Expression of naturally secreted polypeptides without signal peptides

Abstract

The present invention relates to methods of recombinantly producing a naturally secreted polypeptide comprising the steps of: providing a microbial host cell comprising an exogenous polynucleotide encoding a naturally secreted polypeptide without a translational fusion signal peptide; the microbial host cell is cultured under conditions beneficial for expression of the polypeptide, and optionally, the polypeptide, along with microorganisms, certain polynucleotides, expression constructs, and protease substitution variants, is recovered.

Description

[0001] This application is a divisional application of a Chinese patent application filed on June 18, 2014, with application number 201480035605.2 and invention name “Expression of naturally secreted polypeptides without signal peptides”.

[0002] Reference to a sequence listing

[0003] This application contains a Sequence Listing in computer readable form. The computer readable form is incorporated herein by reference. Field of the Invention

[0004] The present invention relates to methods for the recombinant production of naturally secreted polypeptides, comprising the steps of providing a microbial host cell comprising an exogenous polynucleotide encoding a naturally secreted polypeptide without a translational fusion signal peptide; culturing the microbial host cell under conditions conducive for expression of the polypeptide, and optionally, recovering the polypeptide, along with the microorganism, certain polynucleotides, expression constructs, and protease substitution variants. Background of the Invention

[0006] A thermostable secreted protease denoted PfuS is isolated from Pyrococcus furiosus and has previously been produced using an expression DNA construct including a secretion signal, but the yield of PfuS protease is rather low (EP 0994191 A1; Takara, Japan). It is of interest to increase the expression yield of the thermostable PfuS protease from Pyrococcus furiosus so that it can be produced in sufficient quantities and with acceptable production economics in order to employ the enzyme industrially.

[0007] A thermostable secreted xylanase denoted as XynB was identified and cloned from Dictyoglomus thermophilum and recombinantly expressed in E. coli. The mature N-terminus of XynB is located downstream of a 23-amino acid leader peptide, as predicted by SignalP signal peptide analysis software and supported by multiple sequence analysis results performed with 11 xylanases from other bacterial families. The XynB leader peptide renders the enzyme toxic to E. coli. The XynB enzyme is expressed in E. coli (without the leader peptide) and recovered by cell lysis (Morris DD et al. 1998, Appl. Environ. Microbiol. 64 (5): 1759-65). The XynB enzyme has also been recombinantly expressed in a Bacillus subtilis host with its native secretion signal, but only in very low yields (Zhang et al.; Appl Biochem Biotechnol (2010) 160: 1484-1495). It would be of interest to increase the expression yield of the thermostable XynB xylanase from Dictyoglobulus thermophilus so that it can be produced in sufficient quantities and with acceptable production economics in order to be able to employ the enzyme industrially.

[0008] Bacillus host cells have been characterized as workhorses for the industrial production of various polypeptides of interest, primarily because they actively secrete polypeptides with so-called signal peptides. A signal peptide is a small polypeptide, typically about 20-30 amino acids, that is expressed as a transcriptional and translational fusion to the N-terminus of the polypeptide to be secreted. It directs the fused polypeptide into the secretory machinery of an appropriately equipped host cell, whereupon the fused polypeptide is cleaved and the now mature polypeptide of interest, without its signal peptide, is secreted into the surrounding culture fluid, the signal peptide being retained in the cell and degraded.

[0009] Secretion of a recombinantly produced polypeptide of interest in Bacillus allows for relatively easy recovery of the polypeptide directly from the culture medium without the necessity of a cell lysis step. In Bacillus, only polypeptides that are bound to be exported from the cell into the growth medium naturally possess signal peptides.

[0010] Most polypeptides in cells are not necessarily exported, but instead are originally intracellular, periplasmic, membrane-bound, etc. Such naturally non-secreted polypeptides are generally considered difficult to produce because they need to be recovered from the host cell, which often requires cumbersome cell lysis steps, making the recovery process challenging, which in turn is why naturally secreted enzymes are preferred for industrial manufacturing. SUMMARY OF THE INVENTION

[0012] To investigate the expression levels of the PfuS protease and the XynB xylanase (without the native C-terminal cellulose binding domain) in Bacillus, both enzymes were expressed as translated N-terminal fusion polypeptides with a well-known and efficient Bacillus signal peptide. However, regardless of the experimental approach used, these enzymes were expressed in the Bacillus host without any signal peptide.

[0013] Contrary to expectations, we found that the yields of both enzymes in the supernatant were higher when these enzymes were expressed without any secretory signal peptide, as demonstrated in the examples herein. This is a highly surprising result and has economic significance, as it demonstrates that PfuS-like proteases and XynB-like xylanases can be produced in Bacillus (without signal peptides) and have higher yields than when signal peptides are employed. These enzymes can be successfully recovered directly from the culture broth without the need for expensive cell lysis steps.

[0014] Thus, in a first aspect, the present invention relates to methods for the recombinant production of naturally secreted polypeptides, the methods comprising the steps of:

[0015] a) providing a microbial host cell comprising an exogenous polynucleotide encoding a naturally secreted polypeptide without a translational fusion signal peptide;

[0016] b) culturing the microbial host cell under conditions conducive to expression of the polypeptide, and optionally,

[0017] The polypeptide is recovered.

[0018] In a second aspect, the present invention relates to a recombinant microbial host cell comprising an exogenous polynucleotide encoding a native secreted polypeptide without a translational fusion signal peptide.

[0019] A third aspect of the invention relates to an isolated synthetic polynucleotide encoding a naturally secreted polypeptide without a translational fusion signal peptide, wherein the polypeptide is a protease having an amino acid sequence that is at least 80% identical to the sequence as shown at positions 1 to 413 of SEQ ID NO:8, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence as shown at positions 1 to 413 of SEQ ID NO:8; or a xylanase having an amino acid sequence that is at least 80% identical to the sequence as shown at positions 1 to 204 of SEQ ID NO:15, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence as shown at positions 1 to 204 of SEQ ID NO:15.

[0020] In a fourth aspect, the present invention relates to a nucleic acid construct or an expression vector comprising a polynucleotide as defined in any one of claims 11 to 14 operably linked to a control sequence that provides for its expression in a selected host cell.

[0021] A fifth aspect of the present invention relates to an isolated synthetic polypeptide, said polypeptide being:

[0022] a) a protease having, comprising or consisting of an amino acid sequence which is at least 80% identical to the protease shown at positions 1 to 413 of SEQ ID NO:6, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 1 to 413 of SEQ ID NO:6, wherein the protease comprises an amino acid substitution at the position corresponding to position 369 of SEQ ID NO:6; preferably the glycine at the position corresponding to position 369 of SEQ ID NO:6 is substituted with aspartic acid: G369D; or

[0023] b) a xylanase having, comprising or consisting of an amino acid sequence which is at least 80% identical to the protease shown at positions 1 to 204 of SEQ ID NO: 15, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 1 to 204 of SEQ ID NO: 15, and comprises a methionine as its first N-terminal amino acid.

[0024] A sixth aspect of the present invention relates to an isolated synthetic polypeptide, said polypeptide being:

[0025] a) a protease having, comprising or consisting of the amino acid sequence shown at positions 1 to 413 of SEQ ID NO: 8; or

[0026] b) A xylanase having, comprising or consisting of the amino acid sequence shown at positions 1 to 204 of SEQ ID NO: 15 and including a methionine as its first N-terminal amino acid.

[0027] A final aspect relates to a composition comprising a protease polypeptide as defined in the fifth or sixth aspect. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 A plasmid map of the pJA4156 plasmid from Example 4 is shown.

[0030] Figure 2 The plasmid map of the pHyGe396 plasmid from Example 4 is shown.

[0031] definition

[0032] Allelic variant: The term "allelic variant" means any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation is naturally produced by mutation and can lead to polymorphism within a population. Gene mutations can be silent (no change in the encoded polypeptide) or can encode a polypeptide with an altered amino acid sequence. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.

[0033] Coding sequence: The term "coding sequence" means a polynucleotide that directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon (such as ATG, GTG or TTG) and ends with a stop codon (such as TAA, TAG or TGA). The coding sequence can be a genomic DNA, cDNA, synthetic DNA or a combination thereof.

[0034] Control sequences: The term "control sequences" means nucleic acid sequences necessary for the expression of a polynucleotide encoding a polypeptide of the present invention. Each control sequence may be native (i.e., from the same gene) or exogenous (i.e., from a different gene) to the polynucleotide encoding the polypeptide, or native or exogenous to each other. Such control sequences include, but are not limited to, leaders, polyadenylation sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators. At a minimum, control sequences include promoters, and transcription and translation termination signals. For the purpose of introducing specific restriction sites that facilitate the connection of these control sequences to the coding region of a polynucleotide encoding a polypeptide, these control sequences may be provided with multiple linkers.

[0035] Expression: The term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0036] Expression vector: The term "expression vector" means a linear or circular DNA molecule that includes a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.

[0037] Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.

[0038] Isolated: The term "isolated" means a substance that is in a form or environment that does not occur in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance including but not limited to any enzyme, variant, nucleic acid, protein, peptide or cofactor that is at least partially removed from one or more or all of the naturally occurring components with which it is essentially associated; (3) any substance that has been artificially modified relative to the substance found in nature; or (4) any substance that has been modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).

[0039] Mature polypeptide: The term "mature polypeptide" means a polypeptide in its final form after translation and any post-translational modifications such as N-terminal processing, C-terminal truncation, etc. It is known in the art that a host cell can produce a mixture of two or more different mature polypeptides (i.e., having different C-terminal and / or N-terminal amino acids) expressed by the same polynucleotide. It is also known in the art that different host cells process polypeptides differently, and thus a host cell expressing a polynucleotide can produce a different mature polypeptide (e.g., having a different C-terminal and / or N-terminal amino acid) when compared to another host cell expressing the same polynucleotide.

[0040] Nucleic acid construct: The term "nucleic acid construct" means a single-stranded or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene, or modified in a manner that does not exist in nature to contain a nucleic acid segment, or is synthetic, and includes one or more control sequences.

[0041] Full-length polypeptide: The term "full-length polypeptide" is defined herein as a precursor form of a biologically active polypeptide, wherein the precursor comprises a signal peptide and, alternatively, a propeptide, wherein upon secretion from a cell, the signal peptide is cleaved, and, alternatively, the propeptide is also cleaved, thereby producing a biologically active polypeptide.

[0042] Signal peptide: The term "signal peptide" is defined herein as a peptide that is linked (fused) to the amino terminus of a biologically active polypeptide in a reading frame and directs the polypeptide to enter the secretory pathway of the cell. A propeptide may be present between the signal peptide and the amino terminus of the polypeptide (see definition of prepropeptide below).

[0043] Propeptide: The term "propeptide" is an amino acid sequence that is linked (fused) to the amino terminus of a polypeptide in a reading frame-compliant manner, wherein the resulting polypeptide is referred to as a proenzyme or propolypeptide (or in some cases, a zymogen). Propolypeptides are generally inactive and can be converted to mature active polypeptides by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.

[0044] Prepropeptide: The term "prepropeptide" is defined herein as a signal peptide and a propeptide present at the amino terminus of a polypeptide, wherein the propeptide is linked (or fused) to the amino terminus of the polypeptide in a manner that is in frame and the signal peptide region is linked (or fused) to the amino terminus of the propeptide region in a manner that is in frame.

[0045] Signal peptide coding sequence: The term "signal peptide coding sequence" is defined herein as a polynucleotide encoding a signal peptide.

[0046] Propeptide coding sequence: The term "propeptide coding sequence" is defined herein as a polynucleotide that encodes a propeptide.

[0047] Prepropeptide coding sequence: The term "prepropeptide coding sequence" is defined herein as a polynucleotide that encodes a prepropeptide.

[0048] Wild-type signal peptide: The term "wild-type signal peptide" refers to a signal peptide expressed by a naturally occurring microorganism, such as a yeast or a filamentous fungus found in nature.

[0049] Parent signal peptide: The term "parent signal peptide" as used herein means a signal peptide that is to be modified (e.g., one or more substitutions, one or more insertions, one or more deletions and / or one or more truncations) to produce a signal peptide variant of the present invention. The term also refers to a signal peptide with which a variant is compared and aligned. The parent may be a naturally occurring (wild-type) signal peptide, or it may even be a variant thereof prepared by any suitable means. For example, a parent signal peptide may be a variant of a naturally occurring signal peptide whose amino acid sequence has been modified or altered. A parent signal peptide may also be an allelic variant, i.e., a signal peptide encoded by any of two or more alternative forms of a polynucleotide sequence occupying the same chromosomal locus.

[0050] Wild-type prepropeptide: The term "wild-type prepropeptide" means a prepropeptide expressed by a naturally occurring microorganism, such as a yeast or filamentous fungus found in nature.

[0051] Parent prepropeptide: The term "parent prepropeptide" as used herein means a prepropeptide that is to be modified (e.g., one or more substitutions, one or more insertions, one or more deletions and / or one or more truncations) to produce a prepropeptide variant of the present invention. The term also refers to a prepropeptide with which a variant is compared and aligned. The parent may be a naturally occurring (wild-type) prepropeptide, or it may even be a variant thereof prepared by any suitable means. For example, a parent prepropeptide may be a variant of a naturally occurring prepropeptide whose amino acid sequence has been modified or altered. A parent prepropeptide may also be an allelic variant, i.e., a prepropeptide encoded by any of two or more alternative forms of a polynucleotide sequence occupying the same chromosomal locus.

[0052] Variant: The term "variant" is defined herein as a peptide or polypeptide comprising one or more (several) changes (such as substitution, insertion, deletion and / or truncation of one or more (several) specific amino acid residues at one or more (several) specific positions of the peptide or polypeptide).

[0053] Variant signal peptide: The term "variant signal peptide" is defined herein as a signal peptide of a parent signal peptide, wherein the variant signal peptide comprises one or more (several) changes, such as substitution, insertion, deletion and / or truncation of one or more (several) specific amino acid residues at one or more (several) specific positions of the signal peptide.

[0054] Variant prepropeptide: The term "variant prepropeptide" is defined herein as a prepropeptide of a parent prepropeptide, wherein the variant prepropeptide comprises one or more (several) changes, such as substitution, insertion, deletion and / or truncation of one or more (several) specific amino acid residues at one or more (several) specific positions of the prepropeptide. Operably linked: The term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide so that the control sequence directs the expression of the coding sequence.

[0055] Sequence identity: the degree of association between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity". For purposes of the present invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (preferably version 5.0.0 or later) is used to determine the sequence identity between two amino acid sequences. The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and an EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle's notation "longest identity" (obtained using the -unsimplified option) was used as the percent identity and was calculated as follows:

[0056] (number of identical residues x 100) / (length of alignment - total number of gaps in the alignment)

[0057] For purposes of the present invention, the sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) implemented in the Needleman program of the EMBOSS package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, supra) (preferred 5.0.0 version or updated version). The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of the "longest consistency" annotated by Needleman (obtained using the -non-simplified option) is used as a percentage consistency, and is calculated as follows:

[0058] (Number of identical DNA nucleotides x 100) / (Alignment length - Total number of gaps in the alignment)

[0059] Variant: The term "variant" means a polypeptide having enzymatic activity and comprising an alteration (i.e., substitution, insertion, and / or deletion) at one or more (e.g., several) positions compared to its parent wild-type or reference amino acid sequence. Substitution means replacing the amino acid occupying a position with a different amino acid; deletion means removing the amino acid occupying a position; and insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position.

[0060] Variants of mature polypeptides may include substitutions, deletions and / or insertions at one or more (e.g., several) positions. The number of amino acid substitutions, deletions and / or insertions introduced into mature polypeptides may be up to 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. These amino acid changes may be of a minor nature, i.e., conservative amino acid substitutions or insertions that do not significantly affect the folding and / or activity of the protein; small deletions, typically 1-30 amino acids; small amino-terminal or carboxyl-terminal extensions, such as amino-terminal methionine residues; small connecting peptides of up to 20-25 residues; or small extensions that facilitate purification by changing the net charge or another function, such as a polyhistidine stretch, an antigenic epitope or a binding domain.

[0061] Examples of conservative substitutions are within the group consisting of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine) and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that generally do not alter specific activity are known in the art and are described, for example, by H. Neurath and RL Hill, 1979 in The Proteins, Academic Press, New York. Common substitutions are Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Tyr / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly.

[0062] Alternatively, the amino acid change has such a property that the physicochemical properties of the polypeptide are changed. For example, the amino acid change can increase the thermal stability of the polypeptide, change the substrate specificity, change the optimal pH, etc.

[0063] Essential amino acids in a polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resulting mutant molecules are tested for enzyme activity to identify amino acid residues that are critical for the activity of the molecule. See also, Hilton et al., 1996, J. Biol. Chem. 271: 4699-4708. Mutations in putative contact site amino acids can also be combined with physical analysis of the structure, such as determined by techniques such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, to determine the active site of the enzyme or other biological interactions. See, e.g., de Vos et al., 1992, Science 255:306-312; Smith et al., 1992, J. Mol. Biol. 224:899-904; Wlodaver et al., 1992, FEBS Lett. 309:59-64. Essential amino acids can also be identified by inference from alignments with related polypeptides.

[0064] Single or multiple amino acid substitutions, deletions and / or insertions can be made and tested using known methods of mutagenesis, recombination and / or shuffling, followed by relevant screening procedures, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241:53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86:2152-2156; WO 95 / 17413; or WO 95 / 22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991, Biochemistry 30: 10832-10837; U.S. Pat. No. 5,223,409; WO 92 / 06204), and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner et al., 1988, DNA 7: 127).

[0065] Mutagenesis / shuffling methods can be combined with high-throughput automated screening methods to detect the activity of cloned, mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17:893-896). Mutagenized DNA molecules encoding active polypeptides can be recovered from host cells and rapidly sequenced using standard methods in the art. These methods allow the importance of individual amino acid residues in a polypeptide to be rapidly determined.

[0066] Fusion polypeptide: The polypeptide of interest may be a hybrid polypeptide in which a region of one polypeptide is fused at the N-terminus or C-terminus of a region of another polypeptide.

[0067] The polypeptide can be a fusion polypeptide or a cleavable fusion polypeptide, wherein another polypeptide is fused at the N-terminus or C-terminus of the polypeptide of the present invention. Fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide of the present invention. The technology for producing fusion polypeptides is known in the art, and includes connecting the coding sequence of the encoded polypeptide so that they are in frame and the expression of the fusion polypeptide is under the control of the same one or more promoters and terminators. Fusion polypeptides can also be constructed using intein technology, wherein the fusion polypeptide is produced after translation (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779).

[0068] The fusion polypeptide may further include a cleavage site between the two polypeptides. When the fusion protein is secreted, the site is cleaved, thereby releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, those disclosed in the following literature: Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3:568-576; Svetina et al., 2000, J. Biotechnol. 76:245-251; Rasmussen-Wilson et al., 1997, Appl. Environ. Microbiol. 63:3488-3493; Ward ...3:568-576; Svetina et al., 2000, J. Biotechnol. 3:568-576; Svetina et al. d) et al., 1995, Biotechnology 13:498-503; and Contreras et al., 1991, Biotechnology 9:378-381; Eaton et al., 1986, Biochemistry 25:505-512; Collins-Racie et al., 1995, Biotechnology 13:982-987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6:240-248; and Stevens, 2003, Drug Discovery World 4:35-48. DETAILED DESCRIPTION OF THE INVENTION

[0070] Polynucleotide

[0071] The present invention relates to isolated synthetic polynucleotides encoding naturally secreted proteases or xylanases without a secretion signal, wherein the polypeptide is a protease having, comprising or consisting of an amino acid sequence that is at least 80% identical to the sequence shown at positions 1 to 413 of SEQ ID NO:8; preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the protease shown at positions 1 to 413 of SEQ ID NO:8; or the polypeptide is a xylanase having, comprising or consisting of an amino acid sequence that is at least 80% identical to the sequence shown at positions 1 to 413 of SEQ ID NO:8; preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the protease shown at positions 1 to 413 of SEQ ID NO:8. The proteases shown at positions 1 to 204 of NO:15 are at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical.

[0072] In a preferred embodiment, the polynucleotide of the present invention has, includes or consists of a nucleotide sequence that is at least 80% identical to the sequence shown at positions 1 to 1569 of SEQ ID NO:7; preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 1 to 1569 of SEQ ID NO:7; more preferably, the polynucleotide of the present invention has, includes or consists of a nucleotide sequence that is at least 80% identical to the sequence shown at positions 331 to 1569 of SEQ ID NO:7; still more preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 331 to 1569 of SEQ ID NO:7.

[0073] In another preferred embodiment, the polynucleotide of the present invention has, comprises or consists of the following nucleotide sequence, which is at least 80% identical to the sequence shown at positions 1 to 612 of SEQ ID NO:14, and preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 1 to 612 of SEQ ID NO:14.

[0074] The techniques for isolating or cloning polynucleotides are known in the art and include isolating from genomic DNA or cDNA, or a combination thereof. Cloning of polynucleotides from genomic DNA can be achieved, for example, by detecting cloned DNA fragments with common structural features using well-known polymerase chain reaction (PCR) or antibody screening of expression libraries. See, for example, Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification programs such as ligase chain reaction (LCR), ligation activated transcription (LAT) and polynucleotide-based amplification (NASBA) can be used. These polynucleotides can be cloned by Pyrococcus strains or related organisms, and therefore, for example, can be alleles or species variants of the polypeptide coding region of the polynucleotide.

[0075] Modification of the polynucleotide encoding the polypeptide of the present invention may be necessary for synthesizing a polypeptide substantially similar to the polypeptide. The term "substantially similar" to the polypeptide refers to a non-naturally occurring form of the polypeptide. These polypeptides may be different from the polypeptides isolated from their natural sources in a certain engineered manner, such as variants that are different in terms of specific activity, thermostability, optimal pH, etc. These variants can be based on polynucleotides presented in the form of a mature polypeptide coding sequence (e.g., a subsequence thereof) of SEQ ID NO: 1, and / or by introducing nucleotide substitutions that do not change the amino acid sequence of the polypeptide, but correspond to the codons used by the host organisms intended to produce the enzyme, or by introducing nucleotide substitutions that may produce different amino acid sequences to construct. For a general description of nucleotide substitutions, see, for example, Ford et al., 1991, Protein Expression and Purification 2: 95-107.

[0076] Sources of polynucleotides

[0077] The polynucleotide encoding the protease of the present invention can be obtained from microorganisms of any genus. For the purposes of the present invention, the term "obtained from" as used herein in conjunction with a given source should mean that the polypeptide encoded by the polynucleotide is produced by the source or by a strain into which the polynucleotide from the source has been inserted.

[0078] The polynucleotide may be a bacterial polynucleotide. For example, the polynucleotide may be a Gram-positive bacterial polynucleotide encoding a secreted polypeptide having protease activity, such as Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, or Streptomyces. or a gram-negative bacterial polynucleotide, such as a Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Ilyobacter, Neisseria, Pseudomonas, Salmonella or Ureaplasma polynucleotide.

[0079] In one aspect, a polynucleotide of the invention is derived from an extreme thermophilic anaerobic bacterium, such as from the phylum Dictyoglossum, including Dictyoglossum thermophilum.

[0080] In another aspect, the polynucleotide is a Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, or Bacillus thuringiensis polynucleotide.

[0081] In another aspect, the polynucleotide is a Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, or Streptococcus equi subsp. Zooepidemicus polynucleotide.

[0082] In another aspect, the polynucleotide is a Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, or Streptomyces lividans polynucleotide.

[0083] In another aspect, the polynucleotide is a Pyrococcus polynucleotide; preferably a Pyrococcus furiosus polynucleotide.

[0084] The polynucleotide may be a fungal polynucleotide. For example, the polynucleotide may be a yeast polynucleotide, such as a Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia polypeptide;or a filamentous fungal polypeptide, such as Acremonium, Agaricus, Alternaria, Aspergillus, Aureobasidium, Botryospaeria, Ceriporiopsis, Chaetomidium, Chrysosporium, Claviceps, Cochliobolus, Coprinopsis, Coptotermes ptotermes), Corynascus, Cryphonectria, Cryptococcus, Diplodia, Exidia, Filibasidium, Fusarium, Gibberella, Holomastigotoides, Humicola, Irpex, Lentinula, Leptospaeria, Pyricularia Magnaporthe, Melanocarpus, Meripilus, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Piromyces, Poitrasia, Pseudoplectania, Pseudoplectania otrichonympha), Rhizomucor, Schizophyllum, Scytalidium, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trichoderma, Trichophaea, Verticillium, Volvariella, or Xylaria polynucleotides. ;

[0085] In another aspect, the polynucleotide is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, or Saccharomyces oviformis polynucleotide.

[0086] In another aspect, the polynucleotide is Acremonium cellulolyticus, Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum), Chrysosporium tropicum, Chrysosporium zonatum, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum), Fusarium torulosum, Fusariumtrichothecioides, Fusarium venenatum, Humicola grisea, Humicola insolens, Humicola lanuginosa, Irpex lacteus, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium funiculosum, Penicillium purpurogenum, Phanerochaete chrysosporium, Thielavia achromatica, Thielavia albomyces, Thielavia albopilosa, Thielavia australeinsis, Thielavia fimeti, Thielavia microspora, Thielavia ovispora, Thielavia peruviana, Thielavia setosa, Thielavia spededonium, Thielavia subthermophila, Thielavia terrestris, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride polynucleotides.

[0087] It will be understood that for the above-mentioned species, the present invention encompasses both perfect and imperfect states, as well as other taxonomic equivalents, such as anamorphs, regardless of the species name by which they are known. One of ordinary skill in the art will readily recognize the identity of appropriate equivalents.

[0088] Strains of these species are readily available to the public at many culture collections, such as the American Type Culture Collection (ATCC), the German Collection of Microorganisms (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, DSMZ), the Netherlands Type Culture Collection (Centraalbureau Voor Schimmelcultures, CBS), and the Northern Regional Research Center (NRRL) of the Agricultural Research Service Type Collection (ARS).

[0089] The polynucleotide can be identified and obtained from other sources, including microorganisms isolated from nature (e.g., soil, compost, water, etc.) or DNA samples directly obtained from natural materials (e.g., soil, compost, water, etc.). The technology for directly isolating microorganisms and DNA from natural living environments is well known in the art. A polynucleotide can then be obtained by similarly screening in a genomic DNA or cDNA library of another microorganism or mixed DNA sample. Once a polynucleotide is detected, the polynucleotide can be isolated or cloned using technology known to those of ordinary skill in the art (see, for example, Sambrook et al., 1989, supra).

[0090] Nucleic acid construct

[0091] The present invention also relates to nucleic acid constructs comprising a polynucleotide of the present invention operably linked to one or more control sequences which direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

[0092] The polynucleotide can be manipulated in various ways to provide expression of the polypeptide. Depending on the expression vector, manipulation of the polynucleotide prior to its insertion into the vector may be desirable or necessary. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.

[0093] The control sequence can be a promoter, i.e., a polynucleotide that is recognized by the host cell to express a polynucleotide encoding a polypeptide of the present invention. The promoter comprises transcription control sequences that mediate the expression of the polypeptide. The promoter can be any polynucleotide that exhibits transcriptional activity in the host cell, including mutant, truncated and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides that are homologous or heterologous to the host cell. In some aspects, the promoter is a heterologous promoter.

[0094] Examples of suitable promoters for directing transcription of the nucleic acid constructs of the invention in a bacterial host cell are promoters obtained from the following genes: Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus licheniformis penicillinase gene (penP), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus subtilis levansucrase gene (sacB), Bacillus subtilis xylA and xylB genes, Bacillus thuringiensis cryIIIA gene (Agaisse and Lereclus, 1994, Molecular Microbiology). coli lac operon, the E. coli trc promoter (Egon et al., 1988, Gene 69:301-315), the Streptomyces coelicolor agar hydrolase gene (dagA), and the prokaryotic β-lactamase gene (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. USA 75:3727-3731), and the tac promoter (DeBoer et al., 1983, Proc. Natl. Acad. Sci. USA 80:21-25). Other promoters are described in Gilbert et al., 1980, "Useful proteins from recombinant bacteria", Scientific American 242:74-94; and in Sambrook et al., 1989, supra. Examples of tandem promoters are disclosed in WO 99 / 43835.

[0095] The control sequence can also be a transcription terminator recognized by the host cell to terminate transcription. The terminator is operably linked to the 3'-end of the polynucleotide encoding the polypeptide. Any terminator that works in the host cell can be used in the present invention.

[0096] Preferred terminators for bacterial host cells are obtained from the genes for Bacillus clausii alkaline protease (aprH), Bacillus licheniformis alpha-amylase (amyL), and Escherichia coli ribosomal RNA (rrnB).

[0097] The control sequence may also be an mRNA stabilizer region downstream of the promoter and upstream of the coding sequence of a gene, which increases the expression of the gene.

[0098] Examples of suitable mRNA stabilizer regions are obtained from the Bacillus thuringiensis cryIIIA gene (WO94 / 25612) and the Bacillus subtilis SP82 gene (Hue et al., 1995, Journal of Bacteriology 177: 3465-3471).

[0099] The control sequence can also be a propeptide coding sequence encoding a propeptide located at the N-terminal end of a polypeptide. The polypeptide generated is referred to as a proenzyme or propolypeptide (or in some cases as a zymogen). Propolypeptide is usually inactive and can be converted into an active polypeptide from the propeptide of propolypeptide by catalytic cleavage or autocatalytic cleavage. The propeptide coding sequence can be obtained from the following genes: Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), thermophilic myceliophthora laccase (WO 95 / 33836), Rhizomucor miehei aspartic protease and Saccharomyces cerevisiae α-factor.

[0100] It may also be desirable to add regulatory sequences that regulate the expression of the polypeptide relative to the growth of the host cell. Examples of regulatory sequences are those that turn the expression of the gene on or off in response to chemical or physical stimuli, including the presence of regulatory compounds. Regulatory sequences in prokaryotic systems include lac, tac, and trp operator systems. Other examples of regulatory sequences are those that allow gene amplification.

[0101] Expression vector

[0102] The present invention further relates to a recombinant expression vector comprising a polynucleotide of the present invention, a promoter, and a transcription and translation termination signal. Different nucleotides and control sequences can be linked together to produce a recombinant expression vector, and this recombinant expression vector can include one or more convenient restriction enzyme sites to allow the polynucleotides encoding the variant to be inserted or replaced at these sites. Alternatively, the polynucleotides can be expressed by inserting the polynucleotides or a nucleic acid construct comprising the polynucleotides into a suitable vector for expression. When producing the expression vector, the encoding sequence is located in the vector so that the encoding sequence is operably connected to the suitable control sequence for expression.

[0103] The recombinant expression vector can be any vector (e.g., plasmid or virus) that can be easily subjected to recombinant DNA procedures and can cause the expression of the polynucleotide. The choice of vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.

[0104] The vector can be an autonomously replicating vector, that is, a vector existing as an extrachromosomal entity, which replicates independently of chromosome replication, for example, a plasmid, an extrachromosomal element, a minichromosome or an artificial chromosome. The vector can include any element to ensure self-replication. Alternatively, the vector can be a vector that, when introduced into the host cell, is integrated into the genome and replicates with one or more chromosomes into which it has been integrated. In addition, a single vector or plasmid or two or more vectors or plasmids (these vectors or plasmids contain the total DNA to be introduced into the genome of the host cell together) or a transposon can be used.

[0105] The vector preferably contains one or more selectable markers that permit easy selection of transformed cells, transfected cells, transduced cells, etc. A selectable marker is a gene whose product provides biocide or viral resistance, heavy metal resistance, prototrophy of auxotrophs, etc.

[0106] Examples of bacterial selectable markers are the Bacillus licheniformis or Bacillus subtilis dal genes, or markers that confer antibiotic resistance, such as ampicillin, chloramphenicol, kanamycin, neomycin, spectinomycin, or tetracycline resistance.

[0107] The vector preferably contains one or more elements that permit integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.

[0108] For being integrated into the host cell genome, the vector can rely on the polynucleotide sequence encoding the polypeptide or any other element of the vector for being integrated into the genome by homologous or non-homologous recombination.Alternately, the vector can include other polynucleotides for guiding one or more accurate positions of one or more chromosomes integrated into the host cell genome by homologous recombination.In order to increase the possibility of integration at the accurate position, the elements of these integrations should include a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs and 800 to 10,000 base pairs, which have a high degree of sequence identity with the corresponding target sequence to improve the possibility of homologous recombination.These integration elements can be any sequence homologous to the target sequence in the genome of the host cell.In addition, these integration elements can be non-coding polynucleotides or encoding polynucleotides.On the other hand, the vector can be integrated into the genome of the host cell by non-homologous recombination.

[0109] For autonomous replication, the vector may further include an origin of replication that enables the vector to replicate autonomously in the host cell in question. The origin of replication can be any plasmid replicon that mediates autonomous replication that functions in the cell. The term "origin of replication" or "plasmid replicon" means a polynucleotide that enables a plasmid or vector to replicate in vivo.

[0110] Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting replication in E. coli and the origins of replication of plasmids pUB110, pE194, pTA1060, and pAMβ1 permitting replication in Bacillus.

[0111] More than one copy of the polynucleotide of the present invention can be inserted into a host cell to increase the production of a polypeptide. The increased copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by comprising an amplifiable selectable marker gene together with the polynucleotide, wherein cells comprising an amplified copy of the selectable marker gene and thus additional copies of the polynucleotide can be selected by culturing the cell in the presence of an appropriate selective agent.

[0112] The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to those skilled in the art (see, e.g., Sambrook et al., 1989, supra).

[0113] Host cells

[0114] The present invention also relates to recombinant host cells comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the production of a polypeptide of the present invention, wherein the host cell is capable of producing a polypeptide of the present invention.

[0115] The construct or vector comprising the polynucleotide is introduced into a host cell so that the construct or vector is maintained as a chromosomal integrant or as an autonomously replicating extrachromosomal vector, as described earlier. The term "host cell" encompasses any progeny of a parent cell that differs from the parent cell due to mutations that occur during replication. The choice of a host cell depends largely on the gene encoding the polypeptide and its source.

[0116] The host cell can be bacterial, for example it can be prokaryotic, preferably any gram-positive bacteria or gram-negative bacteria. Gram-positive bacteria include but are not limited to: Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Ocean Bacillus, Staphylococcus, Streptococcus and Streptomyces. Gram-negative bacteria include but are not limited to: Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Silvae, Neisseria, Pseudomonas, Salmonella and Ureaplasma.

[0117] The prokaryotic host cell can be any Bacillus cell, including but not limited to Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus fluorescens, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus brevis, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis cells.

[0118] The host cell may also be any Streptococcus cell, including but not limited to Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, and Streptococcus equi subsp. Zooepidemicus cells.

[0119] The host cell may also be any Streptomyces cell, including but not limited to Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, and Streptomyces lividans cells.

[0120] Introduction of DNA into Bacillus cells can be accomplished by protoplast transformation (see, e.g., Chang and Cohen, 1979, Mol. Gen. Genet. 168: 111-115), competent cell transformation (see, e.g., Young and Spizizen, 1961, J. Bacteriol. 81: 823-829; or Dubnau and Davidow, 1986). The introduction of DNA into E. coli cells can be achieved by protoplast transformation (see, e.g., Hanahan, 1983, J. Mol. Biol. 166:557-580) or electroporation (see, e.g., Dower et al., 1988, Nucleic Acids Res. 16:6127-6145). Introduction of DNA into Streptomyces cells can be achieved by protoplast transformation, electroporation (see, e.g., Gong et al., 2004, Folia Microbiol. (Praha) 49:399-405), conjugation (see, e.g., Mazodier et al., 1989, J. Bacteriol. 171:3583-3585), or transduction (see, e.g., Burke et al., 2001, Proc. Natl. Acad. Sci. USA 98:6289-6294). Introduction of DNA into Pseudomonas cells can be achieved by electroporation (see, e.g., Choi et al., 2006, J. Microbiol. Methods 64:391-397) or conjugation (see, e.g., Pinedo and Smets, 2005, Appl. Environ. Microbiol. 71:51-57).DNA is introduced into Streptococcus cells and can be achieved by: natural competence (see, for example, Perry and Kuramitsu, 1981, Infect.Immun. 32: 1295-1297), protoplast transformation (see, for example, Catt and Jollick, 1991, Microbios 68: 189-207), electroporation (see, for example, Buckley et al., 1999, Appl. Environ. Microbiol. 65: 3800-3804), or conjugation (see, for example, Clewell, 1981, Microbiology Review 45: 409-436). However, any method known in the art for introducing DNA into host cells can be used.

[0121] In a preferred embodiment of the second aspect of the present invention, a recombinant microbial host cell comprises an exogenous polynucleotide encoding a native secreted polypeptide without a translational fusion signal peptide.

[0122] Preferably, the microbial host cell is a prokaryotic host cell, preferably a Gram-positive host cell, more preferably a Bacillus host cell, and most preferably, the host cell is selected from the group consisting of Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus radiata, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus brevis, Bacillus stearothermophilus, Bacillus subtilis and Bacillus thuringiensis.

[0123] Preferably, the polypeptide is a homologous or heterologous enzyme, preferably, the enzyme is selected from the group consisting of a hydrolase, an isomerase, a ligase, a lyase, an oxidoreductase or a transferase; more preferably, the enzyme is an α-galactosidase, α-glucosidase, an aminopeptidase, an amylase, an asparaginase, a β-galactosidase, a β-glucosidase, a β-xylosidase, a carbohydrase, a carboxypeptidase, a catalase, a cellobiohydrolase, a cellulase, a chitinase, a cutinase, a cyclodextrin glycosyltransferase, a deoxyribonuclease, an endoglucanase, an esterase, a green fluorescent protein, a glucanotransferase, a glucoamylase, an invertase, a laccase, a lipase, a mannosidase, a mutanase, an oxidase, a pectinolytic enzyme, a peroxidase, a phytase, a polyphenol oxidase, a proteolytic enzyme, a ribonuclease, a transglutaminase, or a xylanase.

[0124] Furthermore, it is preferred that the polypeptide is:

[0125] a) a protease polypeptide comprising or consisting of an amino acid sequence that is at least 80% identical to the sequence shown at positions 1 to 413 of SEQ ID NO:8, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 1 to 413 of SEQ ID NO:8; or

[0126] b) a xylanase polypeptide comprising or consisting of an amino acid sequence that is at least 80% identical to the sequence shown at positions 1 to 204 of SEQ ID NO: 15, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 1 to 204 of SEQ ID NO: 15.

[0127] Still more preferably, the polypeptide is:

[0128] a) a protease encoded by a polynucleotide comprising or consisting of a nucleotide sequence that is at least 80% identical to the sequence as shown at positions 1 to 1569 of SEQ ID NO:7, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence as shown at positions 1 to 1569 of SEQ ID NO:7; or preferably at least 80% identical to the sequence as shown at positions 331 to 1569 of SEQ ID NO:7, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence as shown at positions 331 to 1569 of SEQ ID NO:7, or

[0129] b) a xylanase encoded by a polynucleotide comprising or consisting of a nucleotide sequence that is at least 80% identical to the sequence shown at positions 1 to 612 of SEQ ID NO: 14, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 1 to 612 of SEQ ID NO: 14.

[0130] Production method

[0131] The present invention also relates to various methods for recombinantly producing naturally secreted polypeptides, the methods comprising the steps of:

[0132] a) providing a microbial host cell comprising an exogenous polynucleotide encoding a naturally secreted polypeptide without a translational fusion signal peptide;

[0133] b) culturing the microbial host cell under conditions conducive to expression of the polypeptide, and optionally,

[0134] The polypeptide is recovered.

[0135] These host cells are cultured in a nutrient medium suitable for producing the polypeptide using methods known in the art. For example, shake flask culture can be performed in a suitable medium and under conditions allowing expression and / or separation of the polypeptide, or small-scale or large-scale fermentation (including continuous, batch, batch feed, or solid-state fermentation) can be performed in a laboratory or industrial fermenter to culture cells. The culture is to use a program known in the art, and occurs in a suitable nutrient medium, which includes carbon and nitrogen sources and inorganic salts. Suitable medium can be obtained from commercial suppliers or can be prepared according to disclosed compositions (for example, in the catalog of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be directly recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from the cell lysate.

[0136] The polypeptide can be detected using methods known in the art that are specific for the polypeptide. These detection methods include, but are not limited to, the use of specific antibodies, the formation of an enzyme product, or the disappearance of an enzyme substrate. For example, an enzyme assay can be used to determine the activity of the polypeptide.

[0137] The polypeptide can be recovered using methods known in the art. For example, the polypeptide can be recovered from the nutrient medium by conventional procedures, including but not limited to, collection, centrifugation, filtration, extraction, spray drying, evaporation or precipitation. In one aspect, the fermentation broth comprising the polypeptide is recovered.

[0138] The polypeptide may be purified by a variety of procedures known in the art to obtain a substantially pure polypeptide, including, but not limited to, chromatography (e.g., ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, chromatofocusing, and size exclusion chromatography), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, Janson and Ryden, eds., VCH Publishers, New York, 1989).

[0139] In an alternative aspect, the polypeptide is not recovered, but rather a host cell of the invention expressing the polypeptide is used as a source of the polypeptide.

[0140] Preferably, the microorganism is a prokaryotic host cell, preferably a Gram-positive host cell, more preferably a Bacillus host cell, and most preferably, the host cell is selected from the group consisting of Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus radiata, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus brevis, Bacillus stearothermophilus, Bacillus subtilis and Bacillus thuringiensis.

[0141] Preferably, the polypeptide is a homologous or heterologous enzyme, preferably, the enzyme is selected from the group consisting of a hydrolase, an isomerase, a ligase, a lyase, an oxidoreductase or a transferase; more preferably, the enzyme is an α-galactosidase, α-glucosidase, an aminopeptidase, an amylase, an asparaginase, a β-galactosidase, a β-glucosidase, a β-xylosidase, a carbohydrase, a carboxypeptidase, a catalase, a cellobiohydrolase, a cellulase, a chitinase, a cutinase, a cyclodextrin glycosyltransferase, a deoxyribonuclease, an endoglucanase, an esterase, a green fluorescent protein, a glucanotransferase, a glucoamylase, an invertase, a laccase, a lipase, a mannosidase, a mutanase, an oxidase, a pectinolytic enzyme, a peroxidase, a phytase, a polyphenol oxidase, a proteolytic enzyme, a ribonuclease, a transglutaminase, or a xylanase.

[0142] In a preferred method of the first aspect, the polypeptide is:

[0143] a) a protease polypeptide comprising or consisting of an amino acid sequence that is at least 80% identical to the sequence shown at positions 1 to 413 of SEQ ID NO:8, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 1 to 413 of SEQ ID NO:8, or

[0144] b) a xylanase polypeptide comprising or consisting of an amino acid sequence that is at least 80% identical to the sequence shown at positions 1 to 204 of SEQ ID NO: 15, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 1 to 204 of SEQ ID NO: 15.

[0145] In another preferred embodiment of the first aspect, the polypeptide is:

[0146] a) a protease encoded by a polynucleotide comprising or consisting of a nucleotide sequence that is at least 80% identical to the sequence shown at positions 1 to 1569 of SEQ ID NO:7, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 1 to 1569 of SEQ ID NO:7; or preferably at least 80% identical to the sequence shown at positions 331 to 1569 of SEQ ID NO:7, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 331 to 1569 of SEQ ID NO:7; or

[0147] b) a xylanase encoded by a polynucleotide comprising or consisting of a nucleotide sequence that is at least 80% identical to the sequence shown at positions 1 to 612 of SEQ ID NO: 14, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 1 to 612 of SEQ ID NO: 14.

[0148] Peptides with protease activity

[0149] In a preferred embodiment, the isolated synthetic protease polypeptide has, comprises or consists of an amino acid sequence that is at least 80% identical to the protease shown at positions 1 to 413 of SEQ ID NO:6, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 1 to 413 of SEQ ID NO:6, wherein the protease comprises an amino acid substitution at the position corresponding to position 369 of SEQ ID NO:6; preferably the glycine at the position corresponding to position 369 of SEQ ID NO:6 is substituted with aspartic acid: G369D.

[0150] In one embodiment, the present invention relates to an isolated synthetic protease polypeptide having, including, or consisting of the amino acid sequence shown in positions 1 to 413 of SEQ ID NO: 8 or a fragment thereof having protease activity.

[0151] In a preferred embodiment, the isolated synthetic protease polypeptide of the present invention is a substitution variant of the mature PfuS protease shown in positions 1 to 413 of SEQ ID NO: 6, wherein the glycine at position 369 is substituted with aspartic acid: G369D.

[0152] Polypeptides having xylanase activity

[0153] In a preferred embodiment, the isolated synthetic polypeptide of the invention is a xylanase having, comprising or consisting of an amino acid sequence that is at least 80% identical to the protease shown at positions 1 to 204 of SEQ ID NO: 15, preferably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence shown at positions 1 to 204 of SEQ ID NO: 15, and includes a methionine as its first N-terminal amino acid.

[0154] In one embodiment, the present invention relates to an isolated synthetic xylanase polypeptide having, comprising, or consisting of the amino acid sequence shown in positions 1 to 204 of SEQ ID NO: 15 or a fragment thereof having xylanase activity, and comprising a methionine as its first N-terminal amino acid.

[0155] In a preferred embodiment, the isolated synthetic protease polypeptide of the present invention is a substitution variant of the mature PfuS protease shown in positions 1 to 413 of SEQ ID NO: 6, wherein the glycine at position 369 is substituted with aspartic acid: G369D.

[0156] Enzyme composition

[0157] The present invention also relates to compositions comprising a specific protease polypeptide of the present invention. Preferably, these compositions are enriched in this polypeptide. The term "enriched" indicates that the protease activity of the composition has been increased, for example, by an enrichment factor of at least 1.1.

[0158] These compositions may comprise the polypeptide of the present invention as the major enzyme component, eg, a monocomponent composition. Alternatively, the compositions may include multiple enzyme activities, such as one or more (e.g., several) enzymes selected from the group consisting of a hydrolase, an isomerase, a ligase, a lyase, an oxidoreductase or a transferase; more preferably, the enzyme is an α-galactosidase, α-glucosidase, an aminopeptidase, an amylase, an asparaginase, a β-galactosidase, a β-glucosidase, a β-xylosidase, a carbohydrase, a carboxypeptidase, a catalase, a cellobiohydrolase, a cellulase, a chitinase, a cutinase, a cyclodextrin glycosyltransferase, a deoxyribonuclease, an endoglucanase, an esterase, a green fluorescent protein, a glucanotransferase, a glucoamylase, an invertase, a laccase, a lipase, a mannosidase, a mutanase, an oxidase, a pectinolytic enzyme, a peroxidase, a phytase, a polyphenol oxidase, a proteolytic enzyme, a ribonuclease, a transglutaminase, or a xylanase.

[0159] Further compositions of proteases suitable for the present invention are described in WO 2013 / 082486, the contents of which are incorporated herein by reference.

[0160] These compositions can be prepared according to methods known in the art and can be in the form of liquid or dry compositions. These compositions can be stabilized according to methods known in the art.

[0161] In a preferred embodiment, the present invention relates to a composition comprising a protease polypeptide as defined above in the section entitled "Polypeptide having protease activity".

[0162] Fermentation broth preparation or cell composition

[0163] The present invention also relates to a fermentation broth preparation or cell composition comprising the polypeptide of the present invention. The fermentation broth product further includes other ingredients used in the fermentation process, such as, for example, cells (including host cells containing genes encoding the polypeptide of the present invention, which are used to produce the polypeptide of interest), cell debris, biomass, fermentation medium and / or fermentation product. In certain embodiments, the composition is a cell-killed full culture broth containing one or more organic acids, killed cells and / or cell debris and culture medium.

[0164] The term "fermented liquid" as used herein refers to a preparation produced by cell fermentation, not experiencing or experiencing minimum recovery and / or purification. For example, when the microbial culture grows to saturation, hatches under carbon restriction conditions to allow protein synthesis (for example, by host cells to express enzymes) and secreted into the cell culture medium, produces fermented liquid. Fermented liquid can be included in the unfractionated or graded content of the fermented material obtained when the fermentation ends. Typically, fermented liquid is unfractionated and includes spent culture medium and, for example, cell debris present after centrifugal removal of microbial cells (for example, filamentous fungal cells). In certain embodiments, fermented liquid comprises spent cell culture medium, extracellular enzymes and vigorous and / or inactive microbial cells.

[0165] In one embodiment, the fermentation broth formulation and cell composition include a first organic acid component (including at least one 1-5 carbon organic acid and / or its salt) and a second organic acid component (including at least one 6 carbon or more carbon organic acid and / or its salt). In a specific embodiment, the first organic acid component is acetic acid, formic acid, propionic acid, a salt thereof, or a mixture of two or more of the foregoing acids; and the second organic acid component is benzoic acid, cyclohexanecarboxylic acid, 4-methylpentanoic acid, phenylacetic acid, a salt thereof, or a mixture of two or more of the foregoing acids.

[0166] In one aspect, the composition comprises one or more organic acids, and optionally further comprises killed cells and / or cell debris. In one embodiment, these killed cells and / or cell debris are removed from the whole culture fluid of cell killing to provide a composition without these components.

[0167] The fermentation broth formulations or cell compositions may further comprise a preservative and / or antimicrobial (eg, bacteriostatic) agent, including but not limited to sorbitol, sodium chloride, potassium sorbate, and other agents known in the art.

[0168] The full culture fluid of this cell killing or compositions can be included in the unfractionated content of the fermentation material that obtains when fermentation stops.Typically, the full culture fluid of this cell killing or compositions comprise spent substratum and grow to saturation at microbial cells (for example, filamentous fungal cells), hatch under carbon restriction conditions to allow the cell debris that exists after protein synthesis.In certain embodiments, the full culture fluid of cell killing or compositions contain spent cell culture medium, extracellular enzyme and the filamentous fungal cells that kill.In certain embodiments, methods known in the art can be used to make the microbial cells that exist in the full culture fluid of cell killing or compositions permeabilization and / or cracking.

[0169] The whole culture fluid or cell composition described herein is typically liquid, but may contain insoluble components, such as killed cells, cell debris, culture medium components, and / or one or more insoluble enzymes. In some embodiments, insoluble components may be removed to provide a clarified liquid composition.

[0170] The whole culture broth formulation and cell composition of the present invention can be produced by the method described in WO 90 / 15861 or WO 2010 / 096673.

[0171] The following examples are provided by way of illustration and are not intended to limit the invention.

[0172] Examples

[0173] Example 1 Cloning and expression of PfuS protease from Pyrococcus furiosus ATCC 43587 / DSM 3638

[0174] The protease PfuS from Pyrococcus furiosus has been described as a thermostable protease (Appl. Environ. Microbiol., 56:1992-1998 (1990); FEMS Microbiol. Letters, 71:17-20 (1990); J. Gen. Microbiol., 137:1193-1199 (1991)). Recombinant expression of the PfuS protease has been previously shown in a Bacillus subtilis host organism, but the expression level was very low (EP 0994191 A1; Takara Bio (Japan)).

[0175] Here we describe a novel method for producing PfuS protease using a recombinant cloning and expression construct lacking the native signal peptide of PfuS or any other signal peptide. When this construct is expressed in Bacillus host cells, unexpectedly high enzyme yields are obtained.

[0176] The DNA sequence encoding the native PfuS protease is shown in SEQ ID NO: 1 and the amino acid sequence of the PfuS protease is shown in SEQ ID NO: 2 (UNIPROT: Q8U0C9).

[0177] A synthetic coding sequence was designed based on the amino acid sequence of PfuS. Codon usage in the synthetic gene was optimized for expression in Bacillus subtilis as previously described in WO 12025577.

[0178] DNA amplification was performed by PCR from synthetic DNA using the following primer pairs under standard conditions:

[0179] Forward primer: aaaggagaggataaagaatggcacctgagaagaaa (SEQ ID NO: 3)

[0180] Reverse primer: gcgtttttttattgattaacgcgtttatggtgatgagccaggc (SEQ ID NO: 4)

[0181] By agarose gel electrophoresis, the PCR fragment obtained has an expected 1631bp size. Before the second PCR reaction (PCR2) is carried out, the PCR fragment is purified. In this PCR2 reaction, the 5' end of the PCR1 fragment is fused and operably connected to a DNA fragment containing the three promoters disclosed in WO 9943835. A DNA fragment encoding chloramphenicol acetyltransferase is fused to the 3' end of the PCR1 product. The chloramphenicol acetyltransferase gene is used as an antibiotic marker (as described in Diderichsen et al., 1993, Plasmid 30:312-315). The expected final coding PfuS DNA fragment obtained is shown in SEQ ID NO:5 and the expected coding amino acid sequence is shown in SEQ ID NO:6.

[0182] Alternatively to the above PCR reactions, the complete DNA fragment including all regulatory elements can be ordered as synthetic DNA through commercial suppliers.

[0183] The expression construct of SEQ ID NO: 5 was integrated into the Bacillus subtilis genome by homologous recombination as described in WO 99 / 43835. The expression host was a Bacillus subtilis strain having the following phenotypes: non-spore forming (spo-), biotin auxotrophic (biol-), protease negative (NprE- and AprE-), α-amylase negative (AmyE-), non-surfactant (SrfC-).

[0184] A Bacillus subtilis chloramphenicol resistance expressing clone designated as MTBO0411-1 was selected on TB agar plates containing chloramphenicol as a selection marker. The clone was cultured in liquid medium on a rotary shaker in 500 mL baffled Erlenmeyer flasks, each containing 100 ml of casein-based medium supplemented with 34 mg / l chloramphenicol.

[0185] DNA sequencing was used to verify the polynucleotide insertion from the selected clones and a random mutation was identified at position 1463 of SEQ ID NO:5, where the sequence had been changed from G to A (G1463A). The actual DNA sequence of the polynucleotide expression construct inserted into clone MTBO0411-1 (including the mutated nucleotide at position 1463) is shown in SEQ ID NO:7. The deduced encoded variant PfuS amino acid sequence is shown in SEQ ID NO:8, including a single amino acid substitution at position 369 of the mature polypeptide resulting from the G1463A nucleotide mutation: G369D.

[0186] The MTBO0411-1 clone was cultured at 37° C. for 2 to 5 days. For subsequent purification or enzyme protein activity measurement, the cell-free culture supernatant was heat-treated at 70° C. for 20 minutes, followed by centrifugation to inactivate endogenous proteases from the expression host and remove denatured proteins. The successful expression of PfuS protease was determined by SDS-PAGE analysis (see Example 2).

[0187] For comparison we also put together a PfuS protein expression construct that included a functional Bacillus secretion signal. The PfuS protease including an amino-terminal signal peptide was expressed as outlined above, except that the DNA fragment was PCR amplified using the following primer pair:

[0188] Forward primer: tcatcgatcgcatcggctgcacctgagaagaaagttg (SEQ ID NO: 9)

[0189] Reverse primer: ccaaggccggttttttatgttttatggtgatgagccaggc (SEQ ID NO: 10)

[0190] The resulting expression vector construct consisted of the same coding sequence as above fused in frame to the DNA encoding the Bacillus clausii aprH protease signal peptide:

[0191] atgaaaaaaccgctggggaaaattgtcgcaagcaccgcactactcatttctgttgcttttagttcatcgatcgcatcgg ctgcacctagg (SEQ ID NO: 11),

[0192] wherein nucleotides at positions 1-81 encode the AprH signal and nucleotides 82-90 are retained from the cloning process).

[0193] Cloning and transformation were performed as above and a Bacillus subtilis expression clone was selected, which was denoted as MTBO0411-2, carrying the pfuS gene fragment shown in SEQ ID NO:12, which encodes the deduced amino acid sequence shown in SEQ ID NO:13.

[0194] Example 2. Detection of protease activity and enzyme yield

[0195] The protease activity of the original culture solution of two selected clones from Example 1 together with the culture supernatant was measured by adding 10 μL of the heat-treated sample to a well punched in solidified Luria Bertani agar medium containing 1% casein (dissolved skim milk powder). After incubation at 70° C. for 18 h, the clear zone around the well indicated proteolytic activity.

[0196] The Bacillus subtilis control host strain deficient in the PfuS gene did not produce a clearing zone, whereas the Bacillus subtilis clone from Example 1a carrying the PfuS construct without a signal peptide already showed a clearing zone of 10 mm radius after 2 days of fermentation. After 2 days of fermentation, the clearing zone of the PfuS gene construct from Example 1 with a signal peptide was not significantly different (about 1 mm) compared to the case of the control Bacillus subtilis host strain. After only 5 days of fermentation in shake flasks, we were able to detect a significant clearing of 5 mm from the clone expressing the PfuS protease with the AprH signal peptide.

[0197] Together with the results from SDS-PAGE analysis, we concluded that expression without any signal peptide achieved much higher expression levels of PfuS protease than expression with the otherwise well-known and efficient signal peptide from AprH protease, which did not result in any significant expression after 2 days of fermentation.

[0198] Fermentation: No signal peptide AprH signal peptide Bacillus subtilis control 2 days at 26°C 8 1 0 2 days at 37 °C 10 3 0 5 days at 26°C 10 3 0 5 days at 37 °C 10 3 0

[0199] Table 1. Transparent zone radius in mm.

[0200] The cell-free fermentation culture supernatant was used to analyze the successful expression of the variant PfuS protease by SDS-PAGE. A distinct protein band of approximately 40 kDa indicated that PfuS was successfully expressed into the culture medium. Lysis of the Bacillus subtilis cells was not actively induced during or after the fermentation, which is advantageous for industrial production purposes.

[0201] SDS-PAGE analysis of all recombinantly expressed PfuS enzyme samples indicated that the expression level of the gene construct without a secretion signal in Example 1 was significantly higher than previously reported (see, e.g., EP 0994191A1; Takara Bio, Japan), and was also significantly higher than that of the construct with a secretion signal in Example 1 above, which is similar to the enzyme yields previously reported in EP0994191 A1 (Takara Bio, Japan), i.e., in the range of 13 mg-60 mg / L culture.

[0202] By differential calorimetry, the recombinant purified variant PfuS protease (sample ID U43PS) showed a melting temperature of 103°C in 50 mM acetate buffer (pH 5) at a scan rate of 200 K / h.

[0203] The mature amino terminus of recombinant PfuS was determined to be AELEGLD by N-terminal aa sequencing and the measured intact mass was 43066.4 Daltons, which is expected based on the described mature variant peptide of PfuS introduced with the point mutation: G369D, shown in SEQ ID NO:8, which has a calculated mass of 43,061 Da; as opposed to the calculated mass of 43,003 Daltons for the wild-type mature PfuS polypeptide shown in SEQ ID NO:6.

[0204] The activity of the protease PfuS was also determined spectroscopically by the method adopted by EP 0994191A1 (Takara Bio, Japan), by measuring the amount of p-nitroaniline produced in the enzymatic hydrolysis reaction using Suc-Ala-Ala-Pro-Phe-p-NA (Sigma) as a substrate. In brief, an enzyme preparation was appropriately diluted to carry out sufficient measurements (i.e., 500-fold and 1000-fold dilutions of the cell-free culture supernatant with double distilled water). 50 microliters of 1 mM Suc-Ala-Ala-Pro-Phe-p-NA solution in 100 mM phosphate buffer (pH 7.0) was added to 50 microliters of the diluted sample solution. Then, the reaction was allowed to occur at 95° C. for 30 minutes. After terminating the reaction by cooling on ice, the absorbance at 405 nm was measured to calculate the amount of p-nitroaniline produced. One unit of enzyme is defined as the amount of enzyme that produces 1 micromole of p-nitroaniline per minute at 95°C. The amount of enzyme protein expressed in the culture supernatant or cells is calculated based on the measured enzyme activity, assuming a specific activity of 9.5 U / mg protease PfuS protein, as described in US20040888588. At 410 nm, pH 7.5, the absorption coefficient of p-NA is 8800 M-1 cm-1, and in the reaction of this example (measured at 405 nm at pH 7.0) we used the same coefficient. Using the Beer-Lambert law, an absorption value of 1 in a 1 cm cuvette represents 113,6 micromoles of p-NA.

[0205] The enzyme expression yields calculated from the absorbance values ​​from 500-fold and 1000-fold sample dilutions (shown in Table 2) correlated well with estimates from clearing zone radius measurements and estimates by SDS-PAGE. The expression yields of constructs with the AprH signal peptide ranged from 2 mg to 26 mg / L and the expression yields of constructs without the signal peptide were >5-fold higher (108 to 167 mg / L).

[0206]

[0207]

[0208] Table 2. Absorbance values ​​measured following the Beer-Lambert law (average from 3 independent experiments) and calculated enzyme expression yields.

[0209] Example 3. Protease Characterization

[0210] Suc-AAPF-pNA protease activity assay:

[0211] pNA substrate: Suc-AAPF-pNA (Bachem L-1400).

[0212] Temperature: Room temperature (25°C)

[0213] Assay buffer: 100 mM succinic acid, 100 mM HEPES, 100 mM CHES, 100 mM CABS, 1 mM CaCl2, 150 mM KCl, 0.01% Triton X-100, pH 9.0.

[0214] Mix 20 μl of protease (diluted in 0.01% Triton X-100) with 100 μl of assay buffer. Start the assay by adding 100 μl of pNA substrate (50 mg, dissolved in 1.0 ml DMSO and further diluted 45 times with 0.01% Triton X-100). Monitor OD 405 The increase in was taken as a measure of protease activity.

[0215] Protease purification

[0216] The culture fluid is centrifuged (20000x g, 20min) and the supernatant is carefully separated from the precipitate decantation. The supernatant is filtered through a Nalgene 0.2 μm filter to remove the remaining bacillus host cells. Solid (NH4)2SO4 is added to the 0.2 μm filtrate to a final concentration of 0.85M, and the filtrate regulated by salt is applied to a phenyl-agarose FF (high sub) column (from GE Healthcare), which is with 100mM H3BO3, 10mM MES, 2mM CaCl2, 0.9M (NH4)2SO4 (pH 6.0) balance. After washing the column with equilibrium buffer, the protease is eluted with a linear gradient between equilibrium buffer and 100mM H3BO3, 10mM MES, 2mM CaCl2 (pH 6.0) + 25% (v / v) 2-propanol through five column volumes. The fraction from the post is analyzed for protease activity (using the Suc-AAPF-pNA assay at pH 9), and the peak fractions are merged. The pool from the phenyl-agarose FF post is transferred to 10mM Tris / HCl, 1mM CaCl2 (pH 9.0) on a G25 sepharose column (from GE Medical). The G25 filtrate is applied to a Q-agarose FF post (from GE Medical), which is balanced with 10mM Tris / HCl, 1mM CaCl2 (pH 9.0). After the post is washed with equilibrium buffer, the linear NaCl gradient (0-->0.5M) of the protease in the same buffer is eluted through five column volumes. The fraction from the post is analyzed for protease activity (using the Suc-AAPF-pNA assay at pH 9), and the active fraction is analyzed by SDS-PAGE. Fractions (only one band was seen on the Coomassie-stained SDS-PAGE gel) were pooled as purified preparations and used for additional experiments.

[0217] The N-terminal sequence was determined by Edman degradation as: AELEGLD. The relative molecular weight as determined by SDS-PAGE is approximately M r =41 kDa. The molecular weight determined by intact molecular weight analysis is 43,062.4 Da. This corresponds well to the molecular weight of 43,061.3 Da calculated based on the mature sequence shown in SEQ ID NO:8.

[0218] Example 4. Cloning and expression of Dictyophora thermophila xylanase

[0219] The Bacillus licheniformis host strain contains deletions in the spoIIAC, apr-L, aprL, mprL, cypX, sacB, bprAB, epr, vpr, and wprA genes, which encode the sporulation transcription factor σF, alkaline protease, glu-specific protease (C-component), cytochrome P450-like enzyme CypX, levansucrase, bacillopeptidase F (two genes), two extracellular serine proteases, and cell wall-associated protease WprA, respectively. The expression of the forD gene encoding a 10 kDa background protein is also reduced or eliminated by mutations at its ribosome binding site. In addition, due to the inactivation or elimination of the encoding genes, the Bacillus licheniformis host strain cannot produce α-amylase, cellulase, and β-galactosidase.

[0220] The Bacillus licheniformis strain host has been further modified by inserting an artificial promoter, a marker gene and an attB integrase recognition site from lactococcal phage TP901-1 at two chromosomal loci, amyL and gntP, to serve as integration sites for phage integrase-assisted site-specific integration of expression cassettes (as disclosed in WO 2006 / 042548).

[0221] Two strains were constructed here using phage integrase-assisted site-specific integration of an artificial Dictyophora thermophila xylanase expression cassette, in which the coding sequence had been codon-optimized for expression in Bacillus licheniformis.

[0222] The codon-optimized gene (shown in SEQ ID NO: 14) encoding the mature xylanase xynDt (shown in SEQ ID NO: 15) was cloned into a suitable phage integrase-assisted integration vector flanked downstream by attP sites that were subsequently deleted and upstream by homology regions that were subsequently deleted, thereby making plasmid pJA4156 (see Figure 1 ; SEQ ID NO: 16). The vector was transformed into a host strain and a xylanase expression cassette was established in the resulting strain JA4182 in both loci as outlined above.

[0223] Encodes an artificial signal peptide (shown in SEQ ID NO: 18) derived from the amyL gene of Bacillus licheniformis and known to be effective in Bacillus licheniformis (SP amyL ) was translated into a codon-optimized gene for the mature xylanase xynDt (shown in SEQ ID NO: 17) and cloned into a suitable phage integrase-assisted integration vector flanked downstream by attP sites that were subsequently deleted and upstream by homology regions that were subsequently deleted, thereby making plasmid pHyGe396 (see Figure 2 ; SEQ ID NO: 19). The vector was transformed into a host strain and in the resulting strain HYGE435 a xylanase expression cassette was established in both loci as outlined above.

[0224] The expression cassettes integrated into the two integration sites in each strain encode only the mature xylanase portion of the native two-domain Thermoglobin A. xylanase, including neither its native C-terminal cellulose binding domain nor its native signal peptide (or leader sequence). However, the xylanase expression cassette integrated into the HyGe435 strain does contain an artificial signal peptide (SP) derived from the Bacillus licheniformis amyL gene and known to be effective in Bacillus licheniformis. amyL ), the signal peptide is translationally fused to the mature xylanase coding sequence. In contrast, the xylanase expression cassette integrated into the JA4182 strain has no signal peptide coding sequence; the translation initiation codon ATG is simply added to the 5'-end of the mature xylanase coding sequence.

[0225] ·JA4182(amyL::xynDt; gntP::xynDt)

[0226] ·HYGE435(amyL::SP amyL _xynDt;gntP::SP amyL _xynDt;ipsA - ;prsA + )

[0227] In addition, the HyGe435 strain has a deletion of the ispA intracellular protease encoding gene and it carries an additional integrated prsA chaperone encoding gene. Both the ispA deletion and the prsA gene are expected to slightly increase xylanase production in the HyGe435 strain.

[0228] Example 5. Assay for activity measurement of Dictyoglobulus thermophilus xylanase activity

[0229] This method is used to measure xylanase activity in fermentation samples. The reaction is performed in two steps:

[0230] 1) Xylanase hydrolyzes wheat arabinoxylan (pH 6.0, 37°C) to release reducing carbohydrates.

[0231] 2) The reaction is terminated by adding an alkaline reagent containing PAHBAH and bismuth (pH>10, 37°C) which complexes with reducing sugars producing a colorimetric reading that can be measured at 405 nM. The color produced is proportional to the xylanase activity present in the sample.

[0232] The fermentation samples were weighed, dilutions were prepared and the assay was performed on an analytical robot. Samples were measured on a plate reader, e.g., Molecular Devices SOFTMAX Plate reader.

[0233] Buffers and reagents

[0234] Aces Buffer:

[0235]

[0236] Adjust pH to 6.0 with NaOH

[0237] 2x MES buffer:

[0238]

[0239] Adjust pH to 6.0 with NaOH

[0240] PAHBAH:

[0241]

[0242] 1% w / v Arabinose:

[0243]

[0244] Arabinose-MES substrate buffer:

[0245] Mix an equal amount of 1% arabinose with 2x MES buffer in a volume appropriate for the assay.

[0246] Determination procedure:

[0247] Preparation of standards:

[0248] The standard used was a xylanase sample with a defined concentration (in the following measurements it was 4.03 mg / ml). The standard was thawed to ambient temperature before use. The standard was diluted to a starting dilution of 1 μg / ml.

[0249] The standards were diluted (in quadruplicate) as follows.

[0250] ACES buffer (μl) 1μg / ml diluted standard (μl) Standard concentration (μg / ml) 0 200 1 50 175 0.075 100 150 0.05 150 100 0.025 175 50 0.0125 200 0 0

[0251] All determination steps are performed in a custom-made (Beckman Coulter) liquid handling system, Span8 pipetting system and (Beckman Coulter) plate reader.

[0252] Sample preparation:

[0253] 1) If the complete broth samples are very thick and viscous, the samples are initially prepared by shaking at 900 rpm for 15 minutes in a 24-well plate with steel ball bearings (6 mm diameter). After this time, they are transferred to a robotic balance using a wide-bore pipette and weighed to give an initial dilution of approximately 10 times in ACES buffer (the actual weight / initial dilution is then corrected in the final calculation). Typically, this initial step is to add 200 μl of broth to 1800 μl ACES buffer. If the sample is received as supernatant or can be pipetted smoothly, this initial dilution is performed as a simple liquid-to-liquid pipetting step.

[0254] 2) The weighed samples were then distributed in triplicate and plated with ACES buffer in a 96-well microtiter plate according to their predicted activity. The final 2 dilution plates fell within the standard curve according to their predicted activity.

[0255] 3) Generate a standard curve on each of the final 2 dilution plates as described above.

[0256] 4) For each of the final 2 dilution plates, transfer 20ul of each sample and standard into 110ul of Arabinose-MES substrate buffer and mix immediately (900rpm for 30sec, robotic orbital shaker).

[0257] 5) The plate was sealed and incubated at 37° C. in a closed incubator with shaking (600 rpm, IKA Schüttler MTS4) for 30 minutes.

[0258] 6) 65 ul of PAHBAH were added to the plates, after which time they were sealed and incubated for another 15 minutes at 37°C with shaking (600 rpm, IKA Schüttler MTS4).

[0259] 7) The absorbance of the plates was measured at 405 nM on a plate reader and activity was extrapolated from the attached standard curve generated.

[0260] Example 6. Fed-batch fermentation of Bacillus licheniformis strains JA4182 and HYGE435

[0261] Fed-batch fermentations of Bacillus licheniformis strains JA4182 and HYGE435 were performed as described below. All media were sterilized by standard methods. Unless otherwise described, tap water was used. The ingredient concentrations mentioned in the following recipes are the concentrations before any inoculation.

[0262] First inoculum medium:

[0263] SSB5 agar: 10 g / l soy peptone; sucrose 10 g / l; potassium dihydrogen phosphate 2 g / l; sodium dihydrogen phosphate, 2H2O 5 g / l; vitamins (thiamine dichloride 11,4 mg / l; riboflavin 0,97 mg / l; niacin 7,7 mg / l; D-calcium pantothenate 9,5 mg / l; pyridoxal hydrochloride 1,9 mg / l; D-biotin 0,37 mg / l; folic acid 0,97 mg / l); trace metals (MnSO4, H2O 9,8 mg / l; FeSO4, 7H2O 39,25 mg / l; CuSO4, 5H2O 3,9 mg / l; ZnCl2 3,9 mg / l); 25 g / l agar, adjusted to pH 7,3-7,4 with 4N NaOH.

[0264] Transfer Buffer:

[0265] M-9 buffer (deionized water was used for preparation): disodium hydrogen phosphate, 2H2O 8.8 g / l; potassium dihydrogen phosphate 3 g / l; sodium chloride 4 g / l; magnesium sulfate, 7H2O 0.2 g / l.

[0266] Inoculum shake flask medium (concentration is the concentration before inoculation):

[0267] PRK-50: 110 g / l soybean grains; disodium hydrogen phosphate, 2H2O 5 g / l; pH adjusted to 8.0 using NaOH / H3PO4 before sterilization.

[0268] Composition of culture medium (concentration is the concentration before inoculation):

[0269] Tryptone (casein hydrolyzate from Difco) 30 g / l; magnesium sulfate, 7H2O 4 g / l; potassium dihydrogen phosphate 7 g / l; sodium dihydrogen phosphate, 2H2O 7 g / l; diammonium sulfate 4 g / l; citric acid 0.78 g / l; vitamins (thiamine dichloride 34.2 mg / l; riboflavin 2,9 mg / l; niacin 23 mg / l; calcium D-pantothenate 28,5 mg / l; pyridoxal hydrochloride 5.7 mg / l; D-biotin 1,1 mg / l; folic acid 2,9 mg / l); trace metals (MnSO4, H2O 39.2 mg / l; FeSO4, 7H2O 157 mg / l; CuSO4, 5H2O 15.6 mg / l; ZnCl2 15.6 mg / l); defoamer (SB2121) 1.25 ml / l; before sterilization, the pH was adjusted to 6.0 using NaOH / H3PO4.

[0270] Feed medium:

[0271] Sucrose 708 g / l;

[0272] Procedure for the inoculum step:

[0273] First, the strain was grown on SSB5 agar slant for 1 day at 37°C. Then, the agar was washed with M-9 buffer and the optical density (OD) of the resulting cell suspension was measured at 650nm. An inoculum of OD (650nm) x ml cell suspension = 0.1 was used to inoculate an inoculum shake flask (PRK-50). The shake flask was cultured at 37°C at 300rpm for 20hr.

[0274] Fermentation in the main fermenter (fermenter) was started by inoculating the main fermenter with the growing culture from the shake flask. The inoculation volume was 11% of the make-up medium (80 ml for 720 ml make-up medium).

[0275] Fermentation tank:

[0276] A standard laboratory fermenter equipped with a temperature control system, pH control using ammonia and phosphoric acid, and a dissolved oxygen electrode for measuring >20% oxygen saturation throughout the fermentation was used.

[0277] Fermentation parameters:

[0278] Temperature: 41°C

[0279] The pH was maintained between 6.8 and 7.2 using ammonia and phosphoric acid.

[0280] Control: 6.8 (ammonia water); 7.2 phosphoric acid.

[0281] Ventilation: 1.5 L / min / kg culture medium weight.

[0282] Stirring: 1350rpm.

[0283] Feeding strategy:

[0284] 0hr. After inoculation, 0.05g / min / kg initial culture medium

[0285] 8hr. After inoculation, 0.156g / min / kg initial culture fluid

[0286] End: After inoculation, 0.156g / min / kg initial culture fluid

[0287] Experimental setup:

[0288] The fermentation was run for three days.

[0289] result:

[0290] Relative xylanase activity was determined in the supernatant on day 3:

[0291] strain active Notes JA4182 446％ No signal peptide HyGe435 100％ Signal peptide

[0292] Contrary to expectations, the xylanase yield from the Bacillus licheniformis host strain JA4182 was much higher, regardless of the expression of the enzyme without any signal peptide. When the full-length Dictyophora thermophila xylanase coding sequence (including its native signal) was expressed in Bacillus subtilis, the observed yield was more than 1000 times higher than previously reported, which was only about 1.4 mg / l after recovery (see Table 1 of Zhang et al.; Appl Biochem Biotechnol (2010) 160: 1484-1495). Preferred Embodiments

[0293] [1] An isolated synthetic polynucleotide encoding a protease polypeptide without a secretion signal, wherein the protease polypeptide has an amino acid sequence that is at least 80% identical to the protease shown at positions 1 to 413 of SEQ ID NO:8.

[0294] [2] The polynucleotide according to embodiment 1, wherein the encoded protease polypeptide comprises or consists of an amino acid sequence that is at least 80% identical to the protease shown at positions 1 to 413 of SEQ ID NO:8.

[0295] [3] According to the polynucleotide described in embodiment 1 or 2, the polynucleotide has the following nucleotide sequence, which is at least 80% identical to the sequence shown at positions 1 to 1569 of SEQ ID NO:7; preferably at least 80% identical to the sequence shown at positions 331 to 1569 of SEQ ID NO:7.

[0296] [4] A polynucleotide according to any one of embodiments 1-3, comprising or consisting of a nucleotide sequence that is at least 80% identical to the sequence shown at positions 1 to 1569 of SEQ ID NO:7; preferably at least 80% identical to the sequence shown at positions 331 to 1569 of SEQ ID NO:7.

[0297] [5] A nucleic acid construct or expression vector comprising a polynucleotide as defined in any one of embodiments 1 to 4, operably linked to a control sequence that provides for its expression in a selected host cell.

[0298] [6] A prokaryotic host cell transformed with or comprising a polynucleotide as defined in Examples 1 to 4, or a nucleic acid construct or expression vector as defined in Example 5, wherein the host cell is capable of producing the protease polypeptide.

[0299] [7] The host cell as described in Example 6, which is a Bacillus host cell.

[0300] [8] The host cell as described in Example 7, wherein the Bacillus host cell is selected from the group consisting of Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus radiata, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus brevis, Bacillus stearothermophilus, Bacillus subtilis and Bacillus thuringiensis.

[0301] [9] A host cell as described in any one of Examples 6 to 8, wherein the protease polypeptide comprises or consists of an amino acid sequence that is at least 80% identical to the protease shown at positions 1 to 413 of SEQ ID NO:8.

[0302]

[10] A method for producing a protease polypeptide, the method comprising the following steps:

[0303] a) culturing a host cell as defined in any one of Examples 6 to 9 under conditions conducive to the expression of the protease polypeptide; and, optionally

[0304] b) recovering the protease.

[0305]

[11] An isolated synthetic protease polypeptide having the amino acid sequence shown at positions 1 to 413 of SEQ ID NO:8.

[0306]

[12] A polypeptide as described in Example 11, which comprises or consists of the amino acid sequence shown at positions 1 to 413 of SEQ ID NO:8.

[0307]

[13] A polypeptide as described in Example 11 or 12, which is an isolated protease having at least 80% sequence identity with the protease shown at positions 1 to 413 of SEQ ID NO:6, wherein the protease comprises a substitution at position 369.

[0308]

[14] A polypeptide as described in Example 11 or 12, which is a substitution variant of the mature PfuS protease shown in positions 1 to 413 of SEQ ID NO:6, wherein the glycine at position 369 is substituted with aspartic acid: G369D.

[0309]

[15] A composition comprising a protease polypeptide as defined in any one of embodiments 11 to 14.

[0310] Other preferred embodiments

[0311] 1. A method for recombinantly producing a naturally secreted polypeptide, the method comprising the following steps:

[0312] a) providing a microbial host cell comprising an exogenous polynucleotide encoding a naturally secreted polypeptide without a translational fusion signal peptide;

[0313] b) cultivating the microbial host cell under conditions conducive for expression of the polypeptide and, optionally,

[0314] c) recovering the polypeptide.

[0315] 2. The method according to embodiment 1, wherein the microorganism is a prokaryotic host cell, preferably a Gram-positive host cell, more preferably a Bacillus host cell, and most preferably, the host cell is selected from the group consisting of: alkalophilic Bacillus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus radiata, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus brevis, Bacillus stearothermophilus, Bacillus subtilis and Bacillus thuringiensis.

[0316] 3. The method according to embodiment 1 or 2, wherein the polypeptide is a homologous or heterologous enzyme, preferably the enzyme is selected from the group consisting of a hydrolase, an isomerase, a ligase, a lyase, an oxidoreductase or a transferase; more preferably, the enzyme is an α-galactosidase, α-glucosidase, an aminopeptidase, an amylase, an asparaginase, a β-galactosidase, a β-glucosidase, a β-xylosidase, a carbohydrase, a carboxypeptidase, a catalase, a cellobiohydrolase, a cellulase, a chitinase, a cutinase, a cyclodextrin glycosyltransferase, a deoxyribonuclease, an endoglucanase, an esterase, a green fluorescent protein, a glucanotransferase, a glucoamylase, an invertase, a laccase, a lipase, a mannosidase, a mutanase, an oxidase, a pectinolytic enzyme, a peroxidase, a phytase, a polyphenol oxidase, a proteolytic enzyme, a ribonuclease, a transglutaminase, or a xylanase.

[0317] 4. The method according to any one of embodiments 1-3, wherein the polypeptide is:

[0318] a) a protease polypeptide comprising or consisting of an amino acid sequence that is at least 80% identical to the sequence shown at positions 1 to 413 of SEQ ID NO:8, or

[0319] b) A xylanase polypeptide comprising or consisting of an amino acid sequence that is at least 80% identical to the sequence shown at positions 1 to 204 of SEQ ID NO:15.

[0320] 5. The method according to any one of embodiments 1-3, wherein the polypeptide is:

[0321] a) a protease encoded by a polynucleotide comprising or consisting of a nucleotide sequence that is at least 80% identical to the sequence shown at positions 1 to 1569 of SEQ ID NO:7; preferably at least 80% identical to the sequence shown at positions 331 to 1569 of SEQ ID NO:7; or

[0322] b) a xylanase encoded by a polynucleotide comprising or consisting of a nucleotide sequence that is at least 80% identical to the sequence shown in positions 1 to 612 of SEQ ID NO:14.

[0323] 6. A recombinant microbial host cell comprising an exogenous polynucleotide encoding a native secreted polypeptide without a translational fusion signal peptide.

[0324] 7. The microorganism according to embodiment 6, which is a prokaryotic host cell, preferably a Gram-positive host cell, more preferably a Bacillus host cell, and most preferably, the host cell is selected from the group consisting of: alkalophilic Bacillus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus radiata, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus brevis, Bacillus stearothermophilus, Bacillus subtilis and Bacillus thuringiensis.

[0325] 8. The microorganism of embodiment 6 or 7, wherein the polypeptide is a homologous or heterologous enzyme, preferably the enzyme is selected from the group consisting of a hydrolase, an isomerase, a ligase, a lyase, an oxidoreductase or a transferase; more preferably, the enzyme is an α-galactosidase, α-glucosidase, an aminopeptidase, an amylase, an asparaginase, a β-galactosidase, a β-glucosidase, a β-xylosidase, a carbohydrase, a carboxypeptidase, a catalase, a cellobiohydrolase, a cellulase, a chitinase, a cutinase, a cyclodextrin glycosyltransferase, a deoxyribonuclease, an endoglucanase, an esterase, a green fluorescent protein, a glucanotransferase, a glucoamylase, an invertase, a laccase, a lipase, a mannosidase, a mutanase, an oxidase, a pectinolytic enzyme, a peroxidase, a phytase, a polyphenol oxidase, a proteolytic enzyme, a ribonuclease, a transglutaminase, or a xylanase.

[0326] 9. The microorganism of any one of embodiments 6-8, wherein the polypeptide is:

[0327] a) a protease polypeptide comprising or consisting of an amino acid sequence that is at least 80% identical to the sequence shown at positions 1 to 413 of SEQ ID NO:8; or

[0328] b) a xylanase polypeptide comprising or consisting of an amino acid sequence that is at least 80% identical to the sequence shown at positions 1 to 204 of SEQ ID NO:15.

[0329] 10. The microorganism of any one of embodiments 6-9, wherein the polypeptide is:

[0330] a) a protease encoded by a polynucleotide comprising or consisting of a nucleotide sequence that is at least 80% identical to the sequence shown at positions 1 to 1569 of SEQ ID NO:7; preferably at least 80% identical to the sequence shown at positions 331 to 1569 of SEQ ID NO:7, or

[0331] b) a xylanase encoded by a polynucleotide comprising or consisting of a nucleotide sequence that is at least 80% identical to the sequence shown in positions 1 to 612 of SEQ ID NO:14.

[0332] 11. An isolated synthetic polynucleotide encoding a naturally secreted polypeptide without a translational fusion signal peptide, wherein the polypeptide is a protease having an amino acid sequence at least 80% identical to the sequence shown at positions 1 to 413 of SEQ ID NO:8; or a xylanase having an amino acid sequence at least 80% identical to the sequence shown at positions 1 to 204 of SEQ ID NO:15.

[0333] 12. The polynucleotide of embodiment 11, wherein the encoded polypeptide is a protease comprising or consisting of an amino acid sequence at least 80% identical to the sequence shown at positions 1 to 413 of SEQ ID NO:8; or a xylanase comprising or consisting of an amino acid sequence at least 80% identical to the sequence shown at positions 1 to 204 of SEQ ID NO:15.

[0334] 13. A polynucleotide according to embodiment 11 or 12, which has a nucleotide sequence that is at least 80% identical to the sequence shown at positions 1 to 1569 of SEQ ID NO:7; at least 80% identical to the sequence shown at positions 331 to 1569 of SEQ ID NO:7; or at least 80% identical to the sequence shown at positions 1 to 612 of SEQ ID NO:14.

[0335] 14. The polynucleotide according to any one of embodiments 11-13, comprising or consisting of a nucleotide sequence that is at least 80% identical to the sequence shown at positions 1 to 1569 of SEQ ID NO:7; at least 80% identical to the sequence shown at positions 331 to 1569 of SEQ ID NO:7; or at least 80% identical to the sequence shown at positions 1 to 612 of SEQ ID NO:14.

[0336] 15. A nucleic acid construct or expression vector comprising a polynucleotide as defined in any one of embodiments 11 to 14 operably linked to a control sequence that provides for its expression in a selected host cell.

[0337] 16. An isolated synthetic polypeptide, said polypeptide being:

[0338] a) a protease having, comprising or consisting of an amino acid sequence at least 80% identical to the protease shown in positions 1 to 413 of SEQ ID NO:6, wherein the protease comprises an amino acid substitution at the position corresponding to position 369 of SEQ ID NO:6; preferably the glycine at the position corresponding to position 369 of SEQ ID NO:6 is substituted with aspartic acid: G369D; or

[0339] b) a xylanase having, comprising or consisting of an amino acid sequence at least 80% identical to the protease shown in positions 1 to 204 of SEQ ID NO: 15, and comprising a methionine as its first N-terminal amino acid.

[0340] 17. An isolated synthetic polypeptide, said polypeptide being:

[0341] a) a protease having, comprising or consisting of the amino acid sequence shown at positions 1 to 413 of SEQ ID NO: 8; or

[0342] b) A xylanase having, comprising or consisting of the amino acid sequence shown at positions 1 to 204 of SEQ ID NO: 15 and including a methionine as its first N-terminal amino acid.

[0343] 18. A composition comprising a protease polypeptide as defined in embodiment 16 or 17.

Claims

1. A method for recombinantly producing a naturally secreted protease, the method comprising the following steps: a) providing a Bacillus host cell, the host cell comprising an exogenous polynucleotide encoding a native secreted protease without a translational fusion signal peptide, wherein the protease consists of the amino acid sequence shown at positions 1 to 413 of SEQ ID NO:8, wherein the protease comprises an amino acid substitution G369D at position 369 of SEQ ID NO:8; b) culturing the Bacillus host cell under conditions conducive for expression of the protease and, optionally, c) recovering the protease, The Bacillus host cell is selected from Bacillus licheniformis and Bacillus subtilis.

2. The method according to claim 1, wherein the protease is encoded by a polynucleotide comprising or consisting of a nucleotide sequence that is at least 99% identical to the sequence shown in positions 1 to 1569 of SEQ ID NO:

7.

3. The method according to claim 2, wherein the protease is encoded by a polynucleotide comprising or consisting of a nucleotide sequence that is at least 99% identical to the sequence shown at positions 331 to 1569 of SEQ ID NO:

7.

4. A recombinant Bacillus host cell comprising an exogenous polynucleotide encoding a native secreted protease without a translational fusion signal peptide, wherein the protease consists of the amino acid sequence shown at positions 1 to 413 of SEQ ID NO:8, wherein the protease comprises an amino acid substitution G369D at position 369 of SEQ ID NO:8, and the Bacillus host cell is selected from Bacillus licheniformis and Bacillus subtilis.

5. The Bacillus host cell of claim 4, wherein the protease is encoded by a polynucleotide comprising or consisting of a nucleotide sequence that is at least 99% identical to the sequence shown at positions 1 to 1569 of SEQ ID NO:

7.

6. The Bacillus host cell of claim 5, wherein the protease is encoded by a polynucleotide comprising or consisting of a nucleotide sequence that is at least 99% identical to the sequence shown at positions 331 to 1569 of SEQ ID NO:7.

Images