PCR amplification and gel recovery sequencing verification. For positive clones with different mutations in the two alleles, re-do TA cloning and send for sequencing, compare with the wild type, and determine the mutation status of each allele.

[0046] According to the sequencing results of the PCR products, cell #4 was identified as positive for Ku80 (K568R)-GFP-Flag. The sequencing results are shown in Figure 4 (71713D-A1-primer-71715CF1-88843_H03; 0005_32723061300656_(71713H-B5)_[56939CF2-75541]); The sequencing results of PCR product #4 were compared with the original sequence. There was only one case (except for the empty load). The specific sequencing results are shown in Figure 5 Compared with the parent, the deletion of 13 bp leads to premature termination of translation (including missense). Western blot was used to detect the knockout effect and exogenous expression level of Ku80 target protein in Ku80 (K568R)-GFP-Flag positive cells. Figure 6 As shown, lane S2 in the figure is the identification result of Ku80 (K568R) -GFP-Flag (the remaining lanes are the results of other experiments in the same group and are retained because they cannot be removed).

[0047] According to the sequencing results of the PCR products, cell #24 was identified as positive for Ku80 (WT)-GFP-Flag. The sequencing results are shown in Figure 7 (75400MY-2C-primer-75400CF1A-95789_C04; 75400MY-2C-primer-75400CR1A-95790_D04; 56940CD-D7-primer-56939CF2-75541_D07); The sequencing results of PCR product #4 have only one case (except for the empty load) compared with the original sequence. The specific sequencing results are shown in Figure 8Compared with the parent, the length of the sequence was increased by 1 bp, and the translation was terminated prematurely (including missense). Western blot was used to detect the knockout effect and exogenous expression level of Ku80 target protein in Ku80 (WT)-GFP-Flag positive cells, such as Fig. 9 As shown, lane S4 in the figure is the identification result of Ku80 (WT)-GFP-Flag (the remaining lanes are the results of other experiments in the same group and are retained because they cannot be removed).

[0048] Fig.10 In the figure, shNC is the normal HELA cell line, K568R and WT are the GFP-Flag-Ku80(K568R) cell line and GFP-Flag-Ku80(WT) cell line.

[0049] From the above results, it can be seen that compared with the shNC cell line, Ku80 is almost knocked out in the GFP-Flag-Ku80 (K568R) cell line and the GFP-Flag-Ku80 (WT) cell line, and obvious Ku80 expression is seen at the fused GFP-Flag position. This shows that the cell line was successfully constructed, and the GFP-Flag-Ku80 (K568R) cell line and the GFP-Flag-Ku80 (WT) cell line can be used for verification in the examples.

[0050] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0051] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0052] Example 1 Prepare cells (GFP-Flag-Ku80(K568R) cell line and GFP-Flag-Ku80(WT) cell line) and give different doses of 60 Co γ-ray treatment was performed at a dose rate of 66.49 cGy / min, and the cells were collected for corresponding tests.

[0053] (1) Clone formation experiment The cells were observed to be growing well under the microscope. After washing once with 1×PBS, trypsin was added for digestion and centrifugation, and then complete culture medium was added to make a single cell suspension for cell counting. During this period, a 6-well plate was prepared and the corresponding group name was marked. Then the volume of the inoculated cell suspension was calculated according to the number of cells inoculated in Table 1, and 3 replicates were set for each group: Table 1. Table of cell inoculation numbers for clone formation experiment

[0054] After the inoculated cells adhered to the wall, different doses of 60 Co γ-ray irradiation; After irradiation, place the 6-well plate in a cell culture incubator for continued culture, and replace the cells with fresh complete culture medium every 3 days; observe the cell growth under a microscope, and when each cell clone contains more than 50 cells (about 14 days). Discard the culture medium in the 6-well plate, wash once with pre-cooled 1× PBS, and then add 2mL of anhydrous methanol to each well and fix for 1 hour; then remove the anhydrous methanol, add 2mL of Giemsa stain to each well and stain at room temperature for 3 hours; After staining, the Giemsa stain was recovered and the 6-well plate was washed three times with clean water. Then the cells were observed under a microscope and clones with more than 50 cells were selected for counting. Finally, GraphPad Prism 9 was used for statistical analysis. The experiment was repeated three times independently, and the data are expressed as mean ± standard deviation. * indicates P Value < 0.1, ** indicates P Value < 0.01, *** indicates P Value < 0.001.

[0055] The results are as follows Fig.11 As shown in the figure, WT-Ku80 is the GFP-Flag-Ku80 (WT) cell group, and K568R-Ku80 is the GFP-Flag-Ku80 (K568R) cell group. The results showed that the Ku80 K568R mutation significantly affected the cell's clone formation ability and clone size, and the cell survival rate was significantly reduced. The Ku80 K568R mutation had a significant effect on the cell's proliferation ability and radiation sensitivity.

[0056] (2) Cell proliferation and viability test The cells were observed to be in good growth condition under the microscope. After washing once with 1×PBS, trypsin was added for digestion and centrifugation, and then complete culture medium was added to make a single cell suspension for cell counting. During this period, the E-Plate detection plate was prepared, 50μL of complete culture medium was added to each culture well, and it was placed in the multifunctional real-time label-free cell function analyzer (RTCA) in the cell culture incubator, and the parameters were set for blank background detection; 100μL of cell suspension containing 2000 cells was added to each well, first placed in the clean bench at room temperature for 30 minutes, and then placed in the RTCA instrument for culture; each group was repeated 3 times.

[0057] After the cells adhere to the wall, take out the E-Plate detection plate and give 60 Co γ-ray irradiation (8 Gy) was used to dynamically monitor cell proliferation in real time after irradiation. 60 Cells irradiated with Co γ-rays were used as the control group. After the test, the program was closed, the data was saved, and the instrument was used for image processing and data analysis. Fig.12 As shown in the figure, K568R NC is not performed 60GFP-Flag-Ku80(K568R) cells were irradiated with Co γ-rays, and WT NC cells were not irradiated with Co γ-rays. 60 Co γ-ray irradiated GFP-Flag-Ku80 (WT) cell group, WT IR is 60 GFP-Flag-Ku80 (WT) cell group after Co γ-ray irradiation, K568R IR 60 GFP-Flag-Ku80(K568R) cells irradiated with Co γ-rays. Fig.12 It can be seen that the Ku80 K568R mutation inhibited cell growth, indicating that the Ku80 K568R mutation had a significant effect on the proliferation ability and radiation sensitivity of cells.

[0058] After the cells adhered to the wall, the E-Plate test plate was taken out, the medium in the culture wells was sucked out with a vacuum pump, and then the cells in each culture well were treated with CPT (1μM), HU (1mM), ETO (100nM) and MMC (5μM), and the control group was given an equal volume of DMSO; and real-time dynamic detection was continued; after the detection, the program was closed, the data was saved, and the instrument was used for image processing and data analysis. The results are as follows Fig.13 As shown in the figure, WT DMSO, WT CPT, WT HU, WT ETO and WT MMC represent the groups of GFP-Flag-Ku80 (WT) cells treated with DMSO, CPT, HU, ETO and MMC, respectively; K568R DMSO, K568RCPT, K568R HU, WTK568R ETO and K568R MMC represent the groups of GFP-Flag-Ku80 (K568R) cells treated with DMSO, CPT, HU, ETO and MMC, respectively. It can be seen that compared with GFP-Flag-Ku80-WT cells, the cell viability values ​​of GFP-Flag-Ku80-K568R cells were significantly decreased after treatment with these drugs, indicating that the Ku80 K568R mutation has a significant effect on the proliferation ability and drug sensitivity of cells.

[0059] (3) Immunofluorescence experiment Soak the coverslip in anhydrous ethanol in advance, place the coverslip in a 6-well plate before plating the cells, and then add 2 mL of complete culture medium. Then, the cells are evenly inoculated in the 6-well plate according to the normal cell passaging method and cultured in a cell culture incubator; After the cells adhered to the wall, different doses of 60Co γ-ray irradiation, and samples were collected and processed at different times (0h, 1h, 2h, 4h, 8h, 12h) after irradiation: first, the old culture medium in the 6-well plate was sucked out with a vacuum pump, and then washed 3 times with ice 1× PBS. Finally, 2mL of 4% paraformaldehyde was added to each well, and after fixation at room temperature for 30min, it was stored in a 4℃ refrigerator. After the cells at all time points were fixed, the subsequent steps could be processed uniformly.

[0060] After fixation, first use a vacuum pump to suck out 4% paraformaldehyde in the 6-well plate, then wash twice with 1×PBS; then add 2mL 0.3% Triton-100 to each well and permeabilize for 20min at room temperature; after permeabilization, first wash twice with 1×PBS, then add 2mL 3% BSA to each well and block for 30min at room temperature. During this period, prepare the primary antibody with 3% BSA according to the dilution ratio of the antibody manual (γH2AX 1:200); after blocking, first use a vacuum pump to suck out the blocking solution, then add the primary antibody (50μL) on the coverslip and incubate overnight in a 4℃ refrigerator, or incubate at room temperature for 2h; after the primary antibody incubation, add 2mL ice 1×PBS to each well, wash the primary antibody at medium speed on a shaker, and repeat 3 times. During this period, prepare the secondary antibody with 3% BSA in the dark according to the dilution ratio in the antibody manual (goat anti-rabbit 1:400); after washing the primary antibody, drop the secondary antibody on the surface of the coverslip (50μL) and incubate it in the dark at room temperature for 1h; after incubating the secondary antibody, add 2mL of ice 1×PBS to each well, wash the secondary antibody at high speed on a shaker in the dark, and repeat 3 times. During the washing of the secondary antibody, prepare a new slide, label the corresponding sample name, and drop the anti-quenching sealing agent containing DAPI on the slide. After washing, remove the coverslip from the 6-well plate, and then cover the cell side on the slide with the sealing agent, and try not to produce bubbles. Finally, wrap the slide with tin foil and store it in a humid box at 4°C; After 1 day, the images were taken on a laser confocal instrument and then analyzed and processed. The experiment was repeated three times independently, and the data are expressed as mean ± standard deviation. *** indicates P Value < 0.001.

[0061] The results are as follows Fig.14As shown. In the figure, A is the result of immunofluorescence detection of γ-H2AX foci in GFP-Flag-Ku80-WT and GFP-Flag-Ku80-K568R cells at different time points after irradiation; B is a statistical chart of γ-H2AX foci. γ-H2AX is a marker of DNA damage. When DNA is damaged, γ-H2AX will be phosphorylated, thereby marking the damaged DNA site and promoting the repair of DNA damage. The results showed that compared with GFP-Flag-Ku80-WT cells, the formation of γ-H2AX foci in GFP-Flag-Ku80 (K568R) cells increased significantly, especially at 8h and 12h after ionizing radiation, indicating that DNA damage still exists in the late stage after radiation, and the Ku80 K568R mutation has a greater impact on cell damage and inhibits cell repair.

[0062] (4) Detection of cell apoptosis by flow cytometry The cells were observed to be growing well under the microscope. After washing once with 1× PBS, trypsin was added for digestion and centrifugation. Then the cells were centrifuged at 1×10 4 Each well was inoculated in a 12-well plate and placed in an incubator for 12 h; Cells giving 60 Replace with fresh complete medium before Co γ-ray irradiation. 48h after 8 Gy irradiation, first use a pipette to transfer the old medium in the 12-well plate to a 1.5mL centrifuge tube, then add 300μL of trypsin to each well of the 12-well plate to digest the cells, and terminate the digestion with the corresponding old medium. Finally, use a pipette to transfer the cell suspension to a 1.5mL centrifuge tube, centrifuge at 4℃, 1500rpm for 3min; after centrifugation, add 1mL of ice 1×PBS to each well, resuspend and wash with a pipette, and centrifuge at 4℃, 1500rpm for 3min. Repeat this step twice. After the last centrifugation, discard the supernatant and add 100μL 1×Annexin V BindingBuffer to gently resuspend the cells. Then, add 2.5 μL of Annexin V-APC and 2.5 μL of 7-AAD staining solution to the cell suspension in the dark, mix gently with a pipette, and incubate at room temperature in the dark for 20 min; after the incubation, add 400 μL of diluted 1× Annexin V Binding Buffer, mix gently with a pipette, and immediately test on the instrument. 60 The Co γ-ray irradiated group served as the control.

[0063] The results are as follows Fig.15 As shown. In the figure, A is the cell apoptosis rate detected by flow cytometry; B is the statistical chart of the cell apoptosis rate, NR represents the control group, IR-48h represents the irradiation group. The experiment was repeated three times independently, and the data are expressed as mean ± standard deviation, ns represents no statistical significance, and ** represents PThe value was < 0.01. The results showed that the apoptosis rate of GFP-Flag-Ku80(K568R) cells was significantly increased after ionizing radiation treatment compared with GFP-Flag-Ku80(WT) cells, further indicating that the Ku80 K568R mutation would increase cellular DNA damage.

[0064] (5) Nude mouse tumor formation experiment The experiment was divided into 4 groups: Ku80 WT NC group, injected with GFP-Flag-Ku80 (WT) cells and not given 60 Co γ-ray irradiation group; Ku80 WT IR group, injected with GFP-Flag-Ku80 (WT) cells and given 60 Co γ-ray irradiation group; Ku80 K568RNC group, injected with GFP-Flag-Ku80(K568R) cells and not given 60 Co γ-ray irradiation group; Ku80 K568R IR group, injected with GFP-Flag-Ku80(K568R) cells and not given 60 Co γ-ray irradiation group: 5 nude mice in each group.

[0065] Prepare cells in advance and observe the cell growth and cell density under a microscope. If the cells are growing well, trypsinize the cells, centrifuge the cells (900r / min, 3min) and discard the supernatant. Add 1×PBS to wash twice, and aspirate part of the cell suspension for the last time to count the cells, so that there are 1×10 cells per 100μL of cell suspension. 6 cells and place the cell suspension on ice until use; Take the nude mice out of the SPF-grade culture environment and place them on the clean bench. Use a pipette to disperse the cell suspension before inoculation. Then use a 1mL syringe to draw up 100μL of the cell suspension and inject it subcutaneously into the middle and back of the right armpit of the nude mouse. During the inoculation process, pay attention to inserting the needle a little deeper (1cm) under the skin. After the needle is inserted, slide it left and right several times to ensure the accuracy of the inoculation part. After the injection is completed, slowly withdraw the needle to prevent the cell suspension from overflowing from the needle eye. The inoculation speed should be slightly faster to ensure the activity of the cells. After the inoculation is completed, observe the tumor growth every day; 3 days after injection, the tumor can be observed with the naked eye, and 8Gy is given 60 Co γ-rays were used to irradiate the tumor site of nude mice. After irradiation, the longest and shortest parts of the tumor were measured regularly with a vernier caliper to calculate the relative volume of the tumor. The tumor should not grow too large. When the nude mouse tumor grows to 1000mm 3 The tumor formation experiment was terminated. The nude mice were then killed by cervical dislocation, the tumors were removed, the tumor weight was measured, and photos were taken.

[0066] The results are as follows Fig.16 As shown in the figure, A is the photo of each group of tumors, B is the weight of each group of tumors, and C is the relative volume of each group of tumors; NR represents the control group, and IR represents the irradiation group. ** represents P The value was <0.01. The results showed that the therapeutic effect of ionizing radiation on Ku80K568R mutant tumors was significantly better than that on the GFP-Flag-Ku80 (WT) cell group, as shown by the significant decrease in the weight and volume of tumors after Ku80 K568R mutation, indicating that Ku80 K568R mutation inhibited tumor growth and promoted tumor radiosensitivity.

[0067] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a substance capable of causing site-directed mutation at the K568 site of Ku80 protein in an organism or cell in any of the following: (1) Preparation of products for inhibiting tumor cell proliferation; (2) Preparation of products for inhibiting DNA damage repair in tumor cells; (3) Preparation of products for treating tumors; (4) Preparation of products that improve tumor radiosensitivity; (5) Preparation of tumor chemotherapy drugs.

2. The use according to claim 1, characterized in that: The site-directed mutation at the K568 site is: the 568th position K of the Ku80 protein is mutated to R.

3. The use according to claim 2, characterized in that: The substance includes any one or more of shRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA or antisense DNA, low molecular weight compounds, peptides and antibodies.

4. The use of the K568 site of Ku80 protein in the body or cells as a target in the development of any of the following products: (1) Preparation of products for inhibiting tumor cell proliferation; (2) Preparation of products for inhibiting DNA damage repair in tumor cells; (3) Preparation of products for treating tumors; (4) Preparation of products that improve tumor radiosensitivity; (5) Preparation of tumor chemotherapy drugs.

5. The use according to any one of claims 1 to 4, characterized in that: The tumor is a tumor expressing Ku80 protein; and the tumor cells are tumor cells expressing Ku80 protein.

6. A method for inhibiting tumor cell proliferation for non-disease diagnosis or treatment purposes, characterized in that: The method comprises the following steps: causing site-directed mutation at the K568 site of the Ku80 protein in tumor cells.

7. A method for inhibiting tumor cell DNA damage repair for non-disease diagnosis or treatment purposes, characterized in that: The method comprises the following steps: causing site-directed mutation at the K568 site of the Ku80 protein in tumor cells.

8. A method for improving the radiotherapy sensitivity of tumor cells for purposes other than disease diagnosis or treatment, characterized in that: The method comprises the following steps: causing site-directed mutation at the K568 site of the Ku80 protein in tumor cells.

9. The method according to any one of claims 6 to 8, characterized in that: The site-directed mutation at the K568 site is: the 568th position K of the Ku80 protein is mutated to R.

10. The method according to any one of claims 6 to 8, characterized in that: The tumor cells are tumor cells expressing Ku80 protein.

Images