Primer set of microsatellite marker HA81 related to the growth of Hippocampus abdominalis and its application

Abstract

The present invention relates to a primer set of microsatellite marker HA81 related to the growth of Hippocampus abdominalis and its application, belonging to the field of molecular biology. The sequences of the primer set are shown in SEQ ID NO.1-2. The present invention also provides the application of the primer set in the breeding of growth traits of Hippocampus abdominalis. The DNA of Hippocampus abdominalis individuals is subjected to PCR amplification using the primer set, and individuals capable of amplifying a specific fragment size of 266 bp are screened as basic parents to produce heterozygous or homozygous individuals with this fragment for the breeding of fast-growing varieties. Compared with the conventional breeding method, this method can shorten the breeding period, accelerate the breeding process, and improve the breeding efficiency.

Description

Technical Field

[0001] This application belongs to the field of molecular biology, and specifically relates to a primer group of microsatellite marker HA81 related to the growth of Hippocampus abdominalis and its application. Background Art

[0002] Hippocampus abdominalis is a special marine aquaculture fish introduced into China in recent years, with high nutritional and medicinal values. In the actual production and breeding process, the phenomenon of inconsistent specifications appears in the same batch of seahorses, that is, within the same breeding cycle, there are differences in the individual growth rates of seahorses in the same batch. The average weight of seahorses with rapid growth at 1 month old is 0.260 g heavier than that of seahorses with slow growth, and the average body length is 2.533 cm longer. The breeding growth rate of seahorses has a significant impact on improving the enthusiasm of farmers and promoting the development of the Hippocampus abdominalis aquaculture industry. Growth is an important economic and technical indicator. Selecting a strain of Hippocampus abdominalis with fast growth can effectively shorten the breeding cycle, reduce breeding costs, and increase breeding income.

[0003] Molecular marker-assisted breeding is to directly select and breed individuals with allelic genes or genotypes with trait advantages by means of molecular markers closely related to traits. Compared with traditional breeding methods, molecular marker-assisted selection has a large amount of information, is not easily affected by the environment, has a large selection intensity, and high selection efficiency and accuracy. Among common molecular marker techniques, microsatellite molecular markers (simple sequence repeats, SSR) are widely and randomly distributed in the genome, and have the advantages of codominant inheritance, high polymorphism, good stability, and simple operation, and have been widely used in aquaculture animal breeding research.

[0004] Using molecular marker-assisted breeding to cultivate Hippocampus abdominalis with fast-growing traits is an important way to reduce costs and improve economic benefits. At present, the screening of SSR markers in seahorses mainly focuses on variety identification, and there is less research on growth. There is no report on the molecular marker research of seahorse growth traits at home and abroad. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a primer group of microsatellite marker HA81 related to the growth of Hippocampus abdominalis and its application.

[0006] The present invention is realized by the following technical solutions:

[0007] A primer group of microsatellite marker HA81 related to the growth of Hippocampus abdominalis, wherein the sequence of the forward primer in the primer group is CTGTGAGGTCAATGCGCTAA (SEQ ID NO.1), and the sequence of the reverse primer is CATGTGCAACCACGTTCTCT (SEQ ID NO.2).

[0008] The present invention also provides the application of the primer set in the selective breeding of the growth traits of Hippocampus abdominalis. The application method is to perform PCR amplification on the DNA of Hippocampus abdominalis individuals using the primer set, and screen the individuals that can amplify a specific fragment size of 266 bp as the basic parents to produce heterozygous or homozygous individuals with this fragment, and the offspring have a faster growth rate.

[0009] Furthermore, the PCR reaction system is 50 μL: 1 μL of DNA solution, 1 μL of upstream primer, 1 μL of downstream primer, 25 μL of 2×HS Taq PreMix (Tianlu Diagnostic Group, TOROIVD), and 22 μL of sterilized double-distilled water.

[0010] Furthermore, the PCR amplification reaction conditions are: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, for a total of 35 cycles; extension at 72 °C for 10 min.

[0011] Advantages of the present invention compared with the prior art:

[0012] The present invention obtains for the first time a molecular marker related to the growth of Hippocampus abdominalis, and uses the primer set in the selective breeding of the growth traits of Hippocampus abdominalis for the selective breeding of fast-growing varieties. Compared with the conventional breeding method, this method can shorten the breeding period, accelerate the breeding process, and improve the breeding efficiency. Description of the Drawings

[0013] Figure 1 It is the electrophoresis pattern and peak pattern of the microsatellite marker in the F group and the S group (pooled population);

[0014] Figure 2 It is the electrophoresis pattern of the band distribution of the microsatellite marker in the F group and the S group (all individuals);

[0015] Figure 3 It is the electrophoresis pattern of the amplification band pattern of HA81 in the DNA pools of 46 full-sib families;

[0016] Figure 4 It is the electrophoresis pattern of the amplification band pattern of HA81 in 30 individuals of family A37;

[0017] Figure 5 It is the electrophoresis pattern of the amplification band pattern of HA81 in 30 individuals of family A52. Detailed Embodiments

[0018] The technical solution of the present invention will be further explained below through embodiments in combination with the accompanying drawings, but the protection scope of the present invention is not limited by any form of the embodiments. Unless otherwise specified, the experimental methods used in the embodiments are all conventional methods and techniques well known to those skilled in the art, and the materials and reagents are obtained through commercial purchases.

[0019] Example 1

[0020] 1. Obtaining materials related to the growth traits of Hippocampus abdominalis

[0021] The experimental seahorses were from Weihai Yinze Biotechnology Co., Ltd. Approximately 10,000 juvenile Hippocampus abdominalis (body length 1.6 ± 0.2 cm, body weight 0.008 ± 0.002 g) produced on the same day were placed in the same breeding pond for 30 days. During the experiment, they were fed normally, and the water temperature was maintained at 18 ± 0.5 °C, the salinity was 30 ppt, and the dissolved oxygen was > 6.0 mg / L. After the experiment ended, feeding was stopped for 24 h, 1,000 seahorses were randomly fished from the breeding pond, the growth indexes were measured, and the body weight of each seahorse was recorded. 60 seahorses with a body weight greater than 0.2 g and 60 seahorses with a body weight less than 0.1 g were selected.

[0022] After the measurement, the seahorse samples were placed in absolute ethanol and then frozen in a -80 °C refrigerator for standby. 60 seahorses with a fast growth rate were selected as the fast growth rate group (Group F), and 60 seahorses with a slow growth rate were selected as the slow growth rate group (Group S). The T-test was used to verify whether there was a significant difference between the two groups.

[0023] 2. Microsatellite primers

[0024] According to the genomic data of Hippocampus abdominalis (https: / / ngdc.cncb.ac.cn / gwh / Assembly / 18745 / show), the microsatellite identification tool MISA was used to search for microsatellite loci. 95 microsatellite loci were selected, and primers were designed according to their flanking conserved sequences. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0025] 3. Extraction and detection of genomic DNA

[0026] The Tiangen Marine Animal DNA Extraction Kit was used to extract the tissue DNA of 60 seahorses in each of Group F and Group S of Hippocampus abdominalis. 1% agarose gel electrophoresis was used to determine the quality and integrity of the extracted DNA, and a UV spectrophotometer was used for concentration determination. It was diluted to 50 ng / μL with double-distilled water, and the DNA was stored at -80 °C for standby.

[0027] 4. Establishment of BSA gene pools

[0028] Select 30 samples with the fastest growth rate in group F, and take 5 μL of DNA solution of equal amount from each sample and mix them to form a fast-growing gene pool (F pool). Similarly, select 30 samples with the slowest growth rate in group S, and take 5 μL of DNA solution of equal amount from each sample and mix them to form a slow-growing gene pool (S pool).

[0029] 5. Microsatellite marker screening

[0030] Use 95 pairs of microsatellite primers to perform PCR amplification on the two DNA pools respectively. PCR reaction system: 1 μL of DNA solution, 1 μL of upstream primer, 1 μL of downstream primer, 25 μL of 2×HS Taq PreMix (Tianlu Diagnostic Group, TOROIVD) and 22 μL of sterilized double-distilled water. PCR amplification reaction conditions: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, react at the actual annealing temperature of each pair of primers for 30 s, extension at 72 °C for 30 s, a total of 35 cycles, and extension at 72 °C for 10 min.

[0031] Run the PCR products on a FragmentAnalyzer TM automatic capillary electrophoresis system for electrophoresis, with a sample loading volume of 2 μL, a constant voltage of 6 kV, and electrophoresis for 1 h. After electrophoresis, use ProSize data analysis software to analyze the results. By analyzing the PCR amplification of DNA in the two gene pools, 1 microsatellite locus that can amplify different allele fragments in the two pools was initially screened out, as Figure 1 shown.

[0032] 6. Preliminary verification of microsatellite markers

[0033] Use the technical means in step 4 (PCR amplification and capillary electrophoresis) to analyze the differential banding of 1 microsatellite marker in groups F and S, and perform Pearson test on the frequency of the differential bands. Finally, 1 microsatellite marker HA81 with significant difference was obtained. Forward primer: CTGTGAGGTCAATGCGCTAA (SEQ ID NO.1), reverse primer: CATGTGCAACCACGTTCTCT (SEQ ID NO.2).

[0034] As Figure 2 and Table 1 show, the frequency of the 266 bp fragment of this marker is 40 in group F and 28 in group S. Pearson correlation analysis shows that this fragment is significantly correlated with the growth of Hippocampus abdominalis. The specific statistical data and the results of the correlation analysis are shown in Table 1;

[0035] Table 1 Statistics of the occurrence times of HA81 allele fragments in the individual amplification band patterns

[0036]

[0037] 7. Re-verification of family individuals

[0038] The primers of microsatellite locus HA81 were used to perform PCR amplification on the DNA of 46 family mixed pools, and capillary gel electrophoresis was carried out. The results showed that 266bp bands of the HA81 locus appeared in 37 families ( Figure 3 ). Two families with significantly different growth were selected from these 37 families. For each family, 15 samples with the fastest growth (F group) and 15 samples with the slowest growth (S group) were taken. SSR differential band analysis was performed on all individuals in the two families, and the amplification of 266bp differential alleles in the F group and S group in the families was counted ( Figure 4 . Figure 5 ). The results are shown in Table 2. After Pearson test, there was a significant positive correlation between the differential alleles of the two families and the growth traits (P<0.05), further verifying that there was a significant correlation between the microsatellite locus HA81 and the growth traits of the pot-bellied seahorse;

[0039] Table 2 Statistical results of the occurrence times of HA81 allele fragments in the amplification band patterns of individuals in families A37 and A52

[0040]

[0041] Example 2: Application of microsatellite markers for growth traits in the breeding of high-growth rate strains of pot-bellied seahorses

[0042] Before the intensification of broodstock, a part of the dorsal fin of the candidate parent was cut and fixed in 95% absolute ethanol for low-temperature preservation for extracting genomic DNA. The extraction and detection of DNA, the processes of PCR and capillary electrophoresis, and the analysis of electrophoresis results were as described in Example 1. Individuals with 266bp bands in genotype were selected as the basic parents to construct a core breeding population. The offspring produced by them were collected for cultivation. 1000 seahorses were randomly fished out regularly every month for body weight measurement, and it was measured continuously for 5 times. The body weights of the offspring of the ordinary breeding population in the same period were measured in the same way. The results showed that under the same aquaculture management conditions, the offspring of the core breeding population with homozygous parents with 266bp bands always had a faster growth rate than the offspring of the ordinary population at different developmental stages. The results are shown in Table 3;

[0043] Table 3 Mean body weights of the offspring of the core breeding population and the ordinary breeding population at different developmental stages

[0044]

Claims

1. The application of the primer set in the breeding of growth traits of hippocampus bulging, characterized in that: The application method is to use the primer set to perform PCR amplification on the DNA of Hippocampus inflatus individuals, screen individuals that can amplify a specific fragment with a size of 266bp as basic parents, and produce heterozygous individuals or homozygous individuals with the fragment. The sequence of the primer set is shown in SEQ ID NO.1-2.

2. The use according to claim 1, characterized in that: The PCR reaction system is 50 μL: 1 μL DNA solution, 1 μL upstream primer, 1 μL downstream primer, 25 μL 2× HS Taq PreMix, and 22 μL sterilized double distilled water.

3. The use according to claim 2, characterized in that: The PCR amplification reaction conditions were as follows: pre-denaturation at 94° C. for 5 min; denaturation at 94° C. for 30 s, annealing at 55° C. for 30 s, and extension at 72° C. for 30 s, for a total of 35 cycles; and extension at 72° C. for 10 min.

Images