Construction method of neuronal cell model for silencing ADNP gene

Abstract

The invention relates to the technical field of medical engineering. The invention provides a reagent for silencing an ADNP gene. The reagent comprises shRNA (short hairpin Ribonucleic Acid) plasmid for knocking down the ADNP gene. The invention also provides a construction method of the neuronal cell model for silencing the ADNP gene, the lentivirus containing the shRNA sequence for knocking down the ADNP gene is obtained by using the shRNA plasmid for knocking down the ADNP gene, then Neuro-2a cells are transfected, and a stably transfected cell line is screened out through drugs, so that the neuronal cell model capable of stably silencing the ADNP gene is successfully constructed. The stable cell model can be successfully constructed, has the advantages of simplicity, convenience, easiness in obtaining and the like compared with an animal model, has good cell viability, is easy to culture, can be more conveniently and quickly applied to experiments, and has a good application value for research on the aspect of cytoskeleton microtubules.

Description

Technical Field

[0001] The invention relates to the field of medical engineering technology, and in particular to a method for constructing a neuron cell model for silencing ADNP genes. Background Art

[0002] Activity-dependent neuroprotectin (ADNP) is essential for brain formation and cognitive function. Existing studies have shown that ADNP is mutated in autism and is associated with neurodegenerative and psychiatric disorders. Pure and ADNP knockout mouse embryos show central nervous system dysplasia and die in utero; heterozygous ADNP knockout mice survive but show cognitive dysfunction and microtubule pathology; mice with ADNP gene silencing in the prefrontal cortex also show cognitive deficits and synaptic dysregulation associated with neurodevelopmental disorders. ADNP affects microtubule dynamics by directly binding to microtubule end-binding protein (EB). Although many studies on ADNP have been reported in recent years, these studies have basically been conducted in animal models, and studies on ADNP regulation of microtubules in cell models are still rare. Summary of the invention

[0003] The purpose of the present invention is to provide a method for constructing a neuronal cell model for silencing the ADNP gene, using a shRNA plasmid for knocking down the ADNP gene to obtain a lentivirus containing an shRNA sequence for knocking down the ADNP gene, and then transfecting Neuro-2a cells to successfully construct a neuronal cell model that can stably silence the ADNP gene.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The invention provides a reagent for silencing ADNP gene, comprising a shRNA plasmid for knocking down the ADNP gene.

[0006] Preferably, the functional sequence in the shRNA plasmid for knocking down the ADNP gene includes shRNA1, shRNA2 or shRNA3.

[0007] Preferably, the sequence of the shRNA1 is shown as SEQ ID NO.1, the sequence of the shRNA2 is shown as SEQ ID NO.2, and the sequence of the shRNA3 is shown as SEQ ID NO.3.

[0008] The present invention also provides a method for constructing a neuron cell model for silencing the ADNP gene, comprising the following steps:

[0009] (1) configuring a transfection system comprising the shRNA plasmid for knocking down the ADNP gene and a lentiviral packaging auxiliary plasmid to co-transfect the cells to be transfected, then separating the lentiviral supernatant, filtering and concentrating it to obtain a lentiviral concentrate;

[0010] (2) The Neuro-2a cell suspension is inoculated into a culture medium for culture, and then the above-mentioned lentiviral concentrate is added for transfection, and then the culture medium containing the above-mentioned lentiviral concentrate is discarded, and new culture medium and screening drugs are added for stable transfection culture.

[0011] Preferably, the transfection system in step (1) comprises a plasmid mixture A and a transfection reagent lipo3000 dilution B.

[0012] Preferably, the lentiviral packaging helper plasmid comprises a lentiviral packaging helper plasmid 1 、 and lentiviral packaging helper plasmid 2.

[0013] Preferably, the plasmid mixture A comprises 240-260 μL Opti-MEM, 1-1.4 μg of the shRNA plasmid for knocking down the ADNP gene, 0.8-1 μg of lentiviral packaging helper plasmid 1, 0.5-0.7 μg of lentiviral packaging helper plasmid 2 and 5-6 μL of transfection reagent P3000.

[0014] Preferably, the concentration in step (1) includes a centrifugation treatment, the centrifugation speed is 2800-3200g, the centrifugation time is 8-12min, and the centrifugation temperature is 3-5°C.

[0015] Preferably, the concentration of the Neuro-2a cell suspension in step (2) is (1-3)×10 4 Pieces / mL.

[0016] Preferably, the MOI value of Neuro-2a cells in step (2) is 155-165.

[0017] Preferably, the screening drug in step (2) is puromycin, and the concentration of puromycin is 2-3 μg / mL.

[0018] Preferably, the culture temperature in step (2) is 35-38°C.

[0019] The present invention also provides the use of the ADNP gene silencing neuron cell model obtained by the construction method in screening products for regulating the expression level of microtubule-associated proteins and / or microtubule proteins.

[0020] By adopting the above technical solution, the present invention has the following beneficial effects:

[0021] In the technical solution of the present invention, the shRNA plasmid for knocking down the ADNP gene is used to obtain a lentivirus containing the shRNA sequence for knocking down the ADNP gene, and then Neuro-2a cells are transfected, and a stable transfection cell line is screened out by drugs, and a neuronal cell model that can stably silence the ADNP gene is successfully constructed. The present invention can successfully construct a stable cell model, which has the advantages of being simple and easy to obtain relative to animal models, and the cells have good activity and are easy to culture, and can be more conveniently and quickly applied to experiments, and has good application value for research on cytoskeleton microtubules. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is the ADNP mRNA expression level in different plasmids ( Figure 1 ** indicates P < 0.01, *** indicates P < 0.001);

[0023] Figure 2 The transfection status and ADNP protein expression levels of Neuro-2a cells in different treatment groups ( Figure 2 A in the figure indicates the transfection status of different treatment groups, B indicates the WB band diagram of ADNP protein in different treatment groups, and C indicates the relative expression level of ADNP protein in different treatment groups; ** indicates P < 0.01);

[0024] Figure 3 is the expression level of microtubule-associated proteins and tubulin in Neuro-2a cells in different treatment groups ( Figure 3 A in the figure represents the WB band diagram of microtubule-associated proteins, B represents the statistical diagram of the relative expression of microtubule-associated proteins, C represents the WB band diagram of tubulin, and D represents the statistical diagram of the relative expression of tubulin; * represents P < 0.05, ** represents P < 0.01, and *** represents P < 0.001);

[0025] Figure 4 This is the COIP electrophoresis diagram of ADNP and MAP6 in Neuro-2a cells. DETAILED DESCRIPTION

[0026] The invention provides a reagent for silencing an ADNP gene, wherein the reagent comprises a shRNA plasmid for knocking down the ADNP gene.

[0027] In the present invention, the functional sequence in the shRNA plasmid for knocking down the ADNP gene preferably includes shRNA1, shRNA2 or shRNA3. The sequence of shRNA1 of the present invention is shown in SEQ ID NO.1, and the specific sequence is 5'-GCCTACAGATACCCTACTCAA-3'; the sequence of shRNA2 is shown in SEQ ID NO.2, and the specific sequence is 5'-GGGCAGTCACACCAACATTCA-3'; the sequence of shRNA3 is shown in SEQ ID NO.3, and the specific sequence is 5'-GCACTTGCACATCATTTACGA-3'.

[0028] In the present invention, when the functional sequence in the shRNA plasmid that knocks down the ADNP gene is preferably shRNA1, the plasmid vector information is LV-U6-shRNA1(ADNP)-CMV-EGFP-T2A-Puro-WPRE, and the plasmid is numbered LV-1695. When the functional sequence in the shRNA plasmid that knocks down the ADNP gene is preferably shRNA2, the plasmid vector information is LV-U6-shRNA2(ADNP)-CMV-EGFP-T2A-Puro-WPRE, and the plasmid is numbered LV-1696. When the functional sequence in the shRNA plasmid that knocks down the ADNP gene is preferably shRNA3, the plasmid vector information is LV-U6-shRNA3(ADNP)-CMV-EGFP-T2A-Puro-WPRE, and the plasmid is numbered LV-1697.

[0029] The present invention also provides a method for constructing a neuron cell model for silencing the ADNP gene, comprising the following steps:

[0030] (1) configuring a transfection system comprising the shRNA plasmid for knocking down the ADNP gene and a lentiviral packaging auxiliary plasmid to co-transfect the cells to be transfected, then separating the lentiviral supernatant, filtering and concentrating it to obtain a lentiviral concentrate;

[0031] (2) After the Neuro-2a cell suspension is inoculated into the culture medium, the above-mentioned lentiviral concentrate is added for transfection, and then the culture medium containing the above-mentioned lentiviral concentrate is discarded, and new complete culture medium and screening drugs are added for stable transfection culture.

[0032] In the present invention, a transfection system comprising the shRNA plasmid for knocking down the ADNP gene and a lentiviral packaging auxiliary plasmid is first configured. The lentiviral packaging auxiliary plasmid of the present invention preferably includes lentiviral packaging auxiliary plasmid 1 and lentiviral packaging auxiliary plasmid 2, and further preferably lentiviral packaging auxiliary plasmid 1 psPAX2 and lentiviral packaging auxiliary plasmid 2 pMD2.G.

[0033] In the present invention, the transfection system includes a plasmid mixture A and a transfection reagent lipo3000 dilution B, wherein the plasmid mixture A includes Opti-MEM, the shRNA plasmid for knocking down the ADNP gene, a lentiviral packaging auxiliary plasmid 1, a lentiviral packaging auxiliary plasmid 2 and a transfection reagent P3000. The dosage of Opti-MEM in the present invention is preferably 240-260 μL, further preferably 245-255 μL, and further preferably 250 μL; the dosage of the shRNA plasmid for knocking down the ADNP gene is preferably 1-1.4 μg, further preferably 1.1-1.3 μg, and further preferably 1.2 μg; the dosage of the lentiviral packaging auxiliary plasmid 1 is preferably 0.8-1 μg, further preferably 0.85-0.95 μg, and further preferably 0.9 μg; the dosage of the lentiviral packaging auxiliary plasmid 2 is preferably 0.5-0.7 μg, further preferably 0.55-0.65 μg, and further preferably 0.6 μg; the dosage of the transfection reagent P3000 is preferably 5-6 μL, further preferably 5.2-5.8 μL, and further preferably 5.4 μL. The transfection reagent lipo3000 dilution solution B in the present invention is preferably obtained by mixing Opti-MEM and Lipo3000, and the volume ratio of the mixture of Opti-MEM and Lipo3000 is preferably 250:(5-9), further preferably 250:(6-8), and further preferably 250:7.5.

[0034] In the present invention, the transfection reagent lipo3000 dilution B is preferably gently added to the plasmid mixture A, mixed evenly and allowed to stand to obtain the transfection system, and the standing time is preferably 18-23 minutes, further preferably 19-22 minutes, and further preferably 20 minutes.

[0035] In the present invention, the cells to be transfected are preferably inoculated into a DMEM medium containing 10% FBS, and replaced with a serum-free basal DMEM medium 1 hour before transfection, and then the transfection system is added for transfection. The transfection in the present invention is preferably performed in an incubator, and the temperature of the incubator is preferably 35-38°C, further preferably 36-37.5°C, and further preferably 37°C. Preferably, the present invention discards the supernatant after 8-12 hours of transfection, replaces the serum-free basal DMEM medium with a DMEM complete medium, and continues the transfection culture for 2 days.

[0036] In the present invention, the culture fluid is collected on the 3rd day of transfection culture, cell debris is removed, and the lentiviral supernatant is separated. The present invention is preferably carried out by centrifugation, and the centrifugal speed is preferably 450-550g, further preferably 480-520g, and further preferably 500g; the centrifugal time is preferably 8-12min, further preferably 9-11min, and further preferably 10min.

[0037] In the present invention, the obtained lentiviral supernatant is filtered and concentrated to obtain a lentiviral concentrate. The filtration specification of the present invention is preferably 0.2-0.25μm, and further preferably 0.22μm. The present invention preferably includes centrifugation before concentration, and the centrifugal speed is preferably 2800-3200g, further preferably 2900-3100g, and further preferably 3000g; the centrifugal time is preferably 8-12min, further preferably 9-11min, and further preferably 10min; the centrifugal temperature is preferably 3-5°C, further preferably 3.5-4.5°C, and further preferably 4°C. The concentration of the present invention is preferably carried out using a 100KD concentration tube.

[0038] In the present invention, Neuro-2a cell suspension is inoculated into DMEM complete medium for culture, and then the above-mentioned lentiviral concentrate is added for transfection. The concentration of the Neuro-2a cell suspension in the present invention is preferably (1-3)×10 4 / mL, and more preferably (1.5-2.5)×10 4 / mL, and more preferably 2×10 4 / mL; the MOI value of the Neuro-2a cells is preferably 155-165, further preferably 158-162, and further preferably 160. The culture in the present invention is preferably carried out in a 37°C, 5% CO2 incubator, and subsequent treatment is performed after incubation overnight. In the present invention, it is preferably necessary to replace a new complete culture medium before adding the lentivirus concentrate. In the present invention, the transfection time is preferably 6-10h, further preferably 7-9h, and further preferably 8h; the transfection is preferably carried out in a 37°C, 5% CO2 incubator.

[0039] In the present invention, the culture medium containing the above-mentioned lentiviral concentrate is discarded, and a new complete culture medium is added to culture in a 37°C, 5% CO2 incubator. The culture time is preferably 68-75h, further preferably 70-73h, and further preferably 72h. After the culture is completed, the screening drug is added to screen the stable cell line, that is, the Neuro-2a neuronal cell model that can stably silence the ADNP gene is successfully constructed. The screening drug in the present invention is preferably puromycin, and the concentration of puromycin is preferably 2-3μg / mL, further preferably 2.2-2.8μg / mL, and further preferably 2.5μg / mL. After adding puromycin in the present invention, it is preferably placed in a 5% CO2 incubator for screening and culture, and the screening and culture time is preferably 45-50h, further preferably 47-49h, and further preferably 48h; the screening and culture temperature is preferably 35-38°C, further preferably 36-37.5°C, and further preferably 37°C.

[0040] The present invention also provides the use of the ADNP gene silenced neuron cell model obtained by the construction method in screening products for regulating the expression level of microtubule-associated proteins (MAPs) and / or tubulin.

[0041] In the present invention, the microtubule-associated proteins preferably include MAP6, MAP2, Tau and p-Tau, and the microtubule proteins preferably include α-Tubulin and Acetyl-Tubulin.

[0042] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0043] Example 1 (one)

[0045] Three interference sequences shRNA1, shRNA2 and shRNA3 were designed for the ADNP gene silencing group (see Table 1), and then the corresponding shRNA plasmids for knocking down the ADNP gene were constructed based on the three interference sequences, and the corresponding plasmids were constructed by Wuhan Shumi Brain Science Technology Co., Ltd. (see Table 2).

[0046] The Gene ID of the ADNP gene is 11538, wherein the present invention designs shRNA based on NM_001310086.1.

[0047] Table 1 Interference sequences for silencing ADNP gene

[0048] sequence name Sequence information (5'→3') serial number shRNA1 GCCTACAGATACCCTACTCAA SEQ ID NO.1 shRNA2 GGGCAGTCACACCAACATTCA SEQ ID NO.2 shRNA3 GCACTTGCACATCATTTACGA SEQ ID NO.3

[0049] Table 2 shRNA plasmids for knocking down ADNP gene

[0050]

[0051]

[0052] At the same time, an invalid interference sequence shRNA (scramble) was designed as a control group, and the invalid interference sequence shRNA (scramble) is shown in SEQ ID NO.4, and the specific sequence is 5'-CCTAAGGTTAAGTCGCCCTCG-3'. The plasmid number constructed according to the invalid interference sequence shRNA (scramble) is LV-0186, and the vector information is LV-U6-shRNA (scramble)-CMV-EGFP-T2A-Puro-WPRE. (two)

[0054] B16 cells (from the Cell Bank of the Chinese Academy of Sciences) were digested with trypsin and then made into a cell suspension. The cells were inoculated in a 6-well plate at 2 mL / well, with 5 × 10 cells per well. 5 The cells were placed in a 37°C, 5% CO2 incubator and incubated overnight. The next day, three replicate wells were set for each of the above plasmids, 2.0 μg of plasmid was added to each well, and B16 cells were transfected according to the steps in the FuGENE (HD-1000) transfection reagent manual, and the cells were placed in a 37°C, 5% CO2 incubator and incubated for 72 hours.

[0055] TaKaRa MiniBEST Universal RNA Extraction Kit (purchased from TaKaRa, 9767) was used to extract total RNA from cells of the corresponding groups, and HiScriptⅡOne Step qPCR-PCR-SYBR Green Kit (purchased from Vazyme, Q221-01) was used to perform real-time PCR. The MIX used was purchased from TaKaRa, and the primers were from Beijing Qingke Biotechnology Co., Ltd.

[0056] The real-time PCR reaction system was: MIX 10 μL, ddH2O 7.2 μL, forward primer, reverse primer 0.4 μL each, and template 2 μL.

[0057] The real-time PCR reaction program was: 95°C for 3 min; 95°C for 10 s, 60°C for 30 s, for 39 cycles; 65°C for 5 s.

[0058] Table 3 Forward primer and reverse primer sequences

[0059] Primer name Sequence information (5'→3') serial number qADNP-F ACGTGGCAGCACCCTACATA SEQ ID NO.5 qADNP-R TGGCAGTGACCTGATAGCCT SEQ ID NO.6 qmGAPDH-F GCCCATCACCATCTTCCAGGAGCG SEQ ID NO.7 qmGAPDH-R GCAGAAGGGGCGGAGATGATGACC SEQ ID NO.8

[0060] Based on the above experiments, the interference sequence with the best interference effect on the ADNP gene was screened out.

[0061] Results Figure 1 As shown, plasmid LV-1696 has the most significant interference downregulation effect on the target gene ADNP compared with other interference sequences.

[0062] Example 2 (one)

[0064] 293T cells (from the Cell Bank of the Chinese Academy of Sciences) were seeded in 6-well plates supplemented with DMEM complete medium, with 1×10 6 The cells should reach a confluence of 60%-70% on the next day.

[0065] Prepare the transfection system. Pipette 250μL Opti-MEM, add 1.2μg target plasmid LV-1696, 0.9μg lentiviral packaging auxiliary plasmid 1psPAX2 (purchased from BioVector), 0.6μg lentiviral packaging auxiliary plasmid 2pMD2.G (purchased from BioVector), 5.4μL transfection reagent P3000 (purchased from invitrogen), mix well and let stand at room temperature to prepare plasmid mixture A. Pipette 250μL Opti-MEM, add 7.5μL Lipo3000 (purchased from invitrogen), mix well and let stand at room temperature to prepare transfection reagent lipo3000 dilution B. Gently add liquid B to liquid A, mix well and let stand at room temperature for 20 minutes to obtain the transfection system. The transfection system containing the target plasmid LV-0186 is also prepared in the same way.

[0066] 1h before transfection, replace the 293T cell culture medium with serum-free basic DMEM medium and return it to the 37℃ incubator for continued culture. 1h later, take out the six-well plate from the incubator, add 1mL of culture medium to 1mL of transfection system dropwise into the six-well plate, mix gently, and return it to the 37℃ incubator again. 8-12h after transfection, discard the supernatant, replace it with 2mL / well of DMEM complete medium, and continue to culture for 2 days. On the third day after transfection, collect the 293T cell culture medium in a centrifuge tube, centrifuge it at 500g for 10min at room temperature, remove cell debris, and transfer the lentiviral supernatant to a new centrifuge tube. Then filter the lentiviral liquid with a 0.22μm filter. Put the lentiviral liquid in a 100KD lentiviral concentrator tube (Millipore), concentrate it at 3000g for 10min at 4℃, obtain the lentiviral concentrate, and divide it into 20μL / tube, and then store it at -80℃.

[0067] (II) Lentivirus titer detection

[0068] 293T cells were taken and inoculated into 6-well plates, with 2×10 cells per well. 6 , and cultured in a 37°C, 5% CO2 incubator for 12 hours. On the second day, add 20 μL of lentiviral concentrate to each well of 293T cells, and gently shake the 6-well plate to evenly disperse the virus suspension in the culture medium. Place in a 37°C, 5% CO2 incubator and culture for 72 hours.

[0069] The genomic DNA of 293T cells was extracted using a genomic DNA extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., DP304). The number of lentiviral DNA copies integrated into the cell genome was then determined by qPCR.

[0070] The qPCR reaction system was: MIX 10 μL, ddH2O 7.2 μL, forward primer, reverse primer 0.4 μL each, and template 2 μL.

[0071] The qPCR reaction program was: 95°C for 3 min; 95°C for 10 s, 60°C for 30 s, for 39 cycles; 65°C for 5 s.

[0072] Table 4 Forward primer and reverse primer sequences

[0073] Primer name Sequence information (5'→3') serial number qWPRE-F CCGTTGTCAGGCAACGTG SEQ ID NO.9 qWPRE-R AGCTGACAGGTGGTGGCAAT SEQ ID NO.10

[0074] LV-1696 average copy number = 2.52E+04 copies / μL

[0075] LV-0186 average copy number = 4.19E+04 copies / μL

[0076] Virus titer calculation:

[0077] LV-1696Titer (TU / ml) = (2.52E+04) * 100 * 10 / 20 * 1000 = 1.26E+09TU / mL. The titer after calibration is: 2E+8TU / mL.

[0078] LV-0186Titer (TU / ml) = (4.19E+04) * 100 * 10 / 20 * 1000 = 2.10E+09TU / mL. The titer after calibration is: 2E+8TU / mL.

[0079] Example 3

[0080] Neuro-2a cells (purchased from Pronocell Life Science Co., Ltd.) were digested with trypsin to prepare a cell suspension, which was inoculated in a 24-well plate at 1 mL / well. The number of cells per well was 2 × 10 4 The cells were placed in an incubator at 37°C and 5% CO2 and incubated overnight. On the second day, new complete culture medium was replaced, the culture medium volume was changed to 500 μL / well and lentiviral concentrate was added (as the experimental group, shRNA-ADNP group). At the same time, a blank group (Blank group) was set up without adding lentiviral concentrate; a control group was set up, and lentiviral concentrate containing an invalid interference sequence shRNA (scramble) was added (shRNA-Control group). The volume of the corresponding lentiviral concentrate was calculated using the formula "MOI (multiplicity of cell infection) value = (virus titer × virus volume) / number of infected cells".

[0081] The MOI value of Neuro-2a cells was set to 160, and the volume of lentiviral concentrate added was calculated to be 16 μL / well. Place in a 37°C, 5% CO2 incubator for 8 hours. Discard the culture medium containing lentivirus, replace with new complete culture medium, 1 mL / well, and continue to culture in a 37°C, 5% CO2 incubator for 72 hours. Then observe the transfection efficiency under an inverted fluorescence microscope, and it is advisable to achieve a transfection efficiency of 80%-90%. It was observed that the infected cells did not reach 80%, so the cells were treated with drug screening to screen out more infected cells.

[0082] Screening of stable cell lines. Add 2.5 μg / ml puromycin to the transfected cell culture medium, place in an incubator at 37°C and 5% CO2 for 48 hours, replace with new complete culture medium and observe the screening efficiency under an inverted fluorescence microscope. The number of transfected cells has reached 90%, basically achieving complete screening.

[0083] Western blot experiments were performed on the above transfected Neuro-2a cells to determine the expression of ADNP in different treatment groups.

[0084] Results Figure 2 As shown, the expression level of ADNP gene in the shRNA-ADNP group cells was significantly reduced, which means that the neuronal cell model with ADNP gene silencing was successfully constructed.

[0085] Example 4 (one)

[0087] Continue to culture the stable cell line, and prepare the transfected cells into cell pellets for studying the regulatory effect of ADNP on microtubule-associated proteins (MAPs) and tubulin. The steps are as follows: trypsinize Neuro-2a cells to make a cell suspension, centrifuge at 1000rpm for 5min, and discard the supernatant. Add PBS to blow the cell pellet, count the cells, centrifuge at 1000rpm for 5min, discard the supernatant, keep the cell pellet, and put it at 4℃ for use.

[0088] The cell pellet was used to extract protein, and Western blot experiments were performed to verify the expression level of ADNP in Neuro-2a cells and the regulatory effect of ADNP on microtubules and related proteins.

[0089] Protein extraction: Prepare RIPA, PMSF, and phosphatase inhibitors in the lysis buffer at a volume ratio of 100:1:1, pre-cool, and add 1×10 4 Each cell was added with 100 μL lysis buffer to lyse the cells; after lysis, the cells were incubated on ice for 30 min, centrifuged at 12000 rpm for 15 min, and the supernatant was taken as the protein extract.

[0090] Concentration measurement: The protein concentration of the experimental group and the control group was measured using the BCA protein concentration assay kit, and the loading volume of the Western blot experiment was calculated based on the loading amount of 20 μg of total protein.

[0091] Protein denaturation: Add 5× loading buffer to the protein extract, boil at 95°C for 10 min, cool and store at -20°C for later use.

[0092] SDS-PAGE gel electrophoresis: Electrophoresis: Prepare 10% separation gel, set the power supply voltage to 60V or 90V after loading, adjust the voltage to 200V after bromophenol blue enters the lower gel, and stop electrophoresis when it reaches the bottom of the gel. Transfer: Use transfer clips to clamp the gel, 0.45μm PVDF membrane, filter paper, and sponge in a sandwich method, put them into the transfer tank, adjust the voltage to 100V, and time 1.5h. Wash the membrane once with TBST for 10min. Block with fast blocking solution at 37℃ for 30min. Wash the membrane 3 times with TBST, 10min each time. Add primary antibody (see Table 5 for details) for incubation at 4℃ overnight. Wash the membrane 3 times with TBST, 10min each time. Add secondary antibody (see Table 6 for details) for incubation, and incubate at 37℃ for 2h. Wash the membrane 3 times with TBST, 10min each time. Expose in a fully automatic chemiluminescence system after adding ECL developer.

[0093] Table 5 Primary antibody composition

[0094] Antibody factory Molecular weight Dilution ratio ADNP SantaCruz(sc-393377) 150kDa 1：500 MAP6(STOP) CellSignalingTechnology(#4265) 120 kDa 1：1000 MAP2 ABclonal(A22206) 75kDa 1：3000 Tau SantaCruz(sc-32274) 46-80 kDa 1：500 p-Tau abcam(ab32057) 50-79 kDa 1：1000 α-Tubulin CellSignalingTechnology(#2125s) 52kDa 1：1000 Acetyl-Tubulin Sigma(T7451) 52kDa 1：5000 β-actin Bioss(bs-0061R) 42kDa 1：10000

[0095] Table 6 Secondary antibody composition

[0096] Antibody factory Dilution ratio HRP-labeled goat anti-rabbit IgG Servicebio(GB23303) 1：3000 HRP-labeled goat anti-mouse IgG EARTHOX(E030110-01) 1：12000

[0097] Results Figure 3 As shown in the figure, after ADNP gene was downregulated in Neuro-2a cells in the shRNA-ADNP group, microtubule-associated proteins MAP6, MAP2 and Tau were significantly downregulated, and p-Tau was significantly increased, with statistically significant differences. The expression of tubulin α-Tubulin did not change, but the expression of acetylated tubulin Acetyl-Tubulin was downregulated, with statistically significant differences. (two)

[0099] Untransfected cells were prepared into cell pellets for protein extraction, and COIP experiments confirmed the interaction between ADNP and MAP6 in Neuro-2a cells.

[0100] The cell precipitate was prepared and the protein was extracted using the same process as above, and the extracted protein solution was then divided into three groups for labeling, including Input (positive control), IgG (negative control), and Ip (experimental group).

[0101] Antigen-antibody binding: ADNP and mouse IgG (purchased from Biyuntian, A7028) were calculated according to the dosage for COIP in the antibody manual, and added to the protein solution of Ip and IgG groups respectively, and incubated at 4°C overnight to allow antigen-antibody binding.

[0102] Antigen-antibody conjugates and magnetic beads: Calculate the amount of magnetic beads according to the instructions of the immunoprecipitation kit (purchased from Biyuntian, P2179S), pipette the required amount of magnetic beads into a clean centrifuge tube, wash the magnetic beads with TBST, separate them on a magnetic stand, remove the supernatant and keep the magnetic beads. Wash 3 times, and finally resuspend the magnetic beads with TBST according to the original volume of magnetic beads, and add them to the protein solutions of Ip and IgG groups respectively. Place on a flip mixer and incubate at room temperature for 2 hours to allow the antigen-antibody conjugate to bind to the magnetic beads.

[0103] Wash the antigen-antibody-magnetic bead complex: Place the incubated Ip and IgG centrifuge tubes on a magnetic rack for separation, remove the supernatant and keep the magnetic bead precipitate, and use the prepared lysis buffer to wash the magnetic beads three times according to the steps in "Antigen-antibody conjugate and magnetic bead binding". Finally, place them on a magnetic rack for separation, remove the supernatant and keep the magnetic bead precipitate.

[0104] Protein denaturation: Add 100 μL of 1× loading buffer to each 20 μL original volume of magnetic beads and add it to the centrifuge tubes of the Ip and IgG groups, resuspend the magnetic beads, boil them at 95°C for 20 minutes, cool them and store them at -20°C for later use. For the Input group, follow the procedure of “add 5× loading buffer to the protein extract, boil them at 95°C for 10 minutes, cool them and store them at -20°C for later use”.

[0105] SDS-PAGE gel electrophoresis: Follow the same steps as above. Add ADNP and MAP6 antibodies to the primary antibody for incubation.

[0106] Results Figure 4 As shown, after incubation with ADNP antibody in the Ip group, a band appeared, indicating that ADNP was successfully pulled down. After incubation with MAP6 antibody in the Ip group, a band appeared, indicating that MAP6 was pulled down while ADNP was pulled down, confirming the interaction between ADNP and MAP6 in Neuro-2a cells.

[0107] From the above, it can be seen that the shRNA plasmid for knocking down the ADNP gene of the present invention is used to obtain a lentivirus containing the shRNA sequence for knocking down the ADNP gene, and then transfecting Neuro-2a cells, and screening the stable cell line through drugs, and successfully constructing a neuronal cell model that can stably silence the ADNP gene. The present invention can successfully construct a stable cell model, which has the advantages of being simple and easy to obtain relative to the animal model, and the cell activity is good and easy to culture, and it can be more conveniently and quickly applied to experiments, and has good application value for the research on cytoskeleton microtubules.

[0108] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A reagent for silencing the ADNP gene, characterized in that: Includes shRNA plasmids for knocking down the ADNP gene.

2. The reagent according to claim 1, characterized in that The functional sequence in the shRNA plasmid for knocking down the ADNP gene includes shRNA1, shRNA2 or shRNA3; The sequence of the shRNA1 is shown as SEQ ID NO.1, the sequence of the shRNA2 is shown as SEQ ID NO.2, and the sequence of the shRNA3 is shown as SEQ ID NO.

3.

3. A method for constructing a neuron cell model with ADNP gene silencing, characterized in that: The steps include: (1) configuring a transfection system comprising the shRNA plasmid for knocking down the ADNP gene according to claim 1 and a lentiviral packaging auxiliary plasmid to co-transfect the cells to be transfected, then separating the lentiviral supernatant, filtering and concentrating it to obtain a lentiviral concentrate; (2) The Neuro-2a cell suspension is inoculated into a culture medium for culture, and then the above-mentioned lentiviral concentrate is added for transfection, and then the culture medium containing the above-mentioned lentiviral concentrate is discarded, and new culture medium and screening drugs are added for stable transfection culture.

4. The construction method according to claim 3, characterized in that: The transfection system in step (1) comprises a plasmid mixture A and a transfection reagent lipo3000 dilution B; The lentiviral packaging helper plasmid includes lentiviral packaging helper plasmid 1 and lentiviral packaging helper plasmid 2; The plasmid mixture A comprises 240-260 μL Opti-MEM, 1-1.4 μg of the shRNA plasmid for knocking down the ADNP gene according to claim 1, 0.8-1 μg of lentiviral packaging auxiliary plasmid 1, 0.5-0.7 μg of lentiviral packaging auxiliary plasmid 2 and 5-6 μL of transfection reagent P3000.

5. The construction method according to claim 3, characterized in that: The step (1) includes a centrifugal treatment before the concentration, the centrifugal speed is 2800-3200g, the centrifugal time is 8-12min, and the centrifugal temperature is 3-5°C.

6. The construction method according to claim 3, characterized in that: The concentration of the cell suspension in step (2) is (1-3)×10 4 Pieces / mL.

7. The construction method according to claim 3, characterized in that: The MOI value of the Neuro-2a cells in step (2) is 155-165.

8. The construction method according to claim 3, characterized in that: The screening drug in step (2) is puromycin, and the concentration of puromycin is 2-3 μg / mL.

9. The construction method according to claim 3, characterized in that: The culture temperature in step (2) is 35-38°C.

10. Use of the ADNP gene-silenced neuronal cell model obtained by the construction method according to any one of claims 3 to 9 in screening products for regulating the expression level of microtubule-associated proteins and / or tubulin.

Images