Application of circular RNA circRNA-APP

Abstract

The invention provides application of circular RNA circRNA-APP. Experiments prove that interference of circRNA-APP can significantly reduce expression of hippocampal small proinflammatory factors TNF-alpha and IL-1beta of APP / PS1 TG mice, inhibit generation of A beta and tau phosphorylation, promote expression of anti-inflammatory factors IL-10, inhibit neuronal apoptosis, improve neuronal synaptic structure plastic damage and improve the cognitive function of the APP / PS1 TG mice. The results show that the interference circRNA-APP can inhibit neuroinflammation, thereby inhibiting neuronal apoptosis and synaptic injury, and further improving the cognitive function of AD mice. Therefore, the circular RNA circRNA-APP can serve as a target spot to be used for preparing the medicine for treating or preventing the neurodegenerative diseases, and a new thought is provided for research and development of the medicine for preventing and treating the neurodegenerative diseases including the Alzheimer's disease.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a new circular RNA circRNA-APP, and its application in preparing drugs for treating or preventing neurodegenerative diseases. Background Art

[0002] Neuroinflammation caused by microglial activation is a major risk factor for neurodegenerative diseases including various dementias, such as Alzheimer's disease (AD). Circular RNAs (circRNAs) are a new type of non-coding RNA (ncRNA) molecules composed of special circular structures. Circular RNAs are highly conserved and tissue-specific. Studies have found that circular RNAs are expressed in large quantities in the brain and are associated with neurodegenerative diseases such as AD. For example, circRNA ciRS-7 can sponge miR-7, thereby reducing the expression of the ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) gene, leading to the degradation of APP and β-secretase, suggesting that ciRS-7 may be involved in the pathophysiological process of AD. In addition, Zhang et al. used the SAMP8 mouse model to find that the ceRNA network associated with circRNA was associated with Aβ clearance (Hmgb2) and myelin function (Dio2). These studies indicate that circular RNA may be involved in the pathogenesis of neurodegeneration such as AD. However, the role of circRNA in such diseases remains unclear.

[0003] APP / PS1 transgenic TG ) is a transgenic mouse constructed with C57BL / 6 mice as the background and carrying human APP and PS1 gene mutations. The study found that APP / PS1 at 6 months of age TG The production of amyloid β-protein (Aβ) in mice is significantly increased, and AD pathological manifestations such as neuroinflammation, tau protein hyperphosphorylation, impaired synaptic plasticity and neuronal apoptosis occur. Therefore, this mouse is considered to be an important model for studying neurodegenerative diseases including AD. Summary of the invention

[0004] The purpose of the present invention is to provide a circular RNA circRNA-APP for use in preparing a drug for treating or preventing neurodegenerative diseases based on the prior art.

[0005] The second object of the present invention is to provide a use of a circular RNA circRNA-APP in the preparation of a drug for treating or preventing dementia.

[0006] The third object of the present invention is to provide a use of a circular RNA circRNA-APP in the preparation of a drug for treating or preventing Alzheimer's disease.

[0007] The fourth object of the present invention is to provide a use of a circular RNA circRNA-APP in the preparation of a drug for treating or preventing neuronal damage, neuroinflammation, neuronal apoptosis or cognitive damage in the nervous system.

[0008] The fifth object of the present invention is to provide an application of a circular RNA circRNA-APP in the preparation of a drug for inhibiting the production of amyloid β (Aβ) and tau protein phosphorylation.

[0009] The sixth object of the present invention is to provide an application of a circular RNA circRNA-APP in the preparation of a drug for improving the plasticity of neuronal synaptic structure.

[0010] The seventh object of the present invention is to provide a pharmaceutical composition containing circular RNA circRNA-APP, which has the above-mentioned circular RNA circRNA-APP interfering AAV virus as an active ingredient or a main active ingredient, and is supplemented with a pharmaceutically acceptable carrier.

[0011] The technical solution of the present invention is as follows:

[0012] The use of circular RNA circRNA-APP in the preparation of a drug for treating or preventing neurodegenerative diseases, wherein the sequence of circular RNA circRNA-APP is shown in SEQ ID NO.1, and is specifically as follows:

[0013] TTGGTGAGTT TGTGAGCGAC GCCCTTCTCG TGCCCGACAA GTGCAAGTTC CTACACCAGGAGCGGATGGA TGTTTGTGAG ACCCATCTTC ACTGGCACAC CGTCGCCAAA GAGACATGCA GCGAGAAGAGCACTAACTTG CACGACTATG GCATGCTGCT GCCCTGCGGC ATCGACAAGT TCCGAGGGGT AGAGTTTGTATGCTGCCCGT TGGCCGAGGA AAGCGACAGC GTGGATTCTG CGGATGCAGA GGAGGATTGAC TCTGATGTCTGGTGGGGTGG AGCGGACACA GACTACGCTG ATGGCGGTGA AGACAAAGTA GTAGAAGTCG CCGAAGAGGAGGAAGTGGCT GATGTTGAGG AAGAGGAAGC TGATGATGAT GAGGATGTGG AGGATGGGGA CGAGGTGGAGGAGGAGGCC GAGGAGCCCT ACGAAGAGGC CACCGAGAGA ACAACCAGCA CTGCCACCA C CACCACAACCACCACTGAGT CCGTGGAGGA GGTGGTCCGAG.

[0014] When circular RNA circRNA-APP is used in the preparation of drugs for treating or preventing neurodegenerative diseases, the drugs can be made into solid preparations or liquid preparations. Furthermore, based on the technical solution provided by the present invention, the drugs can be made into injections, oral liquids, granules, powders, tablets or capsules. Pharmaceutically acceptable excipients play a key role in the development of the entire formulation technology. Excipients account for a large part of many preparations, and therefore the properties of the excipients determine the properties of the preparations to a large extent. Excellent excipients can enhance the stability of the main drug and extend the shelf life of the drug; they can regulate the release rate of the main drug in vivo and in vitro; they can change the absorption of the drug in the body and increase the bioavailability. There is no limitation on the specific type of excipients.

[0015] In a preferred embodiment, the circular RNA circRNA-APP uses a virus or plasmid as a vector, wherein the plasmid is pAAV-CX3CR1-circRNA-APP-WPRE or pAAV-CX3CR1-EGFP-miR-30shRNA-WPRE; and the virus is AAV virus.

[0016] The present invention provides the use of circular RNA circRNA-APP in the preparation of a drug for treating or preventing dementia.

[0017] The present invention provides the use of circular RNA circRNA-APP in the preparation of a drug for treating or preventing Alzheimer's disease.

[0018] The present invention provides an application of a circular RNA circRNA-APP in the preparation of a drug for treating or preventing neuronal damage, neuroinflammation, neuronal apoptosis or cognitive damage in the nervous system.

[0019] The present invention provides an application of a circular RNA circRNA-APP in the preparation of a drug for inhibiting the production of amyloid β (Aβ) and tau protein phosphorylation.

[0020] The present invention provides an application of a circular RNA circRNA-APP in the preparation of a drug for improving the plasticity of neuronal synaptic structure.

[0021] The circular RNA circRNA-APP of the present invention can be used to treat neurodegenerative diseases, especially Alzheimer's disease.

[0022] In the present invention, it was found that circRNA-APP was mainly expressed in the hippocampus and cortex of C57BL / 6 mice. Compared with the control C57BL / 6 mice of the same age, circRNA-APP was expressed in APP / PS1 at 3, 6 and 10 months. TG The expression of circRNA-APP in the mouse hippocampus was significantly increased. Overexpression of circRNA-APP can significantly increase the expression of APP / PS1 TG The expression of pro-inflammatory factors TNF-α and IL-1β in the mouse hippocampus promoted the production of amyloid β (Aβ) and tau phosphorylation, inhibited the expression of anti-inflammatory factor IL-10, promoted neuronal apoptosis, and damaged APP / PS1 TG These results suggest that circRNA-APP overexpression can promote neuroinflammation, lead to neuronal apoptosis, and impair cognitive function in AD mice. Conversely, interference with circRNA-APP can significantly reduce APP / PS1 TG The expression of pro-inflammatory factors TNF-α and IL-1β in the mouse hippocampus, inhibited the production of Aβ and tau phosphorylation, promoted the expression of anti-inflammatory factor IL-10, inhibited neuronal apoptosis, improved the plasticity damage of neuronal synaptic structure, and increased APP / PS1 TG These results suggest that interfering with circRNA-APP can inhibit neuroinflammation, thereby inhibiting neuronal apoptosis and synaptic damage, and thus improving the cognitive function of AD mice.

[0023] The present invention also provides a pharmaceutical composition containing circular RNA circRNA-APP, wherein the pharmaceutical composition uses the above-mentioned circular RNA circRNA-APP interfering AAV virus as an active ingredient or a main active ingredient, and is supplemented with a pharmaceutically acceptable carrier. The pharmaceutical composition can be a solid preparation or a liquid preparation, in particular an injection, an oral liquid, a granule, a powder, a tablet or a capsule. Pharmaceutically acceptable excipients play a key role in the development of the entire formulation technology. Excipients account for a large part of many preparations, and thus the properties of the excipients determine the properties of the preparation to a large extent. Excellent excipients can enhance the stability of the main drug and extend the shelf life of the drug; they can regulate the release rate of the main drug in vivo and in vitro; they can change the absorption of the drug in the body and increase the bioavailability, and the specific excipient type is not limited.

[0024] Adopt the technical scheme of the present invention, the advantages are as follows:

[0025] This study confirms that circRNA-APP overexpression can promote APP / PS1 TG Expression of pro-inflammatory factors TNF-α and IL-1β, Aβ production and tau phosphorylation in the mouse hippocampus, inhibition of anti-inflammatory factor IL-10 expression, promotion of neuronal apoptosis, and damage to APP / PS1 TG In contrast, interference with circRNA-APP significantly reduced APP / PS1 TG The expression of pro-inflammatory factors TNF-α and IL-1β in the mouse hippocampus, inhibited the production of Aβ and tau phosphorylation, promoted the expression of anti-inflammatory factor IL-10, inhibited neuronal apoptosis, improved the plasticity damage of neuronal synaptic structure, and increased APP / PS1 TG These results indicate that interfering with circRNA-APP can inhibit neuroinflammation, thereby inhibiting neuronal apoptosis and synaptic damage, and thus improving cognitive function in AD mice. Therefore, circular RNA circRNA-APP can be used as a target for the preparation of drugs for the treatment or prevention of neurodegenerative diseases, providing new ideas for the development of drugs for the prevention and treatment of neurodegenerative diseases including Alzheimer's disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The expression of circular RNA circRNA-APP in different tissues and organs of C57BL / 6 mice and the expression of APP / PS1 in different months of age TG Expression in mouse hippocampus;

[0027] in, Figure 1 A is the expression of circRNA-APP in various tissues and organs of mice detected by RT-PCR experiment; Figure 1B is the RNase enzyme digestion experiment to detect the circular structure of circRNA-APP; Figure 1 C is the RT-PCR experiment to detect circRNA-APP in 3-month-old C57BL / 6 and APP / PS1 TG Expression in mouse hippocampus; Figure 1 D is the RT-PCR experiment to detect circRNA-APP in 6-month-old C57BL / 6 and APP / PS1 TG Expression in mouse hippocampus; Figure 1 E is the RT-PCR experiment to detect circRNA-APP in 10-month-old C57BL / 6 and APP / PS1 TG Expression in mouse hippocampus;

[0028] Figure 2 It is circular RNA circRNA-APP to APP / PS1 TG Effects of mouse behavior;

[0029] in, Figure 2 A shows the infection status of mice after injection of blank AAV carrying green fluorescent microglia-specific infection into the hippocampus; Figure 2 B is APP / PS1 TG Expression of circRNA-APP after injection of circRNA-APP overexpressing AAV in mice; Figure 2 C is APP / PS1 TG Expression of circRNA-APP after injection of circRNA-APP interference (shcircRNA-APP) AAV in mice; Figure 2 D is Morris water maze test for the effect of circRNA-APP overexpression on APP / PS1 TG Effects on learning and memory abilities of mice; Figure 2 E: Morris water maze test of circRNA-APP interference on APP / PS1 TG Effects on learning and memory abilities of mice; Figure 2 F is a light-dark box experiment to detect the effect of circRNA-APP overexpression on APP / PS1 TG Effects on memory ability of mice; Figure 2 G is a light-dark box experiment to detect the effect of circRNA-APP on APP / PS1 TG Effects on memory ability of mice; Figure 2 H is a novel object recognition experiment to detect the effect of circRNA-APP overexpression on APP / PS1 TG The effects of novel object recognition on mice; Figure 2 I is a novel object recognition experiment to detect the effect of circRNA-APP on APP / PS1 TGEffects of novel object recognition on mice.

[0030] Figure 3 It is circular RNA circRNA-APP to APP / PS1 TG Effects on Aβ expression, tau phosphorylation, and expression of pro-inflammatory and anti-inflammatory factors in the mouse hippocampus;

[0031] in, Figure 3 A~3C are Western blot experiments to detect the effect of circRNA-APP overexpression on APP / PS1 TG Effects of Aβ and phosphorylated tau protein expression in mouse hippocampus, Figure 3 A Representative Western blot images; Figure 3 B is the statistical graph of Aβ expression; Figure 3 C is the statistical graph of phosphorylated tau protein expression; Figure 3 D~3F are Western blot experiments to detect the effect of circRNA-APP on APP / PS1 TG Effects of Aβ and phosphorylated tau protein expression in mouse hippocampus; Figure 3 D Representative Western blot images; Figure 3 E is the statistical graph of Aβ expression; Figure 3 F is the statistical graph of phosphorylated tau protein expression; Figure 3 G~3L are Western blot experiments to detect the effect of circRNA-APP overexpression on APP / PS1 TG Effects on the protein expression of pro-inflammatory factors TNF-α, Pro-IL-1β and Cleaved IL-1β and anti-inflammatory factor IL-10 in the mouse hippocampus; Figure 3 G Representative Western blot images; Figure 3 H is the statistical graph of IL-10 expression; Figure 3 I is the statistical graph of Pro-IL-1β expression; Figure 3 J is the statistical graph of TNF-α expression, Figure 3 K Representative Western blot images; Figure 3 L is the statistical graph of Cleaved IL-1β expression; Figure 3 M~3R are Western blot experiments to detect the effect of circRNA-APP on APP / PS1 TG Effects on the protein expression of pro-inflammatory factors TNF-α, Pro-IL-1β and Cleaved IL-1β and anti-inflammatory factor IL-10 in the mouse hippocampus; Figure 3 MRepresentative Western blot images; Figure 3 N is the statistical graph of IL-10 expression; Figure 3O is the statistical graph of Pro-IL-1β expression; Figure 3 P is the statistical graph of TNF-α expression; Figure 3 QRepresentative Western blot images; Figure 3 R is the statistical graph of Cleaved IL-1β expression;

[0032] Figure 4 It is circular RNA circRNA-APP to APP / PS1 TG Effects of apoptosis on neuronal synaptic structure and plasticity in mouse hippocampal neurons

[0033] In the figure, Figure 4 A and 4B are TUNEL experiments to detect the effect of circRNA-APP overexpression on APP / PS1 TG Effects on apoptosis of mouse hippocampal neurons; Figure 4 A is a representative picture of TUNEL; Figure 4 B is a statistical diagram of neuronal apoptosis; Figure 4 C and 4D are TUNEL experiments to detect the effect of circRNA-APP on APP / PS1 TG Effects on apoptosis of mouse hippocampal neurons; Figure 4 C is a representative picture of TUNEL; Figure 4 D is a statistical diagram of neuronal apoptosis; Figure 4 E~4I are Golgi staining experiments to detect the effect of circRNA-APP on APP / PS1 TG Effects on synaptic structural plasticity of mouse hippocampal neurons; Figure 4 E is a representative picture of synapse length and branch number; Figure 4 F) Statistical diagram of synapse length; Figure 4 G is the statistical diagram of the number of synaptic branches; Figure 4 H is a representative picture of synaptic spine density; Figure 4 I is a statistical diagram of synaptic spine density. DETAILED DESCRIPTION

[0034] The present invention can be better understood according to the following examples. However, it is easy for those skilled in the art to understand that the contents described in the examples are only used to illustrate the present invention, and should not and will not limit the present invention described in detail in the claims.

[0035] Example 1: Expression of circular RNA circRNA-APP in various tissues and organs of C57BL / 6 mice (I) Experimental methods:

[0036] 1. RT-PCR experiment:

[0037] (1) Total RNA extraction from tissue samples:

[0038] 1) Experimental preparation: Wash the glass handheld homogenizer, soak it in acid and then rinse it with water 15 times, and sterilize it in the autoclave together with surgical scissors and forceps. Pre-cool chloroform, isopropanol and 75% ethanol in a refrigerator at 4°C. Prepare nuclease-free consumables.

[0039] 2) Weigh the mouse, prepare a 1.5mL centrifuge tube and mark it, remove the mouse's eyeball and collect blood for later use. When the mouse bleeds to death, cut off its head with surgical scissors, peel it on ice, remove the hippocampus, put it in a 1.5mL centrifuge tube, and store it on ice. After the experiment, move the tissue to -80℃ for storage. Take out part of the hippocampus and put it in a small handheld homogenizer, add 800μL Triozl lysis solution, and place the homogenizer on ice. Rotate the homogenizer up and down until the tissue is completely broken, and then pour the Triozl lysis solution into a 2mL nuclease-free centrifuge tube.

[0040] 3) Add chloroform to the above EP tubes one by one at a ratio of 200 μL chloroform / 1 mL Trizol, close the lid, shake the EP tube vigorously up and down for 15 seconds, and let it stand at room temperature for 10 minutes. Prepare a set of 1.5 mL EP tubes without nuclease and mark them.

[0041] 4) Place the EP tube in a low-temperature centrifuge and centrifuge at 12000rpm and 4℃ for 15min. After centrifugation, gently remove the sample. The liquid is now divided into three layers, with RNA being the top aqueous phase, about 400μL. Use a 200μL pipette to draw the upper aqueous phase into another marked centrifuge tube three times, and be sure not to draw the lower layer components.

[0042] 5) Add an equal volume of isopropanol to the above EP tube, close the lid, turn it upside down and gently mix, and let it stand at room temperature for 10 minutes to allow the RNA to fully precipitate.

[0043] 6) Place in a low-temperature centrifuge and centrifuge at 12000rpm and 4℃ for 10min. After centrifugation, slowly pour out the supernatant. The white precipitate at the bottom is the RNA precipitate.

[0044] 7) Add 1 mL of pre-cooled 75% ethanol to the EP tube, use a vortexer to shake until the precipitate floats, and wash the organic phase in the precipitate; put it in a centrifuge, centrifuge at 4°C, 12000 rpm for 10 min, and gently pour off the supernatant.

[0045] 8) Place the EP tube upside down on the table and dry it at room temperature for about 10 minutes until the 75% ethanol is almost completely evaporated.

[0046] 9) Add an appropriate amount (20-50 μL) of nuclease-free water to dissolve the RNA precipitate. Mix by pipetting or gently shake to completely dissolve the precipitate.

[0047] 10) Determine RNA concentration using Nano Drop 1000 Nucleic Acid Analyzer. Wash the injection hole with nuclease-free water before formal measurement. When measuring, measure each sample twice and take the average value. Pay attention to the value of N260 / N280, which should be between 1.8-2.0. Record the RNA concentration of the sample. Store the total RNA sample at -80℃ for later use.

[0048] (2) mRNA reverse transcription: prepare a 200μL nuclease-free EP tube and mark it. Calculate the volume of 1μg RNA according to the RNA concentration, take out the RNA and place it in the EP tube, add nuclease-free water to make the total volume reach 8μL, add 2μL reverse transcription reagent to each sample, and the total of the three is 10μL system. Gently vortex and mix, then centrifuge, place in a PCR machine, set the program to 25℃, 5min, 42℃, 15min, 85℃, 5s, 12℃, 10min denaturation, and immediately put it on ice after denaturation is completed. Store the obtained cDNA at -20℃.

[0049] (3) RT-PCR: The upstream and downstream primer sequences were designed and synthesized by Shanghai Sangon Biotechnology Co., Ltd. Take the primers out of the refrigerator, centrifuge them, and add an appropriate amount of nuclease-free water according to the instructions. Dilute the concentration to 10mM and then divide them into aliquots and store them at -20℃ for future use. The PCR reaction system and primer sequences are shown in the table below. Two replicate wells are set for each sample, and β-actin is used as an internal reference.

[0050] Table 1 PCR reaction system

[0051]

[0052] Table 2 RT-PCR primer sequences

[0053]

[0054] (4) Use LC480Ⅱ real-time fluorescence quantitative PCR instrument for PCR amplification. After adding the sample, seal the PCR-96-well plate with a sealing film, centrifuge at 2000rpm for 5min, and place the plate in the LC480 PCR instrument. Set the computer PCR program as follows: Program 1: Activation: 95℃, 10min; Program 2: PCR: 95℃, 15s; 60℃, 30s, 50cycles; Program 3: Meltingcurves: 95℃, 15s; 60℃, 60s; 95℃; Continuous; Program 4: Cooling: 40℃, 30s. After the reaction is completed, save the experiment, calculate the sample CP value, and export the data using PDF.

[0055] (5) Adopt 2 -△△ct The expression of circRNA in each sample was analyzed.

[0056] 2. RNase digestion experiment: refer to the instructions of the kit (Guangzhou Jisai Biotechnology Co., Ltd.) for specific results. The specific results are as follows: the cultured N2a cells were collected and digested to extract total RNA, and RNase digestion was performed at 37°C for 30 minutes according to the system in Table 3. After digestion, RT-PCR was used to detect the expression of circRNA-APP.

[0057] Table 3 RNase enzyme digestion system

[0058]

[0059] Experimental results: RT-PCR was used to detect the expression of circRNA-APP in different tissues and organs of mice. The results showed that circRNA-APP was highly expressed in the hippocampus and cortex, and was less expressed in the heart, liver, spleen, lung, and kidney ( Figure 1 A). The circular structure of circRNA-APP was detected by RNase digestion experiment, and the results showed that circRNA-APP was more resistant to RNase than linear GAPDH ( Figure 1 B), indicating that circRNA-APP is resistant to RNase digestion. In addition, compared with the control C57BL / 6 mice of the same age, circRNA-APP in APP / PS1 at 3, 6, and 10 months TG The expression in the mouse hippocampus was significantly increased ( Figure 1 C~1E).

[0060] Example 2: Circular RNA circRNA-APP to APP / PS1 TG Effects on cognitive function of mice (I) Experimental methods:

[0061] 1. Construction of circRNA-APP overexpression and interference AAV virus carrying microglia-specific promoter

[0062] Plasmid vectors for circRNA-APP overexpression (pAAV-CX3CR1-circRNA-APP-APP-WPRE) and circRNA-APP interference (pAAV-CX3CR1-EGFP-miR-30-shcircRNA-APP-WPRE) carrying the microglia-specific promoter CX3CR1 were purchased from Heyuan Biotechnology Co., Ltd. The plasmid was transfected into 293T cells. After 72 hours, the cell supernatant was collected and the virus was purified using a heparin-agarose column. After purification and concentration, the virus particles were divided into virus tubes and stored in liquid nitrogen for later use.

[0063] 2. Hippocampal localization injection of circRNA-APP overexpression and AAV virus interference

[0064] Mice were anesthetized with a mixed anesthetic of ketamine (80 mg / kg) + xylazine (8 mg / kg) and fixed on a brain stereotaxic instrument. The injection coordinates were: 1.7 mm behind the anterior fontanelle, 2.5 mm lateral, and 2.25 mm deep. AAV particles were slowly injected at a rate of 0.1 μL / min, and the needle was retained for 15 min to allow the solution to diffuse fully. After the hippocampal localization injection, the wound was sutured, iodine and gel were applied to the wound, and 5% carprofen injection was injected intraperitoneally at a volume of 0.2 mL / 10 g every other day for anti-inflammatory analgesia. At the same time, 0.2 million units / day of penicillin was injected intraperitoneally for antibacterial, once a day, for a total of 5 days.

[0065] 3. Preparation of paraffin sections

[0066] (1) Paraformaldehyde fixation After the animal is deeply anesthetized, the abdomen is dissected, the heart is exposed, the right atrial appendage is cut open, and a venous puncture needle is inserted from the apex of the heart (left ventricle). Pre-cooled saline is injected until the liquid flowing out of the right atrial appendage is transparent and the organ turns white. After the blood in the body is drained, 150 mL of 4% paraformaldehyde is slowly injected until the mouse body is completely stiff. The brain is then dissected and immersed in 4% paraformaldehyde.

[0067] (2) Tissue dehydration and paraffin embedding. Repair the brain tissue to an appropriate size and use a tissue program dehydrator to dehydrate according to the program: 75% ethanol for 1 hour, 85% ethanol for 1 hour, 95% ethanol for 1 hour, 95% ethanol for 1 hour, anhydrous ethanol for 1 hour, anhydrous ethanol for 1 hour, xylene I for 1 hour, xylene II for 1 hour, 65℃ paraffin I for 1 hour, 65℃ paraffin II for 1 hour, 65℃ paraffin III for 1 hour. After dehydration, fix the tissue in a paraffin embedding box and store the embedded tissue at 4℃.

[0068] (3) Paraffin sectioning: Fix the embedded paraffin tissue on the paraffin slicer, set the slice thickness to 4 μm, and set the water temperature of the slice bleaching machine to 40°C. Bleach the cut wax slices first, and after they are completely spread out, use a brush to gently push the tissue onto the slide, spread the slices at 37°C for 2 hours until the water on the slide is completely dry, place the slices at 60°C for 4 hours, and finally bake the slices at 37°C overnight.

[0069] (4) Conventional dewaxing and hydration: soak in xylene I for 5 min; soak in xylene II for 5 min; soak in anhydrous ethanol for 3 min; soak in 90% ethanol for 3 min; soak in 80% alcohol for 3 min; after dewaxing and hydration, rinse with PBS 3 times, 5 min each time.

[0070] 4. Immunofluorescence

[0071] (1) Antigen repair of paraffin sections: Prepare sodium citrate buffer and place the sections in a histochemical box for microwave repair. The microwave program is high heat for 5 minutes, then low heat for 15 minutes. Then take out the microwaved sections and let them cool naturally. Place the sections in a jar containing PBS and wash them three times, 5 minutes each time, and wipe off the liquid around the tissue sections.

[0072] (2) Membrane disruption: 0.2% Triton-100 was used to disrupt the membrane for 15 min, and then the tissue was washed three times with PBS for 5 min each time, and the liquid around the tissue slices was wiped off.

[0073] (3) Blocking: Incubate with 10% normal goat serum at room temperature for 15 min, then discard without washing.

[0074] (4) Shake off excess liquid, add the pre-prepared primary antibody, and place in an incubation box at 4°C overnight.

[0075] (5) Take out the tissue slices from 4°C and rewarm them for 30 minutes. Wash them with PBS three times for 5 minutes each time. Wipe off excess liquid around the tissue slices for the last wash.

[0076] (6) Add fluorescent secondary antibody, incubate at 37°C in the dark for 1 h, and wash with PBS three times for 5 min each time.

[0077] (7) DAPI staining for 5 min, wash with PBS 3 times for 5 min each time. After wiping off excess water for the last time, seal the slides, examine under a microscope, and take photos for preservation.

[0078] 5. Morris water maze:

[0079] (1) Adaptive training: Add water to the water maze and set the water temperature to 21°C. Set up the ANYmaze behavioral analysis system, divide the water maze into four quadrants, name them SW, SE, NE, and NW in a clockwise direction, set the animal color, and the total experimental time is 60 seconds; the software records parameters including the average swimming speed of the mouse, the swimming distance, the stay time in each quadrant, the average distance from the platform, the time required to first board the platform (escape latency), the swimming trajectory, etc.; place the platform and make the water surface slightly higher than the platform by one knuckle height. During the experiment, try to keep the room quiet and dark to avoid external factors interfering with the mice. One day before the experiment, all mice were given adaptive training to screen out drowned mice or weak mice with slow swimming speed.

[0080] (2) Positioning and navigation experiment: All experimental mice were placed into the water from the four quadrants one by one, with their heads facing the wall of the water maze. At the same time, ANYmaze software was started to record and track the swimming trajectory of the mice. For mice that failed to climb onto the platform within 60 seconds, a wooden stick was used to guide them to slowly climb onto the platform and stay there for 10 seconds. For mice that found the platform within 60 seconds, records were kept and allowed to stay on the platform for 10 seconds. After the end, the mice were wiped dry with a dry cloth. All mice were placed into the water in a uniform quadrant order and position, and the training lasted for 4 consecutive days.

[0081] (3) Spatial exploration experiment: On the fifth day of the experiment, the platform was removed and the mice were placed in the water from the diagonal quadrant of the platform. The time it took for the mice to pass through the quadrant where the platform was located (quadrant time) was measured and the percentage of time in the platform quadrant was calculated (quadrant time / 60s*100). The mice’s memory of the platform location was tested and the effects of different treatment groups on the mice’s memory and learning cognitive abilities were evaluated.

[0082] 6. Light-dark box experiment: On the first day of the experiment, mice were placed alone in the light box to adapt for 5 minutes, and then the dark box channel was opened to allow mice to enter the dark box, which was powered on for 5 minutes (voltage: 36V). 24 hours after training, mice were placed in the light box, and the time when the mice entered the dark box (step-through latency) was recorded. If the mice did not enter the dark box within 5 minutes, the step-through latency of the mice was recorded as 300 seconds. The longer the step-through latency of mice, the stronger their learning and memory ability.

[0083] 7. New object recognition experiment:

[0084] Adaptive training: Three days before the formal experiment, place a 50 cm square opaque black glass open box in a quiet laboratory, called an open field. Place the mice in the open field for 20 minutes every day to adapt to the environment. Prepare multiple objects of uniform size, different shapes, and the same color.

[0085] Formal experiment: On the first day, two objects of the same shape, size and color were placed in the open field and marked as old objects. Each mouse was then placed in the open field for 10 minutes, and the time the mouse spent exploring the two objects was observed and recorded. After each mouse finished the experiment, the open field and objects were wiped with 75% ethanol to prevent the influence of odor on the experiment. On the second day, one of the old objects was replaced with another object of the same color and size but different shape, marked as a new object. The new and old objects were placed in the open field, and mice were placed at the same time. Each mouse was observed for 10 minutes, and the time the mouse spent exploring the new and old objects was recorded. The results were expressed as the distinguishing index (DI). The calculation formula for the distinguishing index is: DI = N / (N+F) 100%, where N is the time spent exploring the new object, and F is the time spent exploring the old object.

[0086] (II) Experimental results

[0087] 1. Overexpression and interference effect of circRNA-APP carrying microglia-specific promoter CX3CR1

[0088] In order to clarify the role of circRNA-APP in APP / PS1 TG To investigate the effect of circRNA-APP overexpression (pAAV-CX3CR1-circRNA-APP-APP-WPRE) and circRNA-APP interference (pAAV-CX3CR1-miR-30-shcircRNA-APP-WPRE) AAV viruses carrying the microglia-specific promoter CX3CR1 were injected into APP / PS1 TG In the mouse hippocampus, after 6 weeks, the localization of blank plasmid virus carrying green fluorescence and microglia marker protein Iba-1 (red) was observed by immunofluorescence IF experiment. The results showed that most of the virus fluorescence overlapped with Iba-1 protein (orange-yellow), indicating that AAV carrying microglia promoter CX3CR1 can specifically infect microglia ( Figure 2 A). In addition, RT-PCR was used to detect the expression of circRNA-APP, e.g. Figure 2 As shown in B and 2C, compared with the corresponding blank virus group, the expression of circRNA-APP in the hippocampus of mice in the circRNA-APP overexpression group was significantly increased, and the expression of circRNA-APP in the hippocampus of mice in the circRNA-APP interference group was significantly decreased, indicating that the AAV virus infection effect was better.

[0089] 2. Morris water maze test results

[0090] Morris water maze results showed that overexpression of circRNA-APP significantly reduced the expression of APP / PS1 compared with the blank virus group. TG The percentage of mouse platform quadrant time; interference with circRNA-APP can significantly increase APP / PS1 TG The percentage of time in the platform quadrant suggests that circRNA-APP overexpression can reduce APP / PS1 TG The learning and memory ability of mice was affected by circRNA-APP, while interference with circRNA-APP could improve APP / PS1 TG Learning and memory ability of mice Figure 2 D and 2E).

[0091] 3. Results of the light and dark box experiment

[0092] Depend on Figure 2 As shown in F and 2G, compared with the blank virus group, APP / PS1 in the circRNA-APP overexpression group TG The dark latency of mice was significantly shortened, suggesting that circRNA-APP overexpression can reduce APP / PS1 TG In addition, compared with the blank virus group, the APP / PS1 TG The dark latency of mice was significantly prolonged, suggesting that circRNA-APP interference can increase APP / PS1 TG Memory ability of mice.

[0093] 4. Experimental results of new and old objects

[0094] Depend on Figure 2 As shown in H and 2I, compared with the corresponding blank virus group, overexpression of circRNA-APP significantly reduced APP / PS1 TG The percentage of time mice spend exploring new objects; interference with circRNA-APP can significantly increase APP / PS1 TG The percentage of time mice spent exploring novel objects suggests that overexpression of circRNA-APP can impair APP / PS1 TG Mice's ability to recognize new objects, while interference with circRNA-APP can improve APP / PS1 TG The ability of mice to recognize novel objects.

[0095] In summary, the above experiments show that overexpression of circRNA-APP can damage APP / PS1 TG Mouse cognitive function; interference with circRNA-APP can improve APP / PS1 TG Cognitive function.

[0096] Example 3, circular RNAcircRNA-APP to APP / PS1TG Effects of Aβ expression, tau phosphorylation, and pro-inflammatory and anti-inflammatory factor expression in mouse hippocampus (I) Experimental methods:

[0097] 1. Western blot experiment:

[0098] (1) Leak detection: After thoroughly cleaning the rubber sheet, assemble it onto the rubber rack. Use a spray bottle to fill the rubber sheet with double distilled water. After 10 minutes, observe whether the rubber sheet is leaking. After confirming that there is no leakage, pour out the water and turn the rubber rack upside down to dry.

[0099] (2) Glue preparation: Prepare the lower layer of glue in a clean small beaker according to the ratio in Table 4. After adding the reagents, stir and mix quickly. Use a pipette to slowly add the mixture to the glue plate to avoid adding bubbles. Be careful not to fill it up. The liquid level should be 4 cm below the small plate. In order to flatten the lower layer of glue, gently add double distilled water until it is full. Wash the comb and dry it. After 35 minutes, the lower layer of glue solidifies and the upper layer of double distilled water is discarded. Prepare the upper layer of glue and add it to the glue plate, insert the comb. Let it stand for 30 minutes to solidify.

[0100] (3) Sample loading: Remove the comb, place the gel plate into the electrophoresis tank, fill the tank with 1× electrophoresis solution, and use a 10 μL pipette to add protein sample according to the sample volume for protein quantification.

[0101] (4) Electrophoresis: After loading, add electrophoresis solution to the outer tank and plug in the power supply according to the positive and negative poles. Set the electrophoresis program: Program 1: 60V, 30min; Program 2: 110V, 100min.

[0102] (5) Semi-dry transfer: Prepare the NC membrane and thick filter paper in advance and soak them in semi-dry transfer solution for 5 minutes. Place the moistened thick filter paper in the center of the semi-dry transfer instrument, and then place the NC membrane on the thick filter paper. After the electrophoresis is completed, cut the gel of the target protein according to the position of the marker based on the protein molecular weight, and transfer it to the NC membrane in parallel. During the process, add semi-dry transfer solution to prevent the NC membrane from drying, and carefully remove the bubbles between the NC membrane and the gel. Press another thick filter paper on the gel and cover the lid of the semi-dry transfer instrument. Turn on the power, set the constant voltage to 15V, and transfer for 35 minutes.

[0103] (6) Blocking: After the transfer is completed, remove the NC membrane with tweezers, wash it three times with TBST on a shaker, and then place it in the blocking solution and block it on a shaker for 1 hour.

[0104] (7) Primary antibody incubation: Dilute with primary antibody diluent according to the ratio in the primary antibody instructions, mix well and place in the incubation box, then place the NC membrane and incubate overnight at 4°C. Be careful to avoid bubbles on the membrane.

[0105] (8) Secondary antibody incubation: After overnight at 4°C, remove the NC membrane and rewarm it for 30 minutes. Wash it three times with TBST on a shaker, shaking rapidly for 5 minutes each time. Dilute the secondary antibody at a ratio of 1:10,000, place the secondary antibody and NC membrane in the secondary antibody incubation box, and incubate it on a shaker for 1 hour. Then wash it three times with TBST, shaking rapidly for 5 minutes each time. Note that it should be kept away from light during and after the use of the secondary antibody.

[0106] (9) Color development: The NC membrane was sandwiched between filter paper and blotted dry, scanned with an EPSON scanner, and the image was saved. The protein bands were analyzed by grayscale analysis using Image J software, with GAPDH as the internal reference.

[0107] Table 4 Polyacrylamide separation gel and concentration gel formula

[0108]

[0109] (II) Experimental results

[0110] Compared with the corresponding blank virus group, overexpression of circRNA-APP significantly increased APP / PS1 TG Expression of phosphorylated tau protein and Aβ in mouse hippocampus ( Figure 3 A~3C), while interference with circRNA-APP could significantly reduce APP / PS1 TG Expression of phosphorylated tau protein and Aβ in mouse hippocampus ( Figure 3 D~3F). In addition, compared with the corresponding blank virus group, overexpression of circRNA-APP significantly increased APP / PS1 TG The expression of pro-inflammatory factors TNF-α, Pro-IL-1β and Cleaved IL-1β in the mouse hippocampus was inhibited, and the expression of anti-inflammatory factor IL-10 was inhibited ( Figure 3 G~3L), while interference with circRNA-APP could significantly reduce APP / PS1 TG The expression of pro-inflammatory factors TNF-α, Pro-IL-1β and Cleaved IL-1β in the mouse hippocampus was increased, and the expression of anti-inflammatory factor IL-10 was increased ( Figure 3 These results indicate that overexpression of circRNA-APP can promote neuroinflammation, Aβ production, and tau phosphorylation in AD mice, while interference with circRNA-APP can inhibit neuroinflammation, Aβ production, and tau phosphorylation in AD mice.

[0111] Example 4: Circular RNA circRNA-APP to APP / PS1 TG Effects of apoptosis on neuronal synaptic structure and plasticity in mouse hippocampal neurons

[0112] 1. Experimental methods

[0113] 1. Golgi experiment:

[0114] (1) Tissue preparation: The animal is deeply anesthetized before sampling, and the brain of the animal is quickly removed from the skull. Be very careful during the operation to avoid damaging or compressing the tissue. Use double distilled water to quickly clean the blood on the surface of the brain tissue, and place the brain tissue in a staining solution mixed with solution A and solution B that has been mixed 24 hours in advance. Each brain tissue requires at least 5 times the volume of AB mixed solution. After soaking for 24 hours, replace the AB mixed solution and soak for 14 consecutive days. Keep it away from light, and the AB liquid cannot come into contact with metal. After 14 days, replace it with 5 times the volume of solution C; replace solution C again after 24 hours, and soak it for 3 days to 1 week before it can be used for slicing.

[0115] (2) Sectioning and staining:

[0116] 1) Slicing: Fix the brain tissue on a vibrating slicer in the dark, adjust the appropriate amplitude and slicing speed to prevent the amplitude from being too large and the speed from being too fast, which may cause tissue fragmentation, or the speed from being too large and the amplitude from being too small, which may damage the tissue. Cut the brain tissue into 100 μm slices in PBS solution; collect the slices on a glass slide, add a small amount of solution C and soak for 5 minutes, then dry the solution C and use a paper towel to absorb the solution C on the brain tissue; finally, air-dry the slices in the dark and use them for staining. The sliced ​​slices can be stored at room temperature for up to 3 days.

[0117] 2) Staining: Wash the brain slices twice with double distilled water, 4 minutes each time; prepare the staining solution by mixing solution D, solution E, and double distilled water in a ratio of 1:1:2, gently dripping on the brain slices, and staining for 10 minutes; rinse the slices twice with double distilled water, 4 minutes each time, and replace with new double distilled water each time;

[0118] 3) Dehydration and transparency: Dehydrate the sections in 50%, 75% and 95% ethanol, with each concentration gradient dehydration for 4 minutes; then dehydrate the sections in anhydrous ethanol, 4 times, 4 minutes each time; transparentize in xylene, 3 times, 4 minutes each time, and finally quickly seal the sections with neutral resin sealing media. Be careful to avoid bubbles when aspirating the neutral resin sealing media.

[0119] 4) Data statistics: Image J software and Neuron J plug-in were used to process Golgi images of neurons, identify neuronal morphology and measure length. The number and length of secondary branches of neurons in the hippocampal neurons in the CA1 region of brain slice images were counted, and the differences in neurons among the groups were compared. Image J counting function was used to count the number and length of dendritic spines and to calculate the density of dendritic spines.

[0120] 2. Nissl staining experiment

[0121] The TUNEL kit was purchased from Meilun Biotechnology Co., Ltd., and the specific method was carried out according to the instructions. Specifically, the tissue paraffin sections were made and dewaxed to water (the specific method was carried out according to the method in Example 3), and the tissue was incubated with Proteinase K working solution at 37°C for 20 minutes. Rinse with PBS twice. Prepare the TUNEL reaction mixture, and mix 50μl TdT+450μl fluorescein-labeled dUTP solution with the treatment group; while the negative control group only added 50μl fluorescein-labeled dUTP solution, and the positive control group first added 100μl DNase 1, and reacted at 25°C×10min. After the slides were dry, 50μl TUNEL reaction mixture was added to the specimen, and a cover glass or sealing film was added to react in a dark humid box at 37°C×1h. Rinse 3 times with PBS, add 1 drop of PBS to count apoptotic cells under a fluorescence microscope (excitation wavelength is 500nm, detection wavelength is 565nm); add 50μl converter-POD to the specimen after the slide is dry, cover the slide or seal film in a dark and humid box at 37℃×30min. Rinse 3 times with PBS, add 50-100μl DAB substrate to the tissue, react at 15-25℃×10min; rinse 3 times with PBS; counterstain with hematoxylin or methyl green after taking pictures, and rinse with tap water immediately after a few seconds. Dehydrate with gradient alcohol, make it transparent with xylene, and seal the slide with neutral gum. Add a drop of PBS or glycerol in the field of view, observe apoptotic cells (a total of 200-500 cells) with an optical microscope and take pictures.

[0122] (II) Experimental results

[0123] The results of TUNEL experiments showed that overexpression of circRNA-APP could significantly increase APP / PS1 TG Apoptosis of mouse hippocampal neurons; interference with circRNA-APP can significantly reduce APP / PS1 TG Mouse hippocampal neuron apoptosis Figure 4 A~4D). The results of Golgi experiment showed that interference with circRNA-APP could significantly increase APP / PS1 TG Branch number, length and dendritic spine density of mouse hippocampal neurons ( Figure 4 E~4I), which indicates that interference with circRNA-APP can improve APP / PS1 TG These results suggest that interference with circRNA-APP can alleviate APP / PS1 TG Neuronal injury in mice enhances synaptic structural plasticity.

[0124] In summary, circular RNA circRNA-APP can be used as a target for the preparation of drugs for the treatment or prevention of neurodegenerative diseases, providing new ideas for the research and development of drugs for the prevention and treatment of neurodegenerative diseases including Alzheimer's disease.

[0125] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, a person skilled in the art should understand that it is still possible to modify the technical solutions described in the aforementioned embodiments, or to perform equivalent replacements on some of the technical features therein. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. The use of circular RNA circRNA-APP in the preparation of a drug for treating or preventing neurodegenerative diseases, characterized in that: The sequence of the circular RNA circRNA-APP is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The medicine is prepared into a liquid preparation or a solid preparation.

3. The use according to claim 2, characterized in that: The medicine is prepared into injection, oral liquid, granules, powder, tablets or capsules.

4. The use according to claim 1, characterized in that: The circular RNA circRNA-APP is carried by a virus or a plasmid, wherein the plasmid is pAAV-CX3CR1-circRNA-APP-WPRE or pAAV-CX3CR1-EGFP-miR-30shRNA-WPRE; the virus is AAV virus.

5. Use of circular RNA circRNA-APP in the preparation of a drug for treating or preventing dementia, characterized in that: The sequence of the circular RNA circRNA-APP is shown in SEQ ID NO.

1.

6. Use of circular RNA circRNA-APP in the preparation of a drug for treating or preventing Alzheimer's disease, characterized in that: The sequence of the circular RNA circRNA-APP is shown in SEQ ID NO.

1.

7. Use of circular RNA circRNA-APP in the preparation of a drug for treating or preventing neuronal damage, neuroinflammation, neuronal apoptosis or cognitive damage in the nervous system, characterized in that: The sequence of the circular RNA circRNA-APP is shown as SEQ ID NO.

1.

8. Use of circular RNA circRNA-APP in the preparation of drugs for inhibiting the production of amyloid β and phosphorylation of tau protein, characterized in that: The sequence of the circular RNA circRNA-APP is shown in SEQ ID NO.

1.

9. Use of circular RNA circRNA-APP in the preparation of a drug for improving the plasticity of neuronal synaptic structure, characterized in that: The sequence of the circular RNA circRNA-APP is shown in SEQ ID NO.

1.

10. A pharmaceutical composition containing circular RNA circRNA-APP, characterized in that: It uses the circular RNA circRNA-APP interfering AAV virus described in claim 1 as an active ingredient or a main active ingredient, and is supplemented with a pharmaceutically acceptable carrier.

Images